Application of SlNAC61 gene and protein coded by SlNAC61 gene in regulation and control of salt tolerance of tomato

Abstract

The invention is suitable for the technical field of molecular biology, and provides an application of an SlNAC61 gene and a protein coded by the SlNAC61 gene in regulating and controlling the salt tolerance of tomatoes. According to the invention, an SlNAC61 overexpression vector is successfully constructed and is introduced into a tomato plant, and an SlNAC61 overexpression strain is screened out. Under the condition of salt stress, the oxidative damage degree of leaves of an SlNAC61 overexpression plant is relatively light, which suggests that the SlNAC61 gene may influence the salt tolerance of the plant by regulating the accumulation of ROS in the plant. Besides, after long-time salt stress treatment, the wilting degree of the SlNAC61 overexpression strain is relatively light, and the reduction ratio of the plant height, stem diameter, fresh root weight and dry root weight is lower than that of a wild plant MT. The result shows that overexpression of the SlNAC61 gene can enhance the salt tolerance of the tomato plant, and an important theoretical basis and a practical basis are provided for subsequently cultivating a salt-tolerant tomato variety by using a gene engineering means.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to the application of SlNAC61 gene and protein encoded thereby in regulating salt tolerance of tomatoes. Background Art

[0002] Soil salinization is a long-term problem facing global agriculture, especially in arid and semi-arid areas, posing a serious threat to sustainable agricultural development. In recent years, global climate change and irrational agricultural activities have exacerbated this problem, causing about 20% of agricultural land and 33% of irrigated farmland in the world to suffer from salt stress. The osmotic stress and ion toxicity caused by salinization seriously interfere with the water absorption and ion balance of crops, thereby affecting plant photosynthesis, energy metabolism and nutrient absorption, ultimately leading to reduced crop yields, which has a profound impact on global food security and agricultural economy.

[0003] Tomato (Solanum lycopersicum) is an important horticultural crop widely grown around the world. It is favored by consumers for its rich nutritional value and unique flavor, and the market demand is huge. However, salt stress poses a huge challenge to tomato production. In a high-salt environment, the growth of tomato plants is significantly inhibited, manifested as slow growth, leaf chlorosis, premature senescence, etc., and leads to a decrease in yield and fruit quality. Therefore, in-depth research on the functional mechanism of tomato salt-tolerance-related genes, analyzing the molecular basis of its salt tolerance, and cultivating salt-tolerant tomato varieties through modern biotechnology are effective ways to improve the efficiency and stability of tomato production, which has important practical significance for ensuring the sustainable development of the global tomato industry.

[0004] During the long-term evolution, plants have formed a variety of physiological mechanisms and molecular regulatory strategies to cope with salt stress, including regulating ion homeostasis, synthesizing osmotic regulating substances, removing reactive oxygen species (ROS), and maintaining hormone balance in the body. At the same time, plants have also constructed complex molecular regulatory networks, including gene expression regulation, signal transduction pathways, and the participation of transcription factors. In the response to salt stress, multiple transcription factor families play an important role, such as NAC, MYB, DREB, etc. Among them, the NAC (NAM, ATAF1 / 2, CUC2) transcription factor family is a class of gene regulatory factors unique to plants. It has been identified in many plants and has been proven to be involved in regulating growth and development, stress response, secondary metabolism and other processes. In tomatoes, more than 60 NAC genes have been identified, which are widely involved in plant responses to biotic and abiotic stresses, as well as organelle function and signal transduction regulation. Different NAC genes have great differences in function. Although some NAC genes have been shown to be closely related to plant salt tolerance, the specific functional roles of other members of the tomato NAC family in responding to salt stress still need to be further studied. To this end, the present invention proposes the application of the SlNAC61 gene and the protein it encodes in regulating tomato salt tolerance. Summary of the invention

[0005] The purpose of the present invention is to provide the application of SlNAC61 gene and the protein encoded by it in regulating the salt tolerance of tomatoes, aiming to solve the problems raised in the above background technology.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] The application of the SlNAC61 gene and the protein encoded by it in regulating the salt tolerance of tomatoes is characterized in that the nucleotide sequence of the SlNAC61 gene is shown in SEQ ID No.1, and the amino acid sequence of the protein encoded by the SlNAC61 gene is shown in SEQ ID No.2.

[0008] Furthermore, the SlNAC61 gene affects the salt tolerance of tomato plants by regulating the accumulation of ROS in tomato plants.

[0009] Compared with the prior art, the present invention has the following beneficial effects:

[0010] The present invention successfully constructs a SlNAC61 overexpression vector and introduces it into a tomato plant, and screens out a SlNAC61 overexpression strain. Under salt stress conditions, it is found that the degree of oxidative damage of the leaves of the SlNAC61 overexpression plant is relatively light, which suggests that the SlNAC61 gene may affect the salt tolerance of the plant by regulating the accumulation of ROS in the plant. In addition, after a long period of salt stress treatment, although the growth conditions of all plants are affected to a certain extent, the wilting degree of the SlNAC61 overexpression strain is relatively light, and the ratio of plant height, stem thickness, root fresh weight and root dry weight reduction is also lower than that of the wild-type plant MT. This shows that the overexpression of the SlNAC61 gene can enhance the salt tolerance of tomato plants, and provides an important theoretical basis and practical foundation for the subsequent use of genetic engineering methods to cultivate salt-tolerant tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 This is the result of the rubber recovery test.

[0012] Figure 2 The results of transformation of Escherichia coli were shown in Figure 2.

[0013] Figure 3 The results of Agrobacterium detection.

[0014] Figure 4 The results of positive seedling detection; wherein, M represents Marker, lanes 1-20 are different overexpression plants, lane 21 is the wild-type plant MT, and lane 22 is the positive control.

[0015] Figure 5 Shown is the gene expression of SlNAC61 overexpressing plants.

[0016] Figure 6 The phenotypic observation results of SlNAC61 overexpressing plants.

[0017] Figure 7 DAB staining and NBT staining were performed on the leaves of wild-type MT and SlNAC61 overexpressing plants.

[0018] Figure 8 The growth of wild-type MT and SlNAC61 overexpressing plants under salt stress. DETAILED DESCRIPTION

[0019] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of the present invention. The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials can be obtained from commercial sources unless otherwise specified.

[0020] The specific implementation of the present invention is described in detail below in conjunction with specific embodiments.

[0021] Example 1: Obtaining transgenic plants;

[0022] 1. Construction of overexpression vector: Total RNA was extracted from leaves of 4-week-old wild-type tomato plants (variety MT) and reverse transcribed to obtain the first-chain cDNA;

[0023] Upstream primer S1NAC61-F (as shown in SEQ ID No.3):

[0024] GGAGAGAACACGGGGGACTTTGCAACATGAGTGAAAAAAGAGTAG AAAAAATGG

[0025] Downstream primer S1NAC61-R (as shown in SEQ ID No.4):

[0026] CCACTCCCTGAAGCGGCCGCTGTACATTTAAATCCAAAGAGACTAC GAGG

[0027] Using upstream primer SlNAC61-F and downstream primer SlNAC61-R, PCR amplification was performed with cDNA as template. After obtaining the target fragment, gel electrophoresis was performed for gel recovery. The PCR results are shown in Figure 1 As shown, both lanes have a clear single band at a size of about 1000 bp.

[0028] The pBWA(V)HS-GLosGFP vector was digested with enzymes, and the target gene fragment was connected with the digested vector by seamless cloning to construct a complete overexpression vector.

[0029] 2. Transformation of plasmid into E. coli;

[0030] (1) Thaw 50 μL of Trans1-T1 competent cells on ice. Add 2 μL of the recombinant product to the competent cells in a clean bench and mix gently with a 200 μL pipette.

[0031] (2) After standing on ice for 30 min, the cells were immediately heat-shocked at 42°C for 45 s and then cooled on ice for 2 min.

[0032] (3) Add 450 μL of antibiotic-free LB liquid culture medium to the centrifuge tube and incubate at 37°C, 200 rpm, for 1 h.

[0033] (4) Take 100 μL of bacterial solution and apply it to a kanamycin-resistant LB plate and culture it in a 37°C incubator overnight.

[0034] (5) After positive colonies were taken for verification, plasmids were extracted and sequenced. The results of transformed E. coli PCR test (SlNAC61-F and GFP-R primers) were as follows: Figure 2 As shown, lanes 1-4 contain target bands at a size of about 1500 bp, indicating that all four single colonies are positive clones.

[0035] 3. Obtain overexpression plants by Agrobacterium-mediated genetic transformation;

[0036] (1) Take 50 μL of GV3101 Agrobacterium competent cells stored in a -80°C refrigerator, thaw at room temperature, and place on ice. Add 1 μL of plasmid to the competent cells in an ultra-clean workbench and mix by whipping.

[0037] (2) Place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min.

[0038] (3) Add 500 μL of antibiotic-free LB liquid culture medium to the centrifuge tube and culture in a shaker at 28°C and 200 rpm for 3 h.

[0039] (4) Take about 100 μL of the bacterial solution and spread it on an LB plate containing rifampicin (25 mg / L) and kanamycin (50 mg / L), then invert and place it in a 28°C incubator for 2 to 3 days.

[0040] (5) Select a single colony to verify the positive result and add glycerol to store it in a -80℃ refrigerator for later use. Figure 3 As shown, the target bands can be detected in lanes 1-5 at a size of about 1500 bp, indicating that the five Agrobacterium single colonies are all positive clones.

[0041] 4. Obtaining SlNAC61 overexpressing plants by leaf disc method;

[0042] (1) Aseptic sowing was performed to obtain sterile tomato seedlings. 6-8 day old cotyledons were cut as explants and pre-cultured for 2 days.

[0043] (2) Agrobacterium infection: The explants were infected with GV3101 Agrobacterium solution containing the expression plasmid for 12 minutes.

[0044] (3) Co-cultivation: co-cultivation at 24-26°C for 2 days.

[0045] (4) Screening and subculture: The explants were transferred to a screening medium containing 10 mg / L hyp and screened for 2 weeks. The positive seedlings were then selected for subculture.

[0046] (5) Rooting culture: When the buds grow to 2 cm, they are cut and cultured for rooting.

[0047] (6) Transplantation, acclimatization and transplanting.

[0048] (7) Positive seedling detection to confirm whether the positive seedlings have been successfully introduced into the SlNAC61 gene. Figure 4 As shown, lanes 1-20 all have target bands of the same size as the positive control, and the negative control (MT) has no bands, indicating that all 20 plants tested are positive plants.

[0049] Example 2, salt tolerance identification;

[0050] 1. Planting of plant materials: Take tomato seeds of different strains, prepare a culture dish with filter paper, soak it with clean water, spread the tomato seeds evenly, and sow them in the soil after dark treatment for about 4-5 days; then divide the seedlings when they have 2-3 true leaves, and move them to vermiculite after positive detection; place them in an incubator for cultivation at a temperature of 25 (day) / 20℃ (night), a photoperiod of 16h light / 8h dark cycle, and irrigate with 1 / 2 Hoagland nutrient solution in the early stage and with complete Hoagland nutrient solution in the later stage.

[0051] 2. Identification of transgenic positive seedlings: After extracting DNA from different plants, use PCR to detect positive plants. The primers are as follows:

[0052] S1NAC61-F (as shown in SEQ ID No.5):

[0053] ATGAGTGAAAAAAGAGTAGAAAAAATGG

[0054] GFP-R (as shown in SEQ ID No.6):

[0055] AAGTTCACCTTGATGCCGTTC

[0056] The PCR reaction system (10 μL) is shown in Table 1:

[0057] Table 1 PCR reaction system

[0058]

[0059] The reaction conditions are shown in Table 2:

[0060] Table 2 PCR reaction conditions

[0061]

[0062] Prepare electrophoresis solution using agarose and TAE buffer (at a ratio of 1g:100mL), add 2μL EB to replace the dye. For electrophoresis detection, use the plasmid as a positive control and extract the DNA of wild-type plant MT as a negative control. The positive plant is the one with the corresponding band to the positive control.

[0063] 3. Expression and phenotype observation of SlNAC61 overexpressing plants;

[0064] The expression of SlNAC61 gene was detected by real-time fluorescence quantitative technology. The results showed that the expression levels of SlNAC61 overexpression lines OE#1, OE#2 and OE#3 were increased to varying degrees compared with the wild-type plant MT, and the expression levels of different lines were different ( Figure 5 During the growth of the plants, it was found that there were significant differences in plant height and stem diameter between the 5-week-old wild-type plants MT and the SlNAC61 overexpressing plants. The plant height and stem diameter of the SlNAC61 overexpressing plants were significantly lower than those of the wild-type plants MT ( Figure 6 ).

[0065] 4. Analysis of salt tolerance of SlNAC61 overexpressing plants;

[0066] The wild-type plants MT and SlNAC61 overexpressing plants were irrigated with Hoagland's nutrient solution containing 150 mM NaCl (experimental group, Salt) and Hoagland's nutrient solution without NaCl (control group), respectively.

[0067] After 5 days of treatment, the fourth true leaf of tomato was taken for DAB and NBT staining. Figure 7 It can be seen that in the untreated control group, there was no significant difference in DAB staining and NBT staining between the leaves of the wild-type plant MT and the SlNAC61 overexpression plant, indicating that the leaves of both were almost undamaged. In the experimental group after salt stress treatment, the leaves of the SlNAC61 overexpression plant were light in color after DAB and NBT staining, indicating that compared with the wild-type plant MT, the leaves of the SlNAC61 overexpression plant accumulated less H2O2 and superoxide anions, and the degree of oxidative damage was lighter. Therefore, it is speculated that the SlNAC61 gene may affect plant salt tolerance by affecting the accumulation of ROS in the plant.

[0068] After 7 days of treatment, the growth status of the plants was observed and recorded. Figure 8 It can be seen that in the untreated control group, the plant height, stem diameter, root fresh weight and root dry weight of the SlNAC61 overexpression plants were significantly lower than those of the wild-type plants MT. In the experimental group after salt stress treatment, although the SlNAC61 overexpression lines and the wild-type plants MT had a certain degree of wilting, and the plant height, stem diameter, root fresh weight and root dry weight were lower than those of the control group, compared with the wild-type plants MT, the SlNAC61 overexpression lines had a lighter degree of wilting, and the ratio of plant height, stem diameter, root fresh weight and root dry weight reduction was also lower.

[0069] In summary, the growth condition of SlNAC61 overexpressing plants under salt stress was better than that of wild-type plants MT, indicating that SlNAC61 gene overexpression can enhance the salt tolerance of tomato plants.

[0070] The above are only preferred embodiments of the present invention. It should be pointed out that, for those skilled in the art, several modifications and improvements can be made without departing from the concept of the present invention. These should also be regarded as the protection scope of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. Application of SlNAC61 gene and its encoded protein in regulating salt tolerance of tomatoes, It is characterized in that The nucleotide sequence of the SlNAC61 gene is shown as SEQ ID No.1, and the amino acid sequence of the protein encoded by the SlNAC61 gene is shown as SEQ ID No.

2.

2. The use according to claim 1, wherein the SlNAC61 gene affects the salt tolerance of tomato plants by regulating the accumulation of ROS in tomato plants.

Images