Yeast for realizing green circulating production of selenium-enriched yeast and application of yeast

Abstract

The invention discloses a yeast capable of realizing green cycle production of selenium-enriched yeast and application of the yeast, Saccharomyces cerevisiae HGL201 with selenium-enriched ability is screened out, the Saccharomyces cerevisiae HGL201 is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation time is May 17, 2024, and the preservation number is CGMCC: 30662. The yeast HGL201 can effectively treat the main pollutant inorganic selenium in the industrial selenium-enriched yeast fermentation waste liquid, and the residual inorganic selenium in the treated waste liquid reaches 90% or above. The treated waste liquid does not affect the normal fermentation process and can replace 60%-80% of water for a culture medium, and green production circulation of the selenium-enriched yeast waste liquid is achieved.

Description

Technical Field

[0001] The invention belongs to the technical field of biological fermentation, and in particular relates to a yeast for realizing green cycle production of selenium-enriched yeast and an application thereof. Background Art

[0002] Selenium (Se) is a trace element with a small concentration gap between toxicity and necessity, and is essential for the normal function of humans and animals. This trace element plays an important role in physiological functions such as anti-oxidation, immune regulation, and participation in thyroid hormone metabolism, and can prevent cancer, cardiovascular disease, and diabetes. Selenium exists in nature mainly in the form of organic selenium and inorganic selenium, and the selenium required by the human body is usually supplemented in the form of organic selenium and inorganic selenium. The method and dosage of supplementation have positive or negative effects on its health. Although selenium usually enters the food chain through plants absorbing inorganic selenium from the soil and converting it into organic selenium, the selenium content obtained is often insufficient to meet the developmental needs of humans and animals. Therefore, it is necessary to supplement selenium-rich foods in the diet of humans and animals.

[0003] Selenium-enriched yeast is yeast cultured in a medium containing inorganic selenium to obtain yeast rich in organic selenium. By using selenium supplements including sodium selenite (Na2SeO3), sodium hydrogen selenite (NaHSeO3), etc., inorganic selenium is combined with protein through biotransformation to form selenomethionine, etc. Under appropriate conditions, yeast can use soluble sugars and organic acids to produce high-protein biomass, while accumulating and converting a large amount of selenium into organic selenium-containing compounds, the main form of which is selenomethionine, which is a good source of selenium for humans and animals.

[0004] The industrial production of selenium-enriched yeast requires a large amount of water and generates a large amount of wastewater every day, which contains unconverted inorganic selenium, which is highly toxic to organisms. At present, the selenium-enriched yeast fermentation waste liquid on the market is mainly made into selenium-containing fertilizers through mixing, stirring and drying with other raw materials for reuse. This method of treating waste liquid is costly and requires professional machinery and equipment, which is difficult to implement for small and medium-sized factories. Summary of the invention

[0005] Purpose of the invention: In view of the problems existing in the prior art, the present invention provides a strain of brewer's yeast (Saccharomyces cerevisiae) HGL201 that can achieve green recycling production of selenium-enriched yeast. The yeast has both high selenium-enriching ability and good fermentation performance, so as to solve the high cost problem of recycling and reusing inorganic selenium in selenium-enriched yeast fermentation waste liquid.

[0006] Technical solution: In order to achieve the above-mentioned purpose, the brewer's yeast (Saccharomyces cerevisiae) HGL201 described in the present invention, which can realize the green recycling production of selenium-enriched yeast, has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, the preservation time is May 17, 2024, and the preservation number is CGMCC: 30662.

[0007] The invention discloses an application of the brewer's yeast HGL201 with high selenium-enriching ability in the green recycling and reproduction of selenium-enriched yeast fermentation waste liquid.

[0008] Among them, the brewer's yeast HGL201 with high selenium enrichment ability is used in the green circulation production of highly removing inorganic selenium in selenium-enriched yeast fermentation broth.

[0009] The specific application steps are as follows:

[0010] (1) Primary seed preparation: Saccharomyces cerevisiae HGL201 was inoculated into a plate culture medium for culture, a single colony was selected and cultured in a test tube culture medium, and then inoculated into a liquid shake flask culture medium for culture;

[0011] (2) Preparation of secondary seeds: inoculating the primary seed solution into the secondary seed culture medium for cultivation;

[0012] (3) High-density fermentation: The secondary seed liquid is inoculated into a high-density fermentation medium, cultured in a tank, and aerated and stirred to obtain a high-biomass Saccharomyces cerevisiae HGL201;

[0013] (4) Fermentation waste liquid treatment: Saccharomyces cerevisiae HGL201 was added to the fermentation waste liquid, the pH was adjusted, and the culture was aerated and stirred;

[0014] (5) Fermentation waste liquid recovery: collect the supernatant by centrifugation; the treated supernatant can replace the water required for fermentation and directly replace the water in the fermentation medium for high-density fermentation of various yeasts.

[0015] In step (1), the saccharomyces cerevisiae HGL201 is inoculated into a plate culture medium for 36-48 hours and a culture temperature of 28-30°C; a single colony is selected for culture in a test tube culture medium for 20-24 hours and a culture temperature of 28-30°C. The inoculation volume ratio is 2-3%, and the inoculation volume ratio is 2-3%, and the inoculation volume ratio is 20-24 hours and a culture temperature of 28-30°C; and the inoculation volume ratio is 4-5%, and the inoculation volume ratio is 4-5%, and the inoculation volume ratio is 20-24 hours and a culture temperature of 28-30°C.

[0016] Wherein, in step (2), the primary seed liquid is inoculated into the secondary seed culture medium at an inoculation amount of 5-10%, and cultured in a constant temperature shaker at 200-220 rpm for 20-24 hours at a culture temperature of 28-30°C.

[0017] The secondary seed liquid in step (3) is centrifuged and then resuspended, inoculated into a high-density fermentation medium, and the inoculation amount is 40-60 g / L. The culture is carried out in a tank with ventilation and stirring at a temperature of 28-30° C. to obtain a high-biomass cerevisiae yeast HGL201.

[0018] In step (4), the brewer's yeast HGL201 obtained in step (3) is inoculated into a fermentation tank containing fermentation waste liquid, the inoculation amount is 50-100 g / L wet weight, the tank is cultured for 8-10 hours, the pH is adjusted to 2.5-3.0, the temperature is adjusted to 40-45° C., and the rotation speed is 200-300 rpm.

[0019] In step (5), the yeast is centrifuged at 8000-9000 rpm to collect the supernatant, and the collected supernatant is used for high-density fermentation in different proportions.

[0020] The components of the plate culture medium are as follows by mass percentage: 1-3% yeast powder, 1.5-4% peptone, 1.5-4% glucose and 1.5-4% agar; the components of the test tube culture medium are as follows by mass percentage: 1-3% yeast powder, 1.5-4% peptone, 1.5-4% glucose; the components of the shake flask culture medium are as follows by mass percentage: 1-3% yeast powder, 1.5-4% peptone, 1.5-4% glucose.

[0021] The secondary seed culture medium comprises the following components in percentage by mass: 3-5% glucose, 0.1-0.5% KCL, 0.1-0.5% MgSO4, 0.1-0.5% KH2PO4, 0.3-0.6% urea, 0.03-0.05% CaCl2 and 0.01-0.05% PTM1.

[0022] Among them, the components of the high-density fermentation culture medium base are as follows (mass percentage): 1.5-2.5% glucose, 0.5-0.8% KCL, 0.5-0.8% MgSO4, 0.01-0.03% CaCL2, 1-3% urea, 1-3% KH2PO4 and 0.4-0.5% PTM1 solution; the components of the high-density fermentation culture medium flow addition are as follows (mass percentage): 3-5% glucose, 0.4-0.6% urea, 0.1-0.3% KH2PO4, 0.1-0.3% KCL, 0.1-0.3% MgSO4 and 0.4-0.5% PTM1 solution.

[0023] Wherein, the fermentation waste liquid culture medium has the following components (mass percentage): 100% fermentation waste liquid.

[0024] The fermentation substrate culture medium has the following components (mass percentage): 0.5-0.8% glucose, 0.15-0.2% KCL, 0.15-0.2% MgSO4, 0.003-0.005% CaCL2 and 0.35-0.4% PTM1 solution; the treated yeast production waste liquid (i.e., supernatant) replaces the water for preparing the fermentation substrate culture medium in different proportions; the pH of the treated yeast production waste liquid (i.e., supernatant) is adjusted to 6.0 using HCL and NaOH; the fed-batch fermentation culture medium has the following components (mass percentage): 20-25% glucose, 0.4-0.5% PTM1 solution, 1-3% KH2PO4 and 3-5% urea. The treated yeast production waste liquid replaces the water for preparing the fed-batch fermentation culture medium in different proportions.

[0025] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0026] The present invention has separated and screened a yeast strain HGL201 for the first time, which can highly remove inorganic selenium from selenium-enriched yeast fermentation waste liquid. The yeast has both high selenium-enriching ability and good fermentation performance, and can effectively treat a large amount of waste water generated in yeast selenium-enriched industrial production, and enrich and transform the inorganic selenium therein, so as to realize the reuse of selenium-enriched yeast industrial production waste liquid. The strain HGL201 of the present invention treats inorganic selenium, a main toxic pollutant in yeast selenium-enriched production waste liquid, through biological adsorption, and adsorbs more than 90% of the residual inorganic selenium in yeast selenium-enriched production waste liquid. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the colony morphology of strain HGL201 on the YPD plate;

[0028] Figure 2 This is the cell morphology of strain HGL201 under a microscope;

[0029] Figure 3 The growth of yeast in the wastewater medium after reuse at different proportions;

[0030] Figure 4 Yeast fermentation process without using fermentation wastewater to replace experimental water;

[0031] Figure 5 60% of the treated yeast selenium-enriched production wastewater is reused in the yeast fermentation process;

[0032] Figure 6 80% of the treated yeast selenium-enriched production wastewater is reused in the yeast fermentation process. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0034] Unless otherwise specified, the raw materials and reagents in the present invention are commercially available.

[0035] The present invention provides a selenium-enriched brewer's yeast (Saccharomyces cerevisiae) HGL201, which is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration Committee, and the deposit number is CGMCCNO.30662. The strain provided by the present invention treats inorganic selenium, a main toxic pollutant in yeast selenium-enriched production waste liquid, through biological adsorption, and can adsorb more than 90% of the residual inorganic selenium in the yeast selenium-enriched production waste liquid. The yeast of the present invention can convert inorganic selenium into organic selenium.

[0036] In the present invention, the high biomass yeast is inoculated into the fermentation waste liquid culture medium for cultivation. The supernatant obtained by centrifuging the fermentation liquid after cultivation can replace the deionized water required for the YPD liquid culture medium at a volume ratio of 20%, 40%, 60%, 80%, or 100%.

[0037] In the present invention, the inoculation amount of the yeast HGL201 in the fermentation waste liquid culture medium is 80-100 g / L.

[0038] In the present invention, part of the deionized water in the fermentation substrate medium is replaced by the fermentation waste liquid containing inorganic selenium after treatment, and glucose, KCL, MgSO4 and CaCL2 are sterilized by high pressure steam at 115°C for 20 minutes. After cooling, the filtered and sterilized PTM1 solution is added and then the strain is inoculated.

[0039] In the embodiment of the present invention, each culture medium adopts the following specific combination:

[0040] The components of the plate culture medium are as follows by mass percentage: 1% yeast powder, 2% peptone, 2% glucose and 2% agar, and the solvent is deionized water.

[0041] The components of the test tube culture medium are as follows by mass percentage: 1% yeast powder, 2% peptone, 2% glucose, and the solvent is deionized water; the components of the shake flask culture medium are as follows by mass percentage: 1% yeast powder, 2% peptone, 2% glucose, and the solvent is deionized water.

[0042] The secondary seed culture medium is composed of the following mass percentages: 4% glucose, 0.2% KCL, 0.2% MgSO4, 0.2% KH2PO4, 0.5% urea, 0.03% CaCl2 and 0.0435% PTM1 (trace elements, brand SHMCC, T1801), and the solvent is deionized water.

[0043] The components of the high-density fermentation medium base are as follows (mass percentage): 1.75% glucose, 0.775% KCL, 0.72% MgSO4, 1% KH2PO4, 1% urea, 0.03% CaCL2 and 0.435% PTM1 solution; the solvent is deionized water.

[0044] The high-density fermentation medium feed composition is as follows (mass percentage): 4% glucose, 0.2% KCL, 0.2% MgSO4, 0.2% KH2PO4, 0.5% urea, 0.435% PTM1 solution, and the solvent is deionized water.

[0045] The fermentation substrate culture medium has the following components (mass percentage): 0.6% glucose, 0.18% KCL, 0.18% MgSO4, 0.005% CaCL2 and 0.38% PTM1 solution; the solvent is the treated yeast production waste liquid (i.e., supernatant) replacing the fermentation substrate culture medium preparation water in different proportions; the pH of the treated yeast production waste liquid (i.e., supernatant) is adjusted to 6.0 using HCL and NaOH;

[0046] The components of the fed-batch fermentation medium are as follows by mass percentage: 20% glucose, 0.435% PTM1 solution, 1.2% KH2PO4 and 4.2% urea, and the solvent is the treated yeast production waste liquid (i.e., supernatant) replacing the water for preparing the fermentation base medium in different proportions; the pH of the treated yeast production waste liquid (i.e., supernatant) is adjusted to 6.0 using HCL and NaOH.

[0047] The present invention adopts conventional dissolved oxygen linkage for the flow addition of the fed-batch fermentation medium, and the dissolved oxygen is controlled to fluctuate around 30% by the carbon source.

[0048] Example 1

[0049] Soil was collected from the fruit trees near the School of Life Science and Food Engineering, Meicheng Road Campus, Huaiyin Institute of Technology. -1 Suspension, the main method is to weigh 10g of soil, put it into a conical flask, pour in 90ml of sterile water, and shake for 20 minutes. Inoculate Martin medium with a volume ratio of 5% and culture for 48 hours. Dilute and spread on a YPD solid plate with a pH of 2.5 and culture at 30°C for 48 hours. Select colonies with better growth and inoculate them into YPD liquid culture medium containing 500mg / L sodium selenite, shake at 30°C, 200rpm for 36 hours, take the bacterial liquid and spread it on a solid culture medium containing 500mg / L YPD, and select the best growing strain named HGL201.

[0050] A single colony of HGL201 was inoculated into YPD liquid medium, cultured for 24 hours, streaked onto a YPD plate, and cultured at 30°C for 48 hours. The colony was milky white, with wrinkles on the surface, neat edges, a bulge in the middle, and was moist and easy to pick up. Figure 1 Observing the morphology under a microscope, the cells are oval and reproduce by budding. Figure 2 . Pick a single colony of HGL201 and transfer it to YPD liquid culture medium, culture it for 24 hours, take 2 ml of fresh bacterial solution for sequencing, enter the NCBI website BLAST, and identify it by 18SrRNA gene. The strain sequence (SEQ ID NO.1) has the highest similarity with Saccharomyces cerevisiae, with a match degree of 97.87%. After comparison and physiological and biochemical determination, the strain HGL201 was identified as selenium-enriched yeast (Saccharomycescerevisiae), which has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration, with a deposit address of Beijing, China, a deposit date of May 17, 2024, and a deposit number of CGMCC: 30662.

[0051] SEQ ID NO.1:

[0052] ACCTCTCTTTGGAAAAAAAACATCCAATGAAAAGGCCAGCAATTTCAAGTTAACTCCAAAGAGTATCACTCACTACCAAACAGAATGTTTGAGAAGGAAATGACGCTCAAACAGGCATGCCCCTGGAATACCAAGGCCCGCAATGTGCG TTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGTAGCGAGAACCAAGAGATCCGTTGTTGAAAGTTTAATATTTTAAAATTTCCAGTTACGAATTTTCTTGTTTTTGACAAAA ATTTAATGAATAGATAAAATTGTTTGTGTTTGTTACCTCTGGGCCGATTGCTCGAATGCCCAAAGAAAAAGTTGCAAAGATATGAAAACTCCACAGTGTGTTGTATTGAAACGGTTTTAATTGTCCTATAACAAAAGCACAGAAATCTCT CACCGTTTGGAATAGCAAGAAAGAAACTTACAAGCCTAGCAAGACCGCGCACTTAAGGCAGGCCGGCTGGACTCTCCATCTCTTGTCTTCTTGCCCAGTAAAAGCTCTCATGCTCTTGCCAAAACAAAAAAATCCATTTCAAAATTATAAA

[0053] Example 2

[0054] Yeast HGL201 was inoculated into a plate culture medium and cultured for 48 hours at 30°C; a single colony was selected for culture in a test tube culture medium and cultured for 24 hours at 30°C; the liquid shake flask culture medium was inoculated at a volume ratio of 2% and cultured for 24 hours at 30°C; the liquid shake flask culture medium was then inoculated again at a volume ratio of 5% and cultured for 24 hours at 30°C to prepare a primary seed solution.

[0055] The primary seed liquid was inoculated into the secondary seed culture medium at a volume ratio of 10%, and the culture was placed in a constant temperature shaker at 200 rpm for 24 hours at a culture temperature of 30°C.

[0056] The secondary seed was centrifuged at 8000 rpm for 5 min, the supernatant was removed and the precipitate was inoculated into a high-density fermentation medium with an inoculation amount of 50 g / L in the upper tank for culture. Aeration and stirring were turned on, the aeration volume was 2.5 VVM, stirring was 250 rpm, the temperature was 30°C, and the culture was carried out for 24 h. The seed was centrifuged at 8000 rpm for 5 min, the supernatant was removed and the precipitate was obtained to obtain the wet weight yeast HGL201.

[0057] Example 3

[0058] The wet weight yeast HGL201 was fermented in a fermenter at 80g / L. The fermenter composition was: 100% factory yeast selenium-enriched fermentation waste liquid. HCl and NaOH were used to adjust the pH to 2.5, and ventilation and stirring were turned on. The ventilation volume was 2.5VVM, the speed was 250rpm, and the temperature was 45℃ for 8h. After the end, the supernatant was collected by centrifugation and stored in a refrigerator at 4℃.

[0059] Take 1mL of the untreated supernatant of the centrifuged selenium-enriched fermentation waste liquid of yeast from the factory and the supernatant of the treated waste liquid to two 100mL volumetric flasks, use ultrapure water to make them dilute to the mark, cover the bottle stopper, and invert the volumetric flask several times to mix the solution thoroughly. Take 250μL of the solution from the volumetric flask, transfer it to a 25mL volumetric flask, use 20% HCL to make it dilute to the mark, cover the bottle stopper, and invert the volumetric flask several times to mix the solution thoroughly. Use atomic fluorescence spectrometry to determine the supernatant of the waste liquid before and after treatment. After testing, the inorganic selenium concentration of the untreated waste liquid supernatant was 150mg / L, and the inorganic selenium concentration of the treated waste liquid supernatant was 13mg / L, and the removal of residual inorganic selenium was more than 90%.

[0060] The treated fermentation waste liquid supernatant was used in a certain proportion to replace the deionized water used to prepare the yeast culture medium. Six gradients of 0%, 20%, 40%, 60%, 80%, and 100% were set. For example, 60% means that the supernatant volume accounts for 60%, and deionized water accounts for 40%. The composition of the 50ml / 250ml shake flask culture medium is: 2% glucose, 2% peptone and 1% yeast powder. The pH of the culture medium was adjusted to 6.0 using HCL and NaOH, and three parallel experiments were set for each gradient.

[0061] The yeast HGL201 bacterial liquid in the logarithmic growth phase was inoculated into the above-prepared culture medium at an inoculation rate of 2% by volume, and cultured in a shaker at 30°C and 250rpm for 24 hours. After 24 hours, samples were taken, 1mL of fermentation liquid was taken into a centrifuge tube, centrifuged at 10000rpm for 2 minutes, the supernatant was discarded, and then placed in a forced air drying oven at 60°C to dry to constant weight and weighed, and the dry weight of the bacterial biomass in the tube was calculated. The dry weight of the biomass of the waste liquid ranging from 0% to 100% concentration was 9.46g / L, 9.42g / L, 8.87g / L, 8.63g / L, 8.38g / L and 7.00g / L, respectively. The inhibition rates of yeast growth by yeast culture medium fermentation wastewater in different proportions were 0%, 0.4%, 6.3%, 8.8%, 11.4%, 26%, respectively. The results are shown in the figure. Figure 3 .

[0062] The inhibition rate of yeast growth by yeast selenium-enriched production wastewater after different proportions of yeast culture medium reuse is calculated as follows:

[0063]

[0064] Y: inhibition rate (%); X1: yeast culture medium containing treated fermentation waste liquid, after 24 hours of culture, yeast biomass dry weight (g / L); X0: yeast culture medium without fermentation waste liquid, after 24 hours of culture, yeast biomass dry weight (g / L). When the inhibition rate is defined as 10%, the fermentation waste liquid replacement ratio is the minimum inhibitory concentration.

[0065] From the above results, it can be seen that the 60% and 80% gradients can not only ensure the maximum usage of the treated fermentation liquid, but also effectively meet the growth of yeast.

[0066] Example 4

[0067] Pick a single colony of Saccharomyces cerevisiae (CCTCC WY 2008183) to 50ml / 250ml YPD medium, culture at 250rpm, 30℃ for 22 hours. Then transfer 10% of the volume ratio to 3 bottles of 50ml / 250ml YPD medium, culture at 250rpm, 30℃ for 22 hours. Transfer all to 3 bottles of 500ml / 2000ml YPD medium, culture at 250rpm, 30℃ for 22 hours. Centrifuge at 8000rpm for 5min, resuspend the bacteria in 150ml sterile water for inoculation.

[0068] Fermentation was carried out in a 5L fermenter with 1.3L fermentation substrate medium, the pH value of the medium was adjusted to 6.0, and the temperature was 30°C. When the flow addition signal was issued (the dissolved oxygen rose rapidly, and the slope of the dissolved oxygen curve of the fermenter would rapidly increase in a short period of time), 1.7L of fed-batch fermentation medium was used for fed-batch addition, and the ventilation volume was ventilated according to a ventilation ratio of 1:1.5, and the dissolved oxygen floated around 30%. During the flow addition process, when the pH was lower than 3, it was adjusted to 4 with ammonia water. The flow addition was continued for 12h. 1mL of fermentation broth was taken into a centrifuge tube of known weight, centrifuged at 10000rpm for 2min, the supernatant was discarded, the bacteria were washed 3 times with deionized water, the supernatant was gently shaken off, and the weight was measured when no obvious liquid remained on the wall of the tube, and the wet weight of the bacteria biomass in the tube was calculated, and the final wet weight reached 235g / L. The water used for the fermentation substrate medium and the fed-batch fermentation medium in this example is deionized water. See the results Figure 4 .

[0069] Example 5

[0070] Example 5 According to the method of Example 4, the water used in the fermentation base medium and the fed batch fermentation medium of this example is 60% of the supernatant of the yeast selenium-enriched fermentation waste liquid (prepared in Example 3) and 40% of deionized water, and the final wet weight reaches 227g / L. The results are shown in Figure 5 .

[0071] Example 6

[0072] Example 6 According to the method of Example 4, the water used in the fermentation base medium and the fed batch fermentation medium of this example is 80% of the supernatant of the yeast selenium-enriched fermentation waste liquid (prepared in Example 3) and 40% of deionized water, and the final wet weight reaches 213g / L. The results are shown in Figure 6 .

[0073] It can be seen from the above examples that the fermentation waste liquid prepared by the yeast strain HGL201 in the present invention can effectively replace deionized water for biological fermentation, and its effect is almost the same as that of the culture medium prepared with deionized water.

Claims

1. A strain of brewer's yeast (Saccharomyces cerevisiae) HGL201 that can realize the green recycling production of selenium-enriched yeast has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on May 17, 2024, and the deposit number is CGMCC: 30662.

2. An application of the brewer's yeast HGL201 described in claim 1 in the green recycling of selenium-enriched yeast fermentation waste liquid.

3. The use according to claim 2, characterized in that: The cerevisiae yeast HGL201 is preferably used in the green circulation production for highly removing inorganic selenium in selenium-enriched yeast fermentation broth.

4. The use according to claim 2 or 3, characterized in that: The specific application steps are as follows: (1) Primary seed preparation: Saccharomyces cerevisiae HGL201 was inoculated into a plate culture medium for culture, a single colony was selected and cultured in a test tube culture medium, and then inoculated into a liquid shake flask culture medium for culture; (2) Preparation of secondary seeds: inoculating the primary seed solution into the secondary seed culture medium for cultivation; (3) High-density fermentation: The secondary seed liquid is inoculated into a high-density fermentation medium, cultured in a tank, and aerated and stirred to obtain a high-biomass Saccharomyces cerevisiae HGL201; (4) Fermentation waste liquid treatment: Saccharomyces cerevisiae HGL201 was added to the fermentation waste liquid, the pH was adjusted, and the culture was aerated and stirred; (5) Fermentation waste liquid recovery: collect the supernatant by centrifugation; the treated supernatant can replace the water required for fermentation and be used for high-density fermentation of various yeasts.

5. The use according to claim 4, characterized in that: In step (1), yeast HGL201 is inoculated into a plate culture medium for 36-48 hours at a temperature of 28-30° C.; a single colony is selected for incubation in a test tube culture medium for 20-24 hours at a temperature of 28-30° C.; an inoculation volume ratio of 2-3% is inoculated into a liquid shake flask culture medium for 20-24 hours at a temperature of 28-30° C.; and then the liquid shake flask culture medium is inoculated again for culturing at a volume ratio of 4-5%, a culturing time of 20-24 hours, and a culturing temperature of 28-30° C.

6. The use according to claim 4, characterized in that: In step (2), the primary seed liquid is inoculated into the secondary seed culture medium at a volume ratio of 5-10%, and the culture is placed in a constant temperature shaker at 200-220 rpm for 20-24 hours at a culture temperature of 28-30°C.

7. The use according to claim 4, characterized in that: In step (3), the secondary seed liquid is centrifuged and then resuspended and inoculated into a high-density fermentation medium with an inoculation amount of 40-60 g / L. The medium is cultured in a tank with ventilation and stirring at a temperature of 28-30° C. to obtain a high-biomass Saccharomyces cerevisiae yeast HGL201.

8. The use according to claim 4, characterized in that: Step (4) The yeast HGL201 obtained in step (3) is inoculated into a fermentation tank containing fermentation waste liquid, with an inoculation amount of 80-100 g / L wet weight, and cultured in the tank for 8-10 hours, with the pH adjusted to 2.5-3.0, the temperature adjusted to 40-45° C., and the rotation speed adjusted to 200-300 rpm.

9. The use according to claim 4, characterized in that: Step (5) Centrifuge the yeast at 8000-9000 rpm and collect the supernatant.

10. The use according to claim 4, characterized in that: The components of the plate culture medium are as follows by mass percentage: 1-3% yeast powder, 1.5-4% peptone, 1.5-4% glucose and 1.5-4% agar, and the balance is water; the components of the test tube culture medium are as follows by mass percentage: 1-3% yeast powder, 1.5-4% peptone, 1.5-4% glucose, and the balance is water; the components of the shake flask culture medium are as follows by mass percentage: 1-3% yeast powder, 1.5-4% peptone, 1.5-4% glucose, and the balance is water; the components of the secondary seed culture medium are as follows by mass percentage: 3-5% glucose, 0.1-0.5% KCL, 0.1-0.5% MgSO4, 0.1-0.5% KH2PO4, 0.3-0.6% urea, 0. 03-0.05% CaCl2 and 0.01-0.05% PTM1, the balance is water; the high-density fermentation medium components are as follows in percentage by mass: 1.5-2.5% glucose, 0.5-0.8% KCL, 0.5-0.8% MgSO4, 0.01-0.03% CaCL2, 1-3% urea, 1-3% KH2PO4 and 0.4-0.5% PTM1, the balance is water; the high-density fermentation medium feed components are as follows in percentage by mass: 3-5% glucose, 0.4-0.6% urea, 0.1-0.3% KH2PO4, 0.1-0.3% KCL, 0.1-0.3% MgSO4, 0.4-0.5% PTM1, the balance is water.

Images