Outer membrane vesicle composition for protecting group B meningococcus infection as well as preparation method and application of outer membrane vesicle composition

Abstract

The invention provides an outer membrane vesicle composition for protecting infection of group B meningococcus. The outer membrane vesicle composition consists of lipopolysaccharide modified outer membrane vesicles of group B meningococcus and outer membrane vesicles of group B meningococcus for expressing recombinant protein. Compared with the outer membrane vesicle of a single strain, the outer membrane vesicle composition provided by the invention has a better effect of protecting group B meningococcus infection, and is more suitable for being used as a vaccine.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to an outer membrane vesicle composition for protecting group B meningococcal infection, a preparation method and an application thereof. Background Art

[0002] Neisseria meningitidis is a Gram-negative diplococcus. Humans are the only natural host and it usually colonizes in the human nasopharynx. Epidemic meningitis is a severe global respiratory infectious disease caused by infection with Neisseria meningitidis (or meningococcus). Over the past 100 years, it has often caused periodic epidemics or sporadic outbreaks of meningococcal disease worldwide, with high morbidity and mortality rates. Based on the structural and antigenic differences of the bacterial surface capsular polysaccharides, it is divided into 13 different serogroups, of which most cases are caused by strains of groups A, B, C, W135 and Y.

[0003] The outer membrane of meningococcal cells is a high molecular weight complex composed of outer membrane proteins (OMPs), lipoproteins and lipooligosaccharides (LOS). In its natural state, it forms a vesicle-like structure, also known as outer membrane vesicles (OMVs). The main immunogenicity of the OMVs is

[0004] Outer membrane protein. Group B meningococcal strains have diverse phenotypic and genotypic characteristics, but the group B strains that often cause outbreaks or epidemics may belong to a dominant clone group. Therefore, it is difficult for a monovalent OMV vaccine to protect and resist diseases caused by all different group B meningococcal strains.

[0005] At present, people have not yet studied clearly how to develop mutants with the ability to protect against group B meningococcal infection through genetic engineering, which has slowed down the research on developing mutant outer membrane vesicles with high efficiency in protecting against group B meningococcal infection. Therefore, it is even more difficult to develop corresponding outer membrane vesicle compositions on this basis. Summary of the invention

[0006] In view of the shortcomings of the prior art, the object of the present invention is to provide an outer membrane vesicle composition for protecting against group B meningococcal infection, wherein the components of the composition have a synergistic effect in protecting against group B meningococcal infection.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] An outer membrane vesicle composition for protecting against group B meningococcal infection, the outer membrane vesicle composition consisting of lipopolysaccharide-modified group B meningococcal outer membrane vesicles and group B meningococcal outer membrane vesicles expressing recombinant proteins;

[0009] The lipopolysaccharide-modified group B meningococcus is classified as Neisseria sp., with a deposit number of CGMCC No. 36402, and is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and a deposit date of July 19, 2024;

[0010] The group B meningococcus expressing the recombinant protein is classified and named Neisseria meningitidis, with a preservation number of CGMCC No.31404. It is preserved in the General Microbiology Center of the China Culture Collection Administration, and the preservation address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation time is July 30, 2024.

[0011] The lipopolysaccharide-modified group B meningococcus is obtained by knocking out the lptA gene of group B meningococcus and then overexpressing the lpxE gene at the gene position;

[0012] The group B meningococcus expressing recombinant proteins expresses recombinant proteins Neisserial Heparin Binding Antigen (NHBA), fHbp and Neisseria adhesin A (NadA) through the autotransporter system Hbp.

[0013] The group B meningococcus expressing the recombinant protein is prepared by the following method:

[0014] (1) The gene expression fragments of NHBA, fHbp and NadA antigens were constructed into plasmids using the Hbp protein autotransporter system;

[0015] (2) transferring the plasmid into the serogroup B meningococcal background strain by electroporation;

[0016] The construction method of the plasmid comprises the following steps:

[0017] 1) The Hbp autotransporter expression cassette from group B meningococci was cloned into the vector pYA3332 using the Gibson assembly kit in one step;

[0018] 2) Using the Gibson assembly kit, the coding gene sequences of the group B meningococcal antigen recombinant proteins NHBA, fHbp and NadA were cloned into the Hbp autotransporter expression cassette to express the three antigens on the outer membrane surface of group B meningococci;

[0019] The method for constructing the Hbp self-transport system expression plasmid vector comprises the following steps:

[0020] 1) Primer design:

[0021] Hbp-F:5'CTGACCTTGGACGCGCCACCGGTTTAAG3'

[0022] Hbp-R:5'AACCTTGCGCGATGAGCATAAGCGTACAGCCTG 3'

[0023] 2) extracting genomic DNA of group B Neisseria meningitidis in the logarithmic growth phase as a template, and using the pYA3332 linearized plasmid as a template for amplification using corresponding primers, respectively, to obtain amplification products of the corresponding fragments, and using the Gibson assembly kit for one-step cloning, and transforming the products into the Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp;

[0024] The method for constructing the expression plasmids of the NHBA, fHbp and NadA antigens comprises the following steps:

[0025] 1) Primer design:

[0026] NHBA-F:5'TGCTGACAAAGAACTGGGATGTTTGAACGCAGTGTGATTG3'

[0027] NHBA-R:5'GAAACAGTTCCTGAGTCTCAATCCTGCTCTTTTTT3'

[0028] fHbp-F:5'TGCCACCCTGAGTCTGAACAGGTGAACCGAACTGCCTTCTGCTGC3'

[0029] fHbp-R:5'CGCTGTTACGACGCATTGAGATTATTGCTTGGCTTCAAGACC3'

[0030] NadA-F:5'TGCCACCCTGAGTCTGAACAGCATGCAAACCGCCGCCGCCGCTC3'NadA-R:5'CGCTGTTACGACGCATTGAGACTCAGGCGGGTCCCATGCC3'

[0031] pYA3332-Hbp-NHBA-F:5'CAATCACACTGCGTTTGACGTAACTGACGATTGC3'

[0032] pYA3332-Hbp-NHBA-R:5'AAAAAGAGCAGGATTGCAGTAAACCTTGGCGACGTG3'

[0033] pYA3332-Hbp-fHbp-F:5'GCAGCAGAAGGCAGAGCGCCGGCCTGAAGGTAATC3'

[0034] pYA3332-Hbp-fHbp-R:5'GGTCTTGAAGCCAAGCTGCGCCGAGAGCGATTGA3'

[0035] pYA3332-Hbp-NadA-F:5'GAGCGGCGGCGGCGGTTAAGCGCCGGCCTGAAGGTA ATC3'

[0036] pYA3332-Hbp-NadA-R:5'GGCATGGGACCCGCCTGAGCGCCGAGAGCGATTGA3'

[0037] 2) using primers NHBA-F and NHBA-R to amplify the sequence corresponding to NHBA using group B Neisseria meningitidis as a template, using primers pYA3332-Hbp-NHBA-F and pYA3332-Hbp-NHBA-R to amplify the vector fragment using pYA3332-Hbp as a template, respectively obtaining the amplified products of the corresponding fragments, performing one-step cloning using the Gibson assembly kit, and transforming the products into the Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA;

[0038] 3) Using primers fHbp-F and fHbp-R to amplify the sequence corresponding to fHbp using group B Neisseria meningitidis as a template, using primers pYA3332-Hbp-fHbp-F and pYA3332-Hbp-fHbp-R to amplify the vector fragment using pYA3332-Hbp-NHBA as a template, respectively obtaining the amplified products of the corresponding fragments, performing one-step cloning using the Gibson assembly kit, and transforming the products into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp;

[0039] 4) Using primers NadA-F and NadA-R and group B Neisseria meningitidis as a template, amplify the sequence corresponding to fHbp, and use primers pYA3332-Hbp-NadA-F and pYA3332-Hbp-NadA-R and pYA3332-Hbp-NHBA-fHbp as a template to amplify the vector fragment, respectively obtain the amplification products of the corresponding fragments, perform one-step cloning using the Gibson assembly kit, and transform the products into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp-NadA.

[0040] Specifically, the lipopolysaccharide-modified group B meningococcus is constructed by homologous recombination to construct the gene lpxE forcing the expression of the phosphate group synthase LpxE between the upstream and downstream homologous arms of the knocked-out lptA gene, thereby forming a genotype in which lptA is knocked out and lpxE is expressed at the same time, thereby obtaining a group B meningococcus mutant strain having an optimal lipid A structure that can efficiently activate the TLR4 receptor;

[0041] The construction method of the plasmid pRE112-lptA / Ptrc-lpxE used in the homologous recombination process is as follows:

[0042] According to the gene sequence with the sequence number NZ_LR134326.1 on GenBank, the lpxE sequence was inserted in the middle of the lptA homology arm. The primers are as follows:

[0043] lptA-3F:5'TGAGACGCTGACGATAATTGC3'

[0044] lptA-3R: 5'CGATGAAATTTGCGCGATGACG3'

[0045] lpxE-1F: 5'CCGAGACTTTGACGTAGACGTGACGTGACGATGACG3'

[0046] lpxE-1R: 5'CGACGATAGCGATGACGATTGACGATTAACCGT3';

[0047] The genomic DNA of the Bordetella bronchiseptica reference strain in the logarithmic growth phase was extracted as a template, and the full-length lpxE fragment was amplified using lpxE-1F and lpxE-1R, respectively. Subsequently, the pRE112-lptA plasmid was used as a template to amplify the products using lptA-3F and lptA-3R. The two PCR products were then electroporated into the competent Escherichia coli engineering bacteria χ7232 using a one-step cloning method to obtain the recombinant plasmid pRE112-lptA / Ptrc-lpxE.

[0048] Preferably, the weight ratio of the lipopolysaccharide-modified outer membrane vesicles of group B meningococcus to the outer membrane vesicles of group B meningococcus expressing the recombinant protein is 2:1.

[0049] The present invention also provides a method for preparing the outer membrane vesicle composition. The outer membrane vesicle composition is obtained by mixing the outer membrane vesicles of group B meningococci modified with the lipopolysaccharide and the outer membrane vesicles of group B meningococci expressing recombinant proteins.

[0050] The present invention also provides the use of the above composition in preparing a drug for protecting against group B meningococcal infection. Specifically, the composition is used as a vaccine for protecting against group B meningococcal infection.

[0051] As shown in the embodiments of the present invention, when preparing lipopolysaccharide-modified group B meningococci, the level of immune protection produced by the outer membrane vesicles obtained by only knocking out the lipid A synthesis-related gene lptA or knocking out lptA and simultaneously expressing pagL is significantly worse than the outer membrane vesicles of the strain obtained by the present invention. Based on the obtained lipopolysaccharide-modified group B meningococci, the present invention found that combining the outer membrane vesicles of the group B meningococci expressing the recombinant protein of the present invention with the outer membrane vesicles of the group B meningococci modified by lipopolysaccharide can significantly enhance the effect of protecting group B meningococcal infection. Therefore, the present invention greatly improves the use value of lipopolysaccharide-modified group B meningococci.

[0052] Beneficial effects of the present invention:

[0053] The outer membrane vesicle composition provided by the present invention has a better effect of protecting against group B meningococcal infection compared with the outer membrane vesicles of a single strain, and is more suitable for use as a vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 The results of the assay of the ability of group B meningococcal outer membrane vesicles modified with different lipopolysaccharides to stimulate TLR4 receptor activation;

[0055] Figure 2The results of the measurement of serum IgG antibody levels produced by mice immunized with group B meningococcal outer membrane vesicles modified with different lipopolysaccharides;

[0056] Figure 3 The results of evaluating the immune protection level of serogroup B meningococcal outer membrane vesicles modified with different lipopolysaccharides in an adult mouse infection model;

[0057] Figure 4 The results of evaluating the protective level of serogroup B meningococcal outer membrane vesicles modified with different lipopolysaccharides in the neonatal rat bacteremia model;

[0058] Figure 5 This is a graph showing the results of measuring serum IgG antibody levels produced by mice immunized with different outer membrane vesicles and their compositions;

[0059] Figure 6 Results of evaluating the protective effects of different outer membrane vesicle combinations against serogroup B meningococcal infection in an adult mouse infection model;

[0060] Figure 7 Figure 3 is the result of evaluating the protection level of different outer membrane vesicle combinations against serogroup B meningococcal infection in the neonatal rat bacteremia infection model. DETAILED DESCRIPTION

[0061] The present invention is described in detail below through examples. It is necessary to point out that the following examples are only used to further illustrate the present invention and cannot be understood as limiting the scope of protection of the present invention. Some non-essential improvements and adjustments made by technical personnel in this field based on the above invention content still fall within the scope of protection of the present invention.

[0062] Example 1 Construction of lipopolysaccharide modified group B meningococci

[0063] 1. Construction of homologous recombination plasmid pRE112-lptA containing upstream and downstream homologous arms of lptA gene:

[0064] According to the complete genome sequence of the reference strain of Neisseria meningitidis serogroup B published in GenBank, the sequence number is GCF_008330805.1, the left and right homologous arms of the lptA gene were designed, and the following primers were used:

[0065] lptA-1F:5'CCGATTAGCGATGACGATCG3'

[0066] lptA-2R: 5'CTACGAGCGATGACGAAAATTTGCGATGCGCGTA3'

[0067] lptA-2F: 5'CTATATATTTTAAACGCGTAGATGCGTAGCTGACTGA3'

[0068] lptA-2R: 5'CTGTGTCGAAATTGACGATAGCTGA3'.

[0069] The genomic DNA of group B Neisseria meningitidis in the logarithmic growth phase was extracted as a template, and the corresponding upstream and downstream homologous arm fragments were amplified respectively to obtain the amplified products of the left and right homologous arms. The amplified products were amplified by overlapping PCR using primers 1F and 2R, and the front and back arm fragments were connected by overlapping PCR method; the suicide plasmid vector pYA4278 was then digested with Ahd I, and the digested products were connected with the fusion fragment amplified by PCR in advance and transferred into the competent Escherichia coli engineering bacteria χ7232 to obtain the recombinant plasmid pRE112-lptA.

[0070] The sequence of lptA is shown in SEQ ID No. 1, as follows:

[0071] .

[0072] 2. Construction of homologous recombination plasmid pRE112-lptA / Ptrc-lpxE containing upstream and downstream homology arms of lptA and stably expressing lpxE from Bordetellabronchiseptica at the knockout gene position

[0073] According to the Bordetella bronchiseptica reference strain phosphatasePAP2 family protein (lpxE) gene sequence published in GenBank, the sequence number is NZ_LR134326.1, the lpxE sequence was inserted in the middle of the lptA homology arm, and the following primers were used:

[0074] lptA-3F:5'TGAGACGCTGACGATAATTGC3'

[0075] lptA-3R: 5'CGATGAAATTTGCGCGATGACG3'

[0076] lpxE-1F: 5'CCGAGACTTTGACGTAGACGTGACGTGACGATGACG3'

[0077] lpxE-1R: 5'CGACGATAGCGATGACGATTGACGATTAACCGT3'.

[0078] The genomic DNA of the Bordetella bronchiseptica reference strain in the logarithmic growth phase was extracted as a template, and the full-length lpxE fragment was amplified using lpxE-1F / lpxE-1R. Then, the pRE112-lptA plasmid was used as a template and the product was amplified using lptA-3F / lptA-3R. The two PCR products were then electroporated into the competent Escherichia coli engineering bacteria χ7232 using the one-step cloning method (Gibson Assembly) to obtain the recombinant plasmid pRE112-lptA / Ptrc-lpxE.

[0079] The sequence of lpxE is shown in SEQ ID No. 2, as follows:

[0080] .

[0081] 3. Construction of homologous recombination plasmid pRE112-lptA / Ptrc-pagL containing upstream and downstream homology arms of lptA and stably expressing pagL from Bordetellabronchiseptica at the knockout gene position

[0082] According to the Bordetella bronchiseptica reference strain acyloxyacylhydrolase (pagL) gene sequence published in GenBank, the sequence number is NZ_LR134326.1:, the pagL sequence was inserted in the middle of the lptA homology arm, and the following primers were used:

[0083] lptA-4F: 5'TGAGCTGACGATGGAACCTGA3'

[0084] lptA-4R: 5'GGCTGACTGACGTAGAGATCG3'

[0085] pagL-1F: 5'CCGCGTAAATTTGCTATGATGCGATGAATGACGTAG3'

[0086] pagL-1R: 5'CCTATTTAAAGGGTTATGACTAGATGA3'.

[0087] The genomic DNA of the Bordetella bronchiseptica reference strain NCTC10543_03471 in the logarithmic growth phase was extracted as a template, and the full-length pagL fragment was amplified using pagL-1F / pagL-1R. Subsequently, the pRE112-lptA plasmid was used as a template and the product was amplified using lptA-3F / lptA-3R. The two PCR products were then electroporated into the competent Escherichia coli engineering bacteria χ7232 using a one-step cloning method (Gibson Assembly) to obtain the recombinant plasmid pRE112-lptA / Ptrc-pagL.

[0088] The sequence of pagL is shown in SEQ ID No. 3, as follows:

[0089] .

[0090] 4. Preparation of lipopolysaccharide modified group B meningococci:

[0091] (1) preparing group B Neisseria meningitidis QL00020 electroporation competent cells; (2) transforming pRE112-lptA, pRE112-lptA / Ptrc-lpxE and pRE112-lptA / Ptrc-pagL into group B Neisseria meningitidis QL00020 electroporation competent cells by electroporation (2500 volts for 4 milliseconds); (3) adding 100 μL of preheated The mixture was added to the enrichment broth and blown out gently to mix. The mixture was then spread on a chocolate agar plate containing chloramphenicol resistance (CmR) and cultured overnight at 37°C. The resulting single clone was the successfully electroporated bacterium. (4) PCR screening was performed to obtain mutant strains that did not contain lptA and expressed the corresponding gene, namely QL00021 (△lptA), QL00022 (△lptA / Ptrc-lpxE) and QL00023 (△lptA / Ptrc-pagL).

[0092] Example 2 Preparation of lipopolysaccharide-modified group B meningococcal outer membrane vesicles

[0093] Take the mutant strains QL00021 (△lptA), QL00022 (△lptA / Ptrc-lpxE) and QL00023 (△lptA / Ptrc-pagL) obtained in Example 1. First, pick a single colony to culture the bacteria, inoculate the bacteria into 2L liquid enrichment broth at a ratio of 1:100 overnight, culture at 37°C microaerobic environment for 24-32 hours until the OD value is 1, centrifuge to remove the bacteria, and the centrifugation conditions are 4°C, 10,000×g. The collected supernatant is filtered through a 0.45μm filter membrane to remove the residual bacteria, and then the outer membrane vesicles in the supernatant are collected by ultracentrifugation (centrifugation conditions are 2h, 40,000×g, 4°C). The collected outer membrane vesicles are resuspended with DPBS and filtered again with a 0.45μm filter membrane. The outer membrane vesicles obtained initially need to be purified by density gradient centrifugation. Using 10mM HEPES buffer containing 0.85% NaCl as diluent, 2ml per layer, 8 layers in total, and 20-45% concentration of density gradient centrifugation buffer from top to bottom to prepare a non-continuous density gradient centrifugation device, and add the outer membrane vesicles collected in the previous step to the top layer of the density gradient centrifugation device for centrifugation at 200,000×g, 4°C overnight. The density gradient layer containing a large number of outer membrane vesicles was collected by ultracentrifugation (40,000×g, 4°C, 1h), washed once with DPBS to remove impurities, and then stored in a -80°C refrigerator for use.

[0094] Example 3 Construction of Group B Meningococcus Expressing Recombinant Protein

[0095] The group B meningococci expressing the recombinant protein were prepared by the following method:

[0096] (1) The gene expression fragments of NHBA, fHbp and NadA antigens were constructed into plasmids using the Hbp protein autotransporter system;

[0097] (2) The plasmid was transferred into the group B meningococcal background strain (purchased from Beina Biotechnology (https: / / www.bncc.com / ), catalog number: BNCC359481) by electroporation;

[0098] The construction method of the plasmid comprises the following steps:

[0099] 1) The Hbp autotransporter expression cassette from group B meningococci was cloned into the vector pYA3332 using the Gibson assembly kit in one step;

[0100] 2) Using the Gibson assembly kit, the coding gene sequences of the group B meningococcal antigen recombinant proteins NHBA, fHbp and NadA were cloned into the Hbp autotransporter expression cassette to express the three antigens on the outer membrane surface of group B meningococci;

[0101] The method for constructing the Hbp self-transport system expression plasmid vector comprises the following steps:

[0102] 1) Primer design:

[0103] Hbp-F:5'CTGACCTTGGACGCGCCACCGGTTTAAG3'

[0104] Hbp-R:5'AACCTTGCGCGATGAGCATAAGCGTACAGCCTG 3'

[0105] 2) extracting genomic DNA of group B Neisseria meningitidis in the logarithmic growth phase as a template, and using the pYA3332 linearized plasmid as a template for amplification using corresponding primers, respectively, to obtain amplification products of the corresponding fragments, and using the Gibson assembly kit for one-step cloning, and transforming the products into the Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp;

[0106] The method for constructing the expression plasmids of the NHBA, fHbp and NadA antigens comprises the following steps:

[0107] 1) Primer design:

[0108] NHBA-F:5'TGCTGACAAAGAACTGGGATGTTTGAACGCAGTGTGATTG3'

[0109] NHBA-R:5'GAAACAGTTCCTGAGTCTCAATCCTGCTCTTTTTT3'

[0110] fHbp-F:5'TGCCACCCTGAGTCTGAACAGGTGAACCGAACTGCCTTCTGCTGC3'

[0111] fHbp-R:5'CGCTGTTACGACGCATTGAGATTATTGCTTGGCTTCAAGACC3'

[0112] NadA-F:5'TGCCACCCTGAGTCTGAACAGCATGCAAACCGCCGCCGCCGCTC3'

[0113] NadA-R:5'CGCTGTTACGACGCATTGAGACTCAGGCGGGTCCCATGCC3'

[0114] pYA3332-Hbp-NHBA-F:5'CAATCACACTGCGTTTGACGTAACTGACGATTGC3'

[0115] pYA3332-Hbp-NHBA-R:5'AAAAAGAGCAGGATTGCAGTAAACCTTGGCGACGTG3'

[0116] pYA3332-Hbp-fHbp-F:5'GCAGCAGAAGGCAGAGCGCCGGCCTGAAGGTAATC3'

[0117] pYA3332-Hbp-fHbp-R:5'GGTCTTGAAGCCAAGCTGCGCCGAGAGCGATTGA3'

[0118] pYA3332-Hbp-NadA-F:5'GAGCGGCGGCGGCGGTTAAGCGCCGGCCTGAAGG TAATC3'

[0119] pYA3332-Hbp-NadA-R:5'GGCATGGGACCCGCCTGAGCGCCGAGAGCGATTGA3'

[0120] 2) using primers NHBA-F and NHBA-R to amplify the sequence corresponding to NHBA using group B Neisseria meningitidis as a template, using primers pYA3332-Hbp-NHBA-F and pYA3332-Hbp-NHBA-R to amplify the vector fragment using pYA3332-Hbp as a template, respectively obtaining the amplified products of the corresponding fragments, performing one-step cloning using the Gibson assembly kit, and transforming the products into the Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA;

[0121] 3) Using primers fHbp-F and fHbp-R to amplify the sequence corresponding to fHbp using group B Neisseria meningitidis as a template, using primers pYA3332-Hbp-fHbp-F and pYA3332-Hbp-fHbp-R to amplify the vector fragment using pYA3332-Hbp-NHBA as a template, respectively obtaining the amplified products of the corresponding fragments, performing one-step cloning using the Gibson assembly kit, and transforming the products into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp;

[0122] 4) Using primers NadA-F and NadA-R and group B Neisseria meningitidis as a template, amplify the sequence corresponding to fHbp, and use primers pYA3332-Hbp-NadA-F and pYA3332-Hbp-NadA-R and pYA3332-Hbp-NHBA-fHbp as a template to amplify the vector fragment, respectively obtain the amplification products of the corresponding fragments, perform one-step cloning using the Gibson assembly kit, and transform the products into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp-NadA.

[0123] Example 4 Preparation of Group B Meningococcal Outer Membrane Vesicles Expressing Recombinant Protein

[0124] Take the strain obtained in Example 3. First, pick a single colony to culture the bacteria, inoculate the bacteria into 2L liquid enrichment broth at a ratio of 1:100 overnight, culture at 37°C in a microaerobic environment for 24-32 hours until the OD value is 1, centrifuge to remove the bacteria, and the centrifugation conditions are 4°C, 10,000×g. The collected supernatant is filtered through a 0.45μm filter membrane to remove the residual bacteria, and then the outer membrane vesicles in the supernatant are collected by ultracentrifugation (the centrifugation conditions are 2h, 40,000×g, 4°C). The collected outer membrane vesicles are resuspended with DPBS and filtered again with a 0.45μm filter membrane. The outer membrane vesicles initially obtained also need to be purified by density gradient centrifugation. Using 10mM HEPES buffer containing 0.85% NaCl as diluent, 2ml per layer, 8 layers in total, and 20-45% concentration of density gradient centrifugation buffer from top to bottom to prepare a non-continuous density gradient centrifugation device, and add the outer membrane vesicles collected in the previous step to the top layer of the density gradient centrifugation device for centrifugation at 200,000×g, 4°C overnight. The density gradient layer containing a large number of outer membrane vesicles was collected by ultracentrifugation (40,000×g, 4°C, 1h), washed once with DPBS to remove impurities, and then stored in a -80°C refrigerator for use.

[0125] In the above preparation process, Neisserial Heparin Binding Antigen (NHBA) is derived from group B Neisseria meningitidis, and the sequence is shown in SEQ ID No. 4, which is:

[0126]

[0127] fHbp is derived from Neisseria meningitidis serogroup B, and the sequence is shown in SEQ ID No.5 as follows:

[0128] gtgaaccgaactgccttctgctgcttttctctgaccgccgccctgattctgaccgcctgcagcagcggaggcggcggtgtcgccgccgacatcggcgcggggcttgccgatgcactaaccgcaccgctcgaccataaagacaaaagtttgcagtctttgacgctggatcagtccgtcaggaaaaacgagaaactgaagctggcggcacaaggtgcggaaaaaacttatggaaacggcgacagccttaatacgggcaaattgaagaacgacaaggtcagccgtttcgactttatccgtcaaatcgaagtggacgggcagctcattaccttggagagcggagagttccaagtgtacaaacaaagccattccgccttaaccgcccttcagaccgagcaagaacaagatccagagcattccgggaagatggttgcgaaacgccggttcaaaatcggcgacatagcgggcgaacatacatcttttgacaagcttcccaaagacgtcatggcgacatatcgcgggacggcgttcggttcagacgatgccggcggaaaactgacctatactatagattttgctgccaaacagggacacggcaaaatcgaacatttgaaatcgcccgaactcaatgtcgagcttgccaccgcctatatcaagccggatgaaaaacaccatgccgtcatcagcggttccgtcctttacaatcaagacgagaaaggcagttactccctcggtatctttggcgggcaagcccaggaagttgccggcagcgcggaagtggaaaccgcaaacggcatacaccatatcggtcttgccgccaagcaataa。

[0129] Neisseria adhesin A (NadA) is derived from Neisseria meningitidis serogroup B, and the sequence is shown in SEQ ID No.6 as follows:

[0130]

[0131] Experimental Example 1 Experiment on the ability of outer membrane vesicles of different serogroup B meningococcal mutant strains to stimulate TLR4 response

[0132] HEK-293 cells stably expressing human TLR4 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and cultured at 37°C with 5% CO 2 The culture medium was DMEM (Gibco BRL, USA) with 10% FBS (Hyclone Logan, UT, USA). After the cells were cultured, they were distributed in 96-well plates at a volume of 105 / well. After 18 hours, different concentrations of outer membrane vesicles were added to the plate to stimulate them (10, 10 2 ,10 3 and 10 4 μg / ml), and after 24 hours, the cell culture supernatant was collected, centrifuged to remove cell debris, and the expression level of cytokines was detected. The content of TLR4 was measured using an ELISA kit purchased from R&D Systems, Inc., and the steps were strictly carried out according to the instructions. The detected TLR4 level was as follows Figure 1 As shown, it was verified at the cell level that knocking out lptA and expressing lpxE or pagL on this basis could significantly enhance the ability of outer membrane vesicles to be recognized by TLR4.

[0133] Experimental Example 2 Evaluation of the immune protection efficacy of outer membrane vesicles of different serogroup B meningococcal mutant strains

[0134] BALB / c mice aged 6-8 weeks were used as a model. Outer membrane vesicles of different group B meningococcal mutants were injected subcutaneously at a dose of 20 μg per mouse. The first immunization was performed on day 1, and booster immunization was performed 4 weeks later. Serum antibody IgG levels were measured in mouse sera 4 and 8 weeks after the first immunization. Group B meningococcal challenge was performed 9 weeks after the first immunization. The challenge dose of group B meningococcal was 10 7 CFU, the virus was challenged by nasal drops, and the bacterial load in the nasal cavity was detected 3 days after the virus challenge to evaluate the protective efficacy of different outer membrane vesicles against bacteria. Figure 2 and Figure 3 As shown, QL00022 (△lptA / Ptrc-lxpE) can induce the optimal serum IgG antibody level; at the same time, it can significantly reduce the bacterial load in the nasal cavity 3 days after challenge.

[0135] Experimental Example 3: Evaluation of the protective efficacy of outer membrane vesicles of different serogroup B meningococcal mutant strains using a neonatal rat model

[0136] The ability of antibodies generated by mice immunized with outer membrane vesicles of different serogroup B meningococcal mutants to protect against Neisseria meningitidis bacteremia was evaluated in rat pups. Three- to four-day-old pups from a litter of male Sprague-Dawley rats were randomly reassigned to lactating mothers. Ten pups were injected intraperitoneally with 1:10 dilutions of mouse immunized outer membrane vesicle sera of different species 18 to 24 hours before challenge. 5 They were challenged intraperitoneally with CFU of serogroup B Neisseria meningitidis strain H44 / 76. They were sacrificed and bled 3 hours after the challenge, and an aliquot of the blood was spread on chocolate plates and incubated at 37°C with 5% CO. 2 Incubate overnight. After incubation, determine the level of bacteremia by counting colonies on the plates. Figure 4 As shown, the antibody level generated by QL00022 (△lptA / Ptrc-lxpE) immunization was the most effective in protecting against bacteremia caused by serogroup B Neisseria meningitidis.

[0137] Experimental Example 4 Evaluation of the immune protection efficacy of the combination of outer membrane vesicles of different serogroup B meningococcal mutant strains

[0138] Using 6-8 week old BALB / c mice as a model, different combinations of outer membrane vesicles of group B meningococcal mutants, including (1) wild-type outer membrane vesicles of group B meningococcal Neisseria meningitidis, (2) outer membrane vesicles of group B meningococcal Neisseria meningitidis expressing three recombinant proteins at the same time, (3) lipopolysaccharide-modified group B meningococcal outer membrane vesicles, and (4) outer membrane vesicles expressing proteins and outer membrane vesicles modified by lipopolysaccharide, were injected subcutaneously with 20 μg per mouse. The first immunization was performed on the first day, and booster immunization was performed 4 weeks later. The serum antibody IgG level of mice was measured at 4 weeks and 8 weeks after the first immunization. Group B meningococcal virus was challenged 9 weeks after the first immunization. The challenge dose of group B meningococcal virus was 107 CFU, and the challenge method was nasal drops. The bacterial load in the nasal cavity was detected 3 days after the challenge to evaluate the protective efficacy of different outer membrane vesicles against bacteria. The results showed that the group containing both protein-expressing outer membrane vesicles and LPS-modified outer membrane vesicles induced the best serum IgG antibody level ( Figure 5 ), and was able to significantly reduce the bacterial load in the nasal cavity 3 days after the challenge ( Figure 6 ).

[0139] Experimental Example 5 Evaluation of the protective efficacy of a combination of outer membrane vesicles of different serogroup B meningococcal mutant strains using a neonatal rat model

[0140] The ability of antibodies generated by mice immunized with combinations of outer membrane vesicles of different serogroup B meningococcal mutants to protect against Neisseria meningitidis bacteremia was evaluated in rat pups. Three- to four-day-old pups from a litter of male Sprague-Dawley rats were randomly reassigned to lactating mothers. Ten pups were injected intraperitoneally with 1:10 dilutions of mouse immunization serum of different outer membrane vesicles 18 to 24 hours before challenge. 5 They were challenged intraperitoneally with CFU of group B Neisseria meningitidis strain H44 / 76. They were killed and bled 3 hours after the challenge, and an aliquot of the blood was spread on chocolate plates and incubated overnight at 37°C with 5% CO2. The level of bacteremia was determined by counting the colonies on the plates after incubation. The results also showed that the antibody levels produced by the group immunization containing both the outer membrane vesicles expressing the protein and the outer membrane vesicles modified with lipopolysaccharide were the most effective in resisting bacteremia of group B Neisseria meningitidis ( Figure 7 ).

Claims

1. An outer membrane vesicle composition for protecting against group B meningococcal infection, It is characterized in that The outer membrane vesicle composition is composed of lipopolysaccharide-modified outer membrane vesicles of group B meningococcus and outer membrane vesicles of group B meningococcus expressing recombinant proteins; The lipopolysaccharide-modified group B meningococcus is classified and named as Neisseria, with a preservation number of CGMCC No. 36402, and is deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on July 19, 2024; The group B meningococcus expressing the recombinant protein is classified and named as Neisseria meningitidis, with a preservation number of CGMCC No. 31404. It is preserved in the General Microbiology Center of the China Culture Collection Administration, and the preservation time is July 30, 2024.

2. An outer membrane vesicle composition for protecting against group B meningococcal infection according to claim 1, It is characterized in that The lipopolysaccharide-modified group B meningococcus is obtained by knocking out the lptA gene of group B meningococcus and then overexpressing the lpxE gene at the gene position; The group B meningococcus expressing recombinant proteins expresses the recombinant proteins NHBA, fHbp and NadA through the autotransporter system Hbp.

3. An outer membrane vesicle composition for protecting against group B meningococcal infection according to claim 2, It is characterized in that The group B meningococcus expressing the recombinant protein is prepared by the following method: (1) The gene expression fragments of NHBA, fHbp and NadA antigens were constructed into plasmids using the Hbp protein autotransporter system; (2) transferring the plasmid into the serogroup B meningococcal background strain by electroporation; The construction method of the plasmid comprises the following steps: 1) The Hbp autotransporter expression cassette from group B meningococci was cloned into the vector pYA3332 using the Gibson assembly kit in one step; 2) Using the Gibson assembly kit, the coding gene sequences of the group B meningococcal antigen recombinant proteins NHBA, fHbp and NadA were cloned into the Hbp autotransporter expression cassette to express the three antigens on the outer membrane surface of group B meningococci; The method for constructing the Hbp self-transport system expression plasmid vector comprises the following steps: 1) Primer design: Hbp-F:5'CTGACCTTGGACGCGCCACCGGTTTAAG3' Hbp-R:5'AACCTTGCGCGATGAGCATAAGCGTACAGCCTG 3' 2) Extracting genomic DNA of group B Neisseria meningitidis in the logarithmic growth phase as a template, and using the pYA3332 linearized plasmid as a template for amplification using corresponding primers, respectively, to obtain amplification products of the corresponding fragments, and using the Gibson assembly kit for one-step cloning, and transforming the products into the Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp; The method for constructing the expression plasmids of the NHBA, fHbp and NadA antigens comprises the following steps: 1) Primer design: NHBA-F:5'TGCTGACAAAGAACTGGGATGTTTGAACGCAGTGTGATTG3' NHBA-R:5'GAAACAGTTCCTGAGTCTCAATCCTGCTCTTTTTT3' fHbp-F:5'TGCCACCCTGAGTCTGAACAGGTGAACCGAACTGCCTTCTGCTGC3' fHbp-R:5'CGCTGTTACGACGCATTGAGATTATTGCTTGGCTTCAAGACC3' NadA-F:5'TGCCACCCTGAGTCTGAACAGCATGCAAACCGCCGCCGCCGCTC3' NadA-R:5'CGCTGTTACGACGCATTGAGACTCAGGCGGGTCCCATGCC3' pYA3332-Hbp-NHBA-F:5'CAATCACACTGCGTTTGACGTAACTGACGATTGC3' pYA3332-Hbp-NHBA-R:5'AAAAAGAGCAGGATTGCAGTAAACCTTGGCGACGTG3' pYA3332-Hbp-fHbp-F:5'GCAGCAGAAGGCAGAGCGCCGGCCTGAAGGTAATC3' pYA3332-Hbp-fHbp-R:5'GGTCTTGAAGCCAAGCTGCGCCGAGAGCGATTGA3' pYA3332-Hbp-NadA-F:5'GAGCGGCGGCGGCGGTTAAGCGCCGGCCTGAAGG TAATC3' pYA3332-Hbp-NadA-R:5'GGCATGGGACCCGCCTGAGCGCCGAGAGCGATTGA3' 2) using primers NHBA-F and NHBA-R to amplify the sequence corresponding to NHBA using group B Neisseria meningitidis as a template, using primers pYA3332-Hbp-NHBA-F and pYA3332-Hbp-NHBA-R to amplify the vector fragment using pYA3332-Hbp as a template, respectively obtaining the amplified products of the corresponding fragments, performing one-step cloning using the Gibson assembly kit, and transforming the products into the Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA; 3) Using primers fHbp-F and fHbp-R to amplify the sequence corresponding to fHbp using group B Neisseria meningitidis as a template, using primers pYA3332-Hbp-fHbp-F and pYA3332-Hbp-fHbp-R to amplify the vector fragment using pYA3332-Hbp-NHBA as a template, respectively obtaining the amplified products of the corresponding fragments, performing one-step cloning using the Gibson assembly kit, and transforming the products into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp; 4) Using primers NadA-F and NadA-R and group B Neisseria meningitidis as a template, amplify the sequence corresponding to fHbp, and use primers pYA3332-Hbp-NadA-F and pYA3332-Hbp-NadA-R and pYA3332-Hbp-NHBA-fHbp as a template to amplify the vector fragment, respectively obtain the amplification products of the corresponding fragments, perform one-step cloning using the Gibson assembly kit, and transform the products into Escherichia coli strain TOP10 to obtain the recombinant plasmid pYA3332-Hbp-NHBA-fHbp-NadA.

4. An outer membrane vesicle composition for protecting against group B meningococcal infection according to claim 3, It is characterized in that The lipopolysaccharide-modified group B meningococcus is constructed by homologous recombination to construct the gene lpxE forcing the expression of the phosphate group synthase LpxE between the upstream and downstream homologous arms of the knocked-out lptA gene, thereby forming a genotype in which lptA is knocked out and lpxE is expressed at the same time, thereby obtaining a group B meningococcus mutant strain having an optimal lipid A structure that can efficiently activate the TLR4 receptor; The construction method of the plasmid pRE112-lptA / Ptrc-lpxE used in the homologous recombination process is as follows: According to the gene sequence with the sequence number NZ_LR134326.1 on GenBank, the lpxE sequence was inserted in the middle of the lptA homology arm. The primers are as follows: lptA-3F:5'TGAGACGCTGACGATAATTGC3' lptA-3R: 5'CGATGAAATTTGCGCGATGACG3' lpxE-1F: 5'CCGAGACTTTGACGTAGACGTGACGTGACGATGACG3' lpxE-1R: 5'CGACGATAGCGATGACGATTGACGATTAACCGT3'; The genomic DNA of the Bordetella bronchiseptica reference strain in the logarithmic growth phase was extracted as a template, and the full-length lpxE fragment was amplified using lpxE-1F and lpxE-1R, respectively. Subsequently, the pRE112-lptA plasmid was used as a template to amplify the products using lptA-3F and lptA-3R. The two PCR products were then electroporated into the competent Escherichia coli engineering bacteria χ7232 using a one-step cloning method to obtain the recombinant plasmid pRE112-lptA / Ptrc-lpxE.

5. The outer membrane vesicle composition for protecting against group B meningococcal infection according to claim 1, It is characterized in that The weight ratio of the lipopolysaccharide-modified outer membrane vesicles of group B meningococcus to the outer membrane vesicles of group B meningococcus expressing the recombinant protein is 2:

1.

6. A method for preparing an outer membrane vesicle composition for protecting against group B meningococcal infection, It is characterized in that The outer membrane vesicle composition is obtained by mixing the lipopolysaccharide-modified outer membrane vesicles of group B meningococcus according to claims 1 to 5 and the outer membrane vesicles of group B meningococcus expressing a recombinant protein.

7. Use of the composition according to any one of claims 1 to 5 in the preparation of a drug for protecting against group B meningococcal infection.

8. The use according to claim 7, It is characterized in that The composition is used as a vaccine for protecting against group B meningococcal infection.

Images