Alkaline protease mutant and its application in leather dehairing

Abstract

The present invention belongs to the field of microorganism and genetic engineering technology, and specifically relates to an alkaline protease mutant and its application in leather depilation. Virgibacillus byunsanensis Alkaline protease and Ornithinibacillus caprae The alkaline protease of the present invention is subjected to directed evolution to obtain an alkaline protease mutant with significantly improved enzyme activity and stability, and the active extracellular expression of the mutant encoding gene is achieved in the engineered bacterium Bacillus subtilis WB600. The optimal reaction temperature of the alkaline protease mutant of the present invention is 45°C, the optimal pH value is 8, and the residual enzyme activity can be maintained at more than 90% after incubation for 12 h under the conditions of pH 8 and temperature below 50°C or temperature 45°C and pH 7-9. It has good thermal stability and pH stability, and has strong tolerance to NaCl. It is applied to the depilation of salt-wet sheepskin treated with NaCl at a concentration of ≤100 g / L. Under the conditions of pH 7-9 and 40-50°C, the depilation time is shortened to 1.5-2 h.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and genetic engineering, and in particular relates to an alkaline protease mutant and application thereof in leather depilation. Background Art

[0002] Leather making involves a series of complex operations, including soaking, degreasing, dehairing, pickling and chroming, among which dehairing is considered to be the most polluting process. Dehairing is the process of removing hair and epidermis from animal skins. The most widely used method is sodium sulfide (Na2S) dehairing. The principle is that Na2S dissolves in water to produce sodium hydroxide (NaOH) and sodium hydrosulfide (NaHS). NaOH can dissolve the cross-linked substances in the pores, and the reducing effect of NaHS can break down the disulfide bonds of hair proteins, causing the hair to dissolve, thereby achieving a better dehairing effect. However, the use of Na2S in the above method will release toxic hydrogen sulfide (H2S) gas, which makes the environmental indicators such as ammonia nitrogen (NH3-N), biological oxygen demand (BOD), chemical oxygen demand (COD), sulfide, total dissolved solids (TDS), and total suspended solids (TSS) in the wastewater higher.

[0003] In order to change the above situation, enzymatic depilation has developed rapidly because it meets the requirements of clean production, environmental protection and energy saving. In the process of enzymatic depilation, proteases can efficiently and specifically hydrolyze the cross-linked substances in the pores, destroy the connection between the hair roots and pores, the hair bulbs and the hair papilla, and thus achieve the purpose of depilation. Compared with Na2S depilation, enzymatic depilation can not only significantly reduce the indicators such as NH3-N, BOD, COD in the wastewater, but also recover high-quality and complete hair, and improve the quality of finished leather. However, since enzymes have a hydrolytic effect on collagen, enzymatic depilation can easily damage the animal skin surface, even rot the skin, and weaken the physical and mechanical properties of the leather. Studies have shown that using metal salts such as sodium chloride (NaCl) to treat animal skins for corrosion and then enzymatic depilation, salt can fully protect the collagen of animal skins, overcoming the defects of existing enzymatic depilation that are easy to cause skin damage, rotten skin and weakened leather performance. However, since existing proteases have low adaptability and weak salt and alkali resistance, the enzyme activity will be inhibited when used for depilation of salt-treated animal skins, resulting in a serious reduction in depilation efficiency and depilation time often lasting 4 hours or more. Summary of the invention

[0004] Based on the shortcomings of the prior art, the purpose of the present invention is to provide an alkaline protease mutant with significantly improved enzyme activity and stability, which can withstand the complex environment of the leather making process and has a strong tolerance to NaCl. It is used in the depilation of salt-wet sheepskin treated with NaCl at a concentration of ≤100 g / L. Under the conditions of 40-50°C and pH 7-9, the depilation time is shortened to 1.5-2 h.

[0005] To achieve the above object, the first technical solution adopted by the present invention is:

[0006] An alkaline protease mutant, the amino acid sequence of the alkaline protease mutant is shown as SEQ ID NO.4.

[0007] The second technical solution adopted by the present invention is:

[0008] A gene encoding the above alkaline protease mutant.

[0009] The third technical solution adopted by the present invention is:

[0010] A recombinant vector, characterized in that it contains the coding gene of the alkaline protease mutant.

[0011] Preferably, the vector is pWB980.

[0012] The fourth technical solution adopted by the present invention is:

[0013] A recombinant engineering bacterium comprises the above-mentioned recombinant vector.

[0014] Preferably, the host bacteria of the recombinant engineered bacteria is Bacillus subtilis WB600.

[0015] The fifth technical solution adopted by the present invention is:

[0016] Application of the alkaline protease mutant in leather dehairing.

[0017] Preferably, the leather is salt-wet animal skin treated with NaCl at a concentration of ≤100 g / L.

[0018] Preferably, the animal skin comprises any one of sheepskin, cowhide and pigskin.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] 1. The present invention is carried out in vitro Virgibacillus byunsanensis Alkaline protease and Ornithinibacillus caprae The alkaline protease was subjected to directed evolution to obtain an alkaline protease mutant with significantly improved enzyme activity and stability, and the active extracellular expression of the gene encoding the alkaline protease mutant was achieved in the engineered bacterium Bacillus subtilis WB600. After fermentation and cultivation of the obtained alkaline protease mutant recombinant engineered bacteria, the target alkaline protease mutant can be separated and purified from the fermentation product.

[0021] 2. The activity of the alkaline protease mutant of the present invention reached 87.33 U / mL at pH 10 and temperature 50°C, which was significantly higher than that of the mutant derived from Virgibacillus byunsanensisAlkaline protease (36.27 U / mL) and Ornithinibacillus caprae of alkaline protease (53.14 U / mL).

[0022] 3. The optimal reaction temperature of the alkaline protease mutant of the present invention is 45°C, and the optimal pH is 8. When incubated for 12 h at pH 8 and temperature below 50°C or at temperature 45°C and pH 7-9, the residual enzyme activity can be maintained at more than 90%, and it has good thermal stability and pH stability.

[0023] 4. The alkaline protease mutant of the present invention has a strong tolerance to NaCl. The residual enzyme activity can be maintained at more than 95% after incubation for 12 h at 45°C, pH 8, and 0-100 g / L NaCl. It is applied to leather depilation. The sheepskin is treated with NaCl at a concentration of ≤100 g / L before depilation. The depilation time is shortened to 1.5-2 h at pH 7-9 and 40-50°C. DETAILED DESCRIPTION

[0024] The present invention is further described below by specific embodiments. Unless otherwise specified, the technical means, materials, etc. involved in the following embodiments may be well known to those skilled in the art, and suitable ones may be selected from the known means and materials that can solve the corresponding technical problems. In addition, the embodiments should be understood as illustrative rather than limiting the scope of the present invention, and the essence and scope of the present invention are limited only by the claims. For those skilled in the art, various changes or modifications of the material composition and dosage in these embodiments, without departing from the essence and scope of the present invention, also belong to the protection scope of the present invention.

[0025] An embodiment of the present invention provides an alkaline protease mutant, the amino acid sequence of the alkaline protease mutant is shown in SEQ ID NO.4.

[0026] This embodiment mainly uses DNA shuffling technology to Virgibacillus byunsanensis The alkaline protease gene and the Ornithinibacillus caprae The alkaline protease gene is subjected to directed evolution, that is, the above gene is subjected to mutagenesis and recombination to obtain an alkaline protease mutant with significantly improved enzyme activity and stability. The specific technical solution mainly includes the following steps:

[0027] Deoxyribonuclease I (DNaseI) was used to treat Virgibacillus byunsanensis The alkaline protease gene and the Ornithinibacillus caprae The alkaline protease gene of was obtained by digestion of the gene fragments;

[0028] The digested gene fragments are used as primers to obtain the gene fragment encoding the alkaline protease mutant by polymerase chain reaction (PCR);

[0029] Using the above alkaline protease mutant encoding gene fragment as a template, PCR amplification is performed to obtain amplified products, namely, a large number of alkaline protease mutant encoding genes;

[0030] Connecting the amplified product to a vector to obtain a recombinant vector;

[0031] The recombinant vector is transferred into the host bacterial cell to obtain the recombinant engineered bacteria;

[0032] The recombinant engineering bacteria are fermented, cultured, separated and purified to obtain the alkaline protease mutant.

[0033] In this embodiment, the Virgibacillus byunsanensis The alkaline protease gene and the Ornithinibacillus caprae The alkaline protease genes were derived from Virgibacillus byunsanensis The wild-type alkaline protease and Ornithinibacillus caprae The alkaline protease gene is synthesized after codon optimization of the wild-type alkaline protease gene sequence.

[0034] It should be noted that the vector may be one of the Bacillus subtilis expression vectors known to those skilled in the art for preparing protease by gene recombination. In this embodiment, the vector is pWB980.

[0035] It should also be noted that the host bacteria can be any strain suitable for the alkaline protease mutant of the present invention, such as Bacillus subtilis, Escherichia coli, Halomonas, etc. In this embodiment, the host bacteria is Bacillus subtilis WB600.

[0036] This embodiment also provides the use of the alkaline protease mutant in leather depilation. The leather can be common animal skin, such as sheepskin, cowhide, pigskin, etc. In this embodiment, the leather is sheepskin.

[0037] In this embodiment, the sheepskin is treated with NaCl at a concentration of ≤100 g / L and then dehaired using an alkaline protease mutant. The dehairing time can be shortened to 1.5-2 h at pH 7-9 and 40-50°C, which is similar to that derived from Virgibacillus byunsanensis Alkaline protease and Ornithinibacillus caprae Compared with alkaline protease, the hair removal efficiency is significantly improved.

[0038] In order to make the technical solution of the present invention clearer, the alkaline protease mutant is described in detail through multiple specific examples below.

[0039] The components of the culture medium used in the embodiment of the present invention are as follows:

[0040] LB solid medium: 5 g yeast powder, 10 g tryptone, 10 g NaCl, 950 mL deionized water, 15 g agar powder;

[0041] LB liquid medium: 5 g yeast powder, 10 g tryptone, 10 g NaCl, 950 mL deionized water;

[0042] GMI medium (10 mL): 10× Spizizen salts (containing 15% K2HPO4·3H2O, 6% KH2PO4, 2% (NH4)2SO4, 0.2% MgSO4, 1% sodium citrate) 1 mL, 10% yeast powder 0.1 mL, 20% glucose 0.25 mL, 1% hydrolyzed casein 0.2 mL, and the rest is distilled water;

[0043] GMII medium (10 mL): 10× Spizizen salts (containing 15% K2HPO4·3H2O, 6% KH2PO4, 2% (NH4)2SO4, 0.2% MgSO4, 1% sodium citrate) 1 mL, 10% yeast powder 0.05 mL, 20% glucose 0.25 mL, 1% hydrolyzed casein 0.04 mL, 0.1 M CaCl2 0.05 mL, 25 mM MgCl2 1 mL, and the rest is sterile water;

[0044] It should be noted that the above culture media need to be sterilized by high pressure at 120℃ for 20 min.

[0045] The method for determining the enzymatic activity of alkaline protease in the embodiment of the present invention is as follows: with reference to the Folin method for determination of protease activity in Appendix A of GB / T 23527.1-2023 "Quality Requirements for Enzyme Preparations Part 1: Protease Preparations", and the specific determination method is as follows:

[0046] (1) Preparation of standard curve: Prepare L-tyrosine standard solutions with concentrations of 0 μg / mL, 10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL and 50 μg / mL, respectively. Take 1 mL of each standard solution, add 5 mL of 0.4 mol / L sodium carbonate solution and 1 mL of Folin reagent solution (Folin: water = 1:2), shake evenly, place in a 40°C water bath for color development for 20 min, take out, place in a spectrophotometer to measure its absorbance at a wavelength of 680 nm, use tube 0 without tyrosine as blank, use absorbance A as the ordinate and tyrosine concentration C as the abscissa, and draw a standard curve (this line should pass through the zero point);

[0047] (2) Enzyme activity determination: Take 1 mL of pre-diluted enzyme solution, add 1 mL of 10% casein preheated at 40°C, mix well and react at 40°C for 10 min, then add 2 mL of 54% trichloroacetic acid solution, mix well and let stand at room temperature for 10 min to terminate the reaction. Take 1 mL of the terminated reaction solution, add 5 mL of 42.4 g / L sodium carbonate solution, then add 1 mL of Folin reagent, color in a 40°C water bath for 20 min, take out, place in a spectrophotometer to measure its absorbance at a wavelength of 680 nm, calculate the enzyme activity of the diluted enzyme solution based on the above standard curve, and then calculate the enzyme activity of the sample according to the following formula:

[0048] X=A×K×4 / 10×n

[0049] Wherein, X represents the enzyme activity of the sample (U / mL); A represents the absorbance of the sample; K represents the absorbance constant; 4 represents the total volume of the reaction reagent (mL); 10 represents the reaction time of 10 min; and n represents the dilution multiple.

[0050] Example 1 Preparation of alkaline protease

[0051] 1.1 Synthesis and amplification of alkaline protease genes aprV and aprO

[0052] according to Virgibacillus byunsanensis The gene sequence of wild-type alkaline protease (GenBank: WP_390363261.1), and Ornithinibacillus caprae The gene sequence of wild-type alkaline protease (GenBank: WP_155670955.1) was commissioned to Shanghai Sangon Biotechnology Co., Ltd. to optimize and synthesize the above gene sequence based on the gene sequence of protease and the codon preference of Bacillus subtilis. Virgibacillus byunsanensis The alkaline protease gene aprV (the gene sequence is shown in SEQ ID NO.1) and the optimized synthesized Ornithinibacillus capraealkaline protease gene aprO (gene sequence is shown in SEQ ID NO.2).

[0053] The optimized and synthesized alkaline protease genes were amplified by PCR.

[0054] The amplification reaction system is: DNA template 1 μL, upstream primer 2 μL, downstream primer 2 μL, ultra-fidelity DNA polymerase 1 μL, buffer 10 μL, add deionized water to make up to 50 μL;

[0055] The upstream and downstream primer sequences of the alkaline protease gene aprV are as follows:

[0056] Upstream primer aprVF: AAAAAGCTTATGTGGTCCCCGAATGATACC;

[0057] Downstream primer aprVR: AAAGGATCCTTAATAGTTGACTGCGTCACTTGAG;

[0058] The upstream and downstream primer sequences of the alkaline protease gene aprO are as follows:

[0059] Upstream primer aprOF: AAAAAGCTTATGTGGACGCCTAACGACC;

[0060] Downstream primer aprOR: AAAGGATCCTTAATAGTTGACAGCATCTAATGAG.

[0061] The reaction conditions for amplification were as follows: pre-denaturation at 95°C for 5 min, denaturation at 98°C for 20 s, annealing at 70°C for 30 s, extension at 72°C for 2 min, 25 cycles, and extension at 72°C for 10 min.

[0062] 1.2 Preparation of recombinant vector containing alkaline protease gene

[0063] The pWB980 plasmid was extracted using the Merck plasmid extraction kit. The extraction process was referred to the kit's operating manual. The extracted plasmid was Here dIII and Bam HI for double restriction digestion, the restriction digestion reaction system is 90 μL plasmid, 3 μL Here dIII, 3 μL Bam HI, 12 μL Quickcut Buffer, digest at 30°C for 2 h, and then perform agarose gel electrophoresis. Then, the product was recovered by DNA gel recovery kit to obtain the linearized pWB980 vector fragment;

[0064] The alkaline protease genes aprV and aprO amplified above were respectively Here dIII and Bam HI double digestion, the digestion reaction system is 90 μL amplified alkaline protease gene aprV or aprO, 3 μL Here dIII, 3 μL Bam HI, 12 μL rCutSmart Buffer, digested at 30°C for 2 h, treated with agarose gel electrophoresis, and recovered the products using a DNA gel recovery kit to obtain aprV gene fragments and aprO gene fragments, respectively;

[0065] The aprV gene fragment and the aprO gene fragment were ligated with the linearized pWB980 vector fragment to obtain the recombinant vectors pWB980-aprV and pWB980-aprO.

[0066] 1.3 Preparation of recombinant bacteria capable of expressing alkaline protease

[0067] The recombinant vectors pWB980-aprV and pWB980-aprO were transferred into the host Bacillus subtilis WB600 to obtain a recombinant engineered bacterium capable of expressing alkaline protease. The specific transfer method is as follows:

[0068] Activate Bacillus subtilis WB600 using LB solid medium overnight, pick a single colony in 5 mL GMI medium, shake overnight culture for 14 h, take 2 mL of bacterial solution the next day and transfer it to 18 mL GMI medium, shake culture at 37 ° C, 250 r / min for 3.5 hours, take 10 mL of the above culture solution and transfer it to 90 mL GMII medium, shake culture at 37 ° C, 150 r / min for 1.5 h, and obtain Bacillus subtilis WB600 competent cells;

[0069] 1 μL of the recombinant vector pWB980-aprV and 1 μL of the recombinant vector pWB980-aprO were added to 100 μL of Bacillus subtilis WB600 competent cells, flicked to mix, and vibrated at 37°C, 200 rpm for 1.5 h to recover. Then, the cells were spread on LB solid medium (containing 2% skim milk powder and 50 μg / mL tetracycline) and inverted overnight at 37°C to obtain the expression vector derived from Virgibacillus byunsanensis Recombinant engineering bacteria and bacteria capable of expressing alkaline protease derived from Ornithinibacillus caprae Recombinant engineering bacteria producing alkaline protease.

[0070] The above recombinant engineering strains were inoculated into 5 mL LB liquid medium (containing 50 μg / mL tetracycline) and cultured at 37°C, 220 r / min for 12 h. Then, they were transferred to new LB liquid medium at a 2% inoculum and cultured at 37°C, 220 r / min for 48 h. After the culture was completed, they were allowed to stand at 4°C for 30 min to remove the precipitate. The supernatant was obtained from Virgibacillus byunsanensis Alkaline protease and Ornithinibacillus caprae Alkaline protease, specifically derived from Virgibacillus byunsanensis Alkaline protease enzyme solution and derived from Ornithinibacillus caprae Alkaline protease enzyme solution.

[0071] The enzyme activity of the enzyme solution at 50°C and pH 10 was measured, and the measured enzyme activity of the enzyme solution was the enzyme activity of the wild-type alkaline protease. Virgibacillus byunsanensis The enzyme activity of alkaline protease is 36.27 U / mL, derived from Ornithinibacillus caprae The enzyme activity of alkaline protease was 53.14 U / mL.

[0072] Example 2 Preparation of alkaline protease mutants

[0073] 2.1 Preparation and amplification of alkaline protease mutant encoding genes

[0074] The alkaline protease genes aprV and aprO were digested with Dnase I, respectively. The specific method was as follows: 3 μL of alkaline protease gene was taken, 1 μL of DnaseI (1 U / μL) and 21 μL of ddH2O were added, mixed, and reacted at 15°C for 20 min, then heated at 90°C for 10 min to terminate the reaction, and after the reaction, agarose gel electrophoresis was performed, and a DNA gel recovery kit was used to recover fragments of about 120 bp to obtain digested aprV gene fragments and aprO gene fragments.

[0075] The digested aprV gene fragment and the aprO gene fragment are used as primers to obtain the gene encoding the alkaline protease mutant through PCR reaction;

[0076] The reaction system was: 10 μL of digested aprV gene fragment, 10 μL of digested aprO gene fragment, 1 μL of deoxynucleotide triphosphates (dNTPs), 25 μL of ultra-fidelity DNA polymerase, and 4 μL of deionized water;

[0077] The reaction conditions were as follows: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 45 cycles, and extension at 72°C for 10 min.

[0078] Using the above alkaline protease mutant encoding gene as a template, PCR amplification is performed to obtain amplification products, namely, a large number of alkaline protease mutant encoding genes;

[0079] The amplification reaction system was: 1 μL DNA template, 1 μL first primer, 1 μL second primer, 25 μL ultra-fidelity DNA polymerase, and 22 μL deionized water;

[0080] The first primer sequence was: CAACTCAAGCTTTTGCCATGTGGACGCCTAACGACC;

[0081] The second primer sequence is:

[0082] GTCGACTCTAGAGGATCCTTAATAGTTGACAGCATCTAATGAG.

[0083] The reaction conditions for amplification were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20 s, annealing at 65°C for 20 s, extension at 72°C for 1 min, 35 cycles, and extension at 72°C for 10 min.

[0084] 2.2 Preparation of recombinant vector containing alkaline protease mutant encoding gene

[0085] The amplified product was connected to the vector pWB980 plasmid using a homologous recombination kit to obtain a recombinant vector.

[0086] 2.3 Preparation of recombinant bacteria capable of expressing alkaline protease mutants

[0087] According to the method in Section 1.3 of Example 1, the recombinant vector was transferred into the engineered bacterium Bacillus subtilis WB600 to obtain a recombinant engineered bacterium capable of expressing the alkaline protease mutant.

[0088] 2.4 Screening of alkaline protease mutants

[0089] The above recombinant engineered bacteria were inoculated on LB solid medium (containing 50 μg / mL tetracycline), cultured at 37°C for 12 h, and then a single colony was picked and inoculated into 5 mL LB liquid medium (containing 50 μg / mL tetracycline), and cultured at 37°C and 220 r / min for 12 h. Subsequently, the above culture solution was transferred to a 96-well deep-well plate at a 2% inoculation amount, and cultured at 37°C and 600 r / min for 48 h. After the culture was completed, it was allowed to stand at 4°C for 30 min, the precipitate was removed, and the supernatant of each well (i.e., the crude enzyme solution of the alkaline protease mutant) was taken to determine its enzyme activity at 50°C and pH 10, and the measured enzyme activity was compared with the above-mentioned Virgibacillus byunsanensis Alkaline protease and Ornithinibacillus capraeThe enzyme activity of alkaline protease of the present invention is compared with that of the present invention, and the crude enzyme solution of alkaline protease mutant with improved enzyme activity is obtained by preliminary screening. The above steps are repeated for rescreening, and finally the crude enzyme solution of alkaline protease mutant with significantly improved enzyme activity is obtained by screening.

[0090] The crude enzyme solution of the alkaline protease mutant is separated and purified to obtain the alkaline protease mutant. The specific separation and purification method is:

[0091] The alkaline protease mutant crude enzyme solution finally screened was salted out using 70% saturation ammonium sulfate, and the precipitate formed was collected and redissolved in 50 mM Tris-HCl buffer (pH 9), and centrifuged at 4 °C and 8000 rpm for 15 min. The supernatant was dialyzed (molecular weight cutoff 8k Da) and membrane filtered (0.45 μm water filter membrane) as the enzyme-containing sample solution for further purification;

[0092] Using a protein purifier, the enzyme-containing loading solution was injected into a Q anion exchange column that had been equilibrated with 50 mM Tris-HCl buffer (pH 9). After loading, Tris-HCl buffer was added at a uniform rate to remove foreign proteins, pigments, etc. that were not bound to the Q-sepharose filler. Subsequently, gradient elution was performed using Tris-HCl buffer containing 0-2 M NaCl at a flow rate of 4 mL / min, and the effluents with chromatographic absorption peaks were collected, which were the alkaline protease mutants, specifically the alkaline protease mutant enzyme solution.

[0093] The coding gene sequencing and amino acid sequencing of the alkaline protease mutant were performed, and the gene sequence is shown as SEQ ID NO.3, and the amino acid sequence is shown as SEQ ID NO.4.

[0094] The enzyme activity of the alkaline protease mutant was measured at 50° C. and pH 10. The enzyme activity was found to be 87.33 U / mL.

[0095] Example 3 Investigation of enzymatic properties of alkaline protease mutants

[0096] 1. Optimum temperature of alkaline protease mutants

[0097] Under the condition of pH 10, the enzyme activity of the alkaline protease mutant was measured between 20-70°C. The temperature with the highest enzyme activity was the optimal temperature of the alkaline protease mutant, and this enzyme activity was defined as 100%, and the relative enzyme activity under the other temperature conditions was calculated.

[0098] The test results are shown in Table 1. The optimum temperature of the alkaline protease mutant of the present invention is 45°C, and the relative enzyme activity is maintained above 90% under the condition of 40-50°C.

[0099] Table 1 Relative enzyme activities of alkaline protease mutants at different temperatures

[0100] .

[0101] 2. Optimal pH of alkaline protease mutants

[0102] Under the condition of temperature 45°C, the enzyme activity of the alkaline protease mutant was measured between pH 5 and 12. The pH with the highest enzyme activity was the optimal pH of the alkaline protease mutant, and the enzyme activity was defined as 100%, and the relative enzyme activity under other pH conditions was calculated.

[0103] The determination results are shown in Table 2. The optimum pH of the alkaline protease mutant of the present invention is 10, and the relative enzyme activity is maintained above 90% under the condition of pH 9-11.

[0104] Table 2 Relative enzyme activities of alkaline protease mutants at different pH

[0105] .

[0106] 3. Thermal stability of alkaline protease

[0107] The thermal stability of the alkaline protease mutant was determined under pH 8 conditions, that is, the alkaline protease mutant was incubated at 20-70°C for 12 h, and the residual enzyme activity of the alkaline protease mutant was determined and calculated, and the initial enzyme activity at 0 h of incubation was positioned as 100%.

[0108] After incubation for 12 h at 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C and 70°C, the residual enzyme activities of the alkaline protease of the present invention are 98.26%, 97.46%, 95.42%, 94.88%, 94.56%, 93.4%, 91.61%, 82.15%, 73.4%, 52.12% and 28.46%, respectively.

[0109] 4. pH stability of alkaline protease mutants

[0110] The pH stability of the alkaline protease mutant was determined at 45°C, that is, the alkaline protease mutant was incubated at pH 7-12 for 12 h, and the residual enzyme activity of the alkaline protease mutant was determined and calculated, and the initial enzyme activity at 0 h of incubation was positioned as 100%.

[0111] The alkaline protease mutants of the present invention were incubated for 12 h under pH 5, 6, 7, 8, 9, 10, 11, and 12, and the residual enzyme activities were 43.25%, 74.26%, 90.67%, 93.27%, 91.2%, 78.74%, 63.31%, and 41.15%, respectively.

[0112] 5. Salt tolerance of alkaline protease mutants

[0113] The salt tolerance of the alkaline protease mutants was determined at 45°C and pH 8, that is, the alkaline protease mutants were incubated in NaCl solutions with concentrations of 0 g / L, 20 g / L, 40 g / L, 60 g / L, 80 g / L, 100 g / L, 120 g / L, 140 g / L, 160 g / L, 180 g / L, and 200 g / L for 12 h, and the residual enzyme activity of the alkaline protease mutants was determined and calculated, and the initial enzyme activity at 0 h of incubation was positioned as 100%.

[0114] The alkaline protease mutants of the present invention were incubated for 12 h in NaCl solutions with concentrations of 0 g / L, 20 g / L, 40 g / L, 60 g / L, 80 g / L, 100 g / L, 120 g / L, 140 g / L, 160 g / L, 180 g / L and 200 g / L, and the residual enzyme activities were 99.55%, 99.06%, 98.67%, 96.87%, 96.2%, 95.24%, 82.31%, 76.15%, 60.27%, 43.48% and 22.39%, respectively.

[0115] Example 4 Application of alkaline protease mutants in sheepskin depilation

[0116] Treatment group A: After washing, pre-immersion, main immersion and water control, the whole fresh sheepskin was placed in a temperature-controlled drum, 180% of the sheepskin weight of water was added, the pH was adjusted to 8.5 with sodium carbonate, and then 20% of the sheepskin weight and 100 g / L of NaCl were added, and the drum was rotated at 30°C for 30 min;

[0117] 3% of the weight of the sheepskin was added to the above-mentioned temperature-controlled drum. The pH was adjusted to 7 with sodium carbonate. The drum was rotated at 40° C. for 30 min and then stopped for 30 min until all the hair fell off.

[0118] The total dehairing time under this treatment is 2 h, and the obtained bare leather has a smooth, flat and clean grain surface, a high whiteness and no visible damage.

[0119] Treatment group B: After washing, pre-immersion, main immersion and water control, the whole fresh sheepskin was placed in a temperature-controlled drum, 180% of the sheepskin weight of water was added, the pH was adjusted to 8.5 with sodium carbonate, and then 20% of the sheepskin weight and 100 g / L NaCl was added, and the drum was rotated at 30°C for 30 min;

[0120] 3% of the weight of the sheepskin was added to the above-mentioned temperature-controlled drum. The pH was adjusted to 8 with sodium carbonate. The drum was rotated at 45° C. for 30 min and then stopped for 30 min until all the hair fell off.

[0121] The total dehairing time under this treatment was 1.5 h, and the obtained bare leather had a smooth, flat and clean grain surface, a high degree of whiteness and no visible damage.

[0122] Treatment group C: After washing, pre-immersion, main immersion and water control, the whole fresh sheepskin was placed in a temperature-controlled drum, 180% of the sheepskin weight of water was added, the pH was adjusted to 8.5 with sodium carbonate, and then 20% of the sheepskin weight and 100 g / L of NaCl were added, and the drum was rotated at 30°C for 30 min;

[0123] 3% of the weight of the sheepskin was added to the above-mentioned temperature-controlled drum. The pH was adjusted to 9 with sodium carbonate. The drum was rotated at 50° C. for 30 min and then stopped for 30 min until all the hair fell off.

[0124] The total dehairing time under this treatment was 1.5 h, and the obtained bare leather had a smooth, flat and clean grain surface, a high degree of whiteness and no visible damage.

[0125] Control group A: After washing, pre-immersion, main immersion and water control, the whole fresh sheepskin was placed in a temperature-controlled drum, 180% of the sheepskin weight of water was added, the pH was adjusted to 8.5 with sodium carbonate, and then 20% of the sheepskin weight and 100 g / L of NaCl were added, and the drum was rotated at 30°C for 30 min;

[0126] 3% of the sheepskin mass in Example 1 from Vi was added to the above-mentioned temperature-controlled drum. rgibacillus byunsanensis alkaline protease, adjust the pH to 9 with sodium carbonate, rotate at 40°C for 30 min, and stop for 30 min until all the hair falls off.

[0127] The total dehairing time under this treatment was 5 h, and the bare leather obtained had a relatively smooth, flat and clean grain surface, average whiteness and slightly visible damage.

[0128] Control group B: After washing, pre-immersion, main immersion and water control, the whole fresh sheepskin was placed in a temperature-controlled drum, 180% of the sheepskin weight of water was added, the pH was adjusted to 8.5 with sodium carbonate, and then 20% of the sheepskin weight and 100 g / L NaCl was added, and the drum was rotated at 30°C for 30 min;

[0129] 3% of the sheepskin mass of Example 1 from Ornithinibacillus goats alkaline protease, adjust the pH to 9 with sodium carbonate, rotate at 40°C for 30 min, and stop for 30 min until all the hair falls off.

[0130] The total dehairing time under this treatment was 4.5 h, and the resulting bare leather grain surface was relatively smooth, flat and clean, with average whiteness and slight visible damage.

[0131] Those skilled in the art may make various changes, modifications, substitutions and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. An alkaline protease mutant, characterized in that The amino acid sequence of the alkaline protease mutant is shown in SEQ ID NO.

4.

2. A gene encoding the alkaline protease mutant according to claim 1.

3. A recombinant vector, characterized in that: Comprising the gene according to claim 2.

4. The recombinant vector according to claim 3, characterized in that The vector is pWB980.

5. A recombinant engineered bacterium, characterized in that: Comprising the recombinant vector according to claim 3 or 4.

6. The recombinant engineered bacterium according to claim 5, characterized in that The host bacteria of the recombinant engineering bacteria is Bacillus subtilis WB600.

7. Use of the alkaline protease mutant as claimed in claim 1 in leather dehairing.

8. The use according to claim 7, characterized in that The leather is salt-wet animal skin treated with NaCl at a concentration of ≤100 g / L for preservation.

9. The use according to claim 8, characterized in that The animal skin includes any one of sheepskin, cowhide and pigskin.