PiRNA-362733 biomarker for diagnosis or treatment and application of piRNA-362733 biomarker

Abstract

The invention discloses a piRNA-362733 biomarker for diagnosis or treatment and an application of the piRNA-362733 biomarker. The novel molecule is related to colorectal cancer, qPCR verification shows that the novel molecule is highly expressed in human colorectal cancer tissues and cells, the piRNA molecule is not found in previous researches on colorectal cancer, other types of tumors and non-tumors, in-vitro experiments show that the piRNA-362733 inhibitor can inhibit the proliferation, invasion and migration of colorectal cancer cells, and the piRNA molecule can be used for inhibiting the colorectal cancer cells. Therefore, piRNA-362733 is expected to become a biomarker for predicting invasion and metastasis of human colorectal cancer and a potential molecular treatment target for improving prognosis.

Description

Technical field:

[0001] The invention belongs to the field of biotechnology and relates to a new tumor marker piRNA-362733 and its application in predicting, diagnosing and treating invasion and metastasis of colorectal cancer. Background technology:

[0002] Colorectal cancer (CRC) is the third most common cancer and the second leading cause of cancer-related death in the world. There are no specific symptoms and effective screening methods in the early stages of colorectal cancer. Most patients are diagnosed in the advanced stage, and distant metastasis seriously affects the patient's prognosis. At present, except for surgical resection and chemotherapy, other treatment methods are less effective. Therefore, finding optimized markers and treatment methods has become an urgent clinical need. There are very few studies that can improve early diagnosis, so it is of great significance to screen out new small molecule targets for early diagnosis and prognosis.

[0003] In recent years, a new type of non-coding small RNA-Piwi-interacting RNA (piRNA) has been further studied. The length of piRNA is generally 24 to 33 nucleotides (nuclotide, nt), and it can specifically bind to Piwi protein to exert its effect. Since the genes encoding piRNA are almost distributed throughout the entire genome, piRNA has existed in the early origin of life and has been retained in the natural selection evolution of species. Since the discovery of piRNA, research on it has progressed rapidly, and it has been found that it plays an important role in germ stem cell differentiation, embryonic development, maintaining DNA integrity, epigenetic regulation, and sex determination of species. More and more evidence shows that piRNA is abnormally expressed in a variety of tumors, which is of great significance for the early diagnosis and treatment of cancer. Summary of the invention:

[0004] In order to achieve early diagnosis and targeted treatment of colorectal cancer, the first purpose of the present invention is to screen a piRNA for predicting, diagnosing and treating the invasion and metastasis of colorectal cancer. The second aspect of the present invention aims to provide the use of a marker piRNA inhibitor in the preparation of a colorectal cancer treatment preparation, especially the use of a preparation for inhibiting the invasion and metastasis of human colorectal cancer cells. The third aspect of the present invention aims to provide a marker piRNA inhibitor as a colorectal cancer treatment drug. The fourth aspect of the present invention aims to provide the use of a reagent for detecting the piRNA-362733 in the preparation of a colorectal cancer diagnosis and / or prognosis preparation.

[0005] To achieve the first objective, the present invention provides a piRNA that is significantly highly expressed in colorectal cancer tissues, wherein the marker is piRNA-362733, and its nucleic acid sequence is: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAACA

[0006] The second aspect of the present invention aims to provide a method for preparing a colorectal cancer treatment preparation using a reagent for inhibiting the expression of piRNA-362733, in particular a preparation capable of reducing the proliferation, invasion and migration of colorectal cancer cells.

[0007] The third aspect of the present invention aims to provide a preparation for treating colorectal cancer, which is an agent for inhibiting the expression of piRNA-362733. Preferably, the sequence of the piRNA-362733 inhibitor is TTCAACATCAGTCTGATAAGCTACC.

[0008] The fourth aspect of the present invention aims to provide a reagent for detecting the piRNA-362733 for use in preparing a colorectal cancer diagnosis and / or prognosis preparation.

[0009] Furthermore, the colorectal cancer diagnosis and / or prognosis preparation includes a PCR detection reagent, and the primer sequence of the PCR detection reagent is as follows:

[0010] F:5'-GTAGCTTATCAGACTGATGTTG-3'

[0011] R:5'-GTCGTATCCAGTGCAGGGTCCGAGGT-3';

[0012] The β-actin internal reference primer sequence is as follows

[0013] F: 5'-GGGAATCGTGCGTGACATTAAG-3'

[0014] R: 5'-TGTGTTGGCGTACAGGTCTTTG-3'.

[0015] The present invention uses real-time quantitative PCR to expand sample verification and confirm that piRNA-362733 is highly expressed in colorectal cancer tissues and cells. This piRNA molecule has not been discovered in previous studies on colorectal cancer, other types of tumors, and non-tumors, so it has good innovation. Cell experiments also further verified the mechanism of action of piRNA-362733 in colorectal cancer cell lines, and piRNA-362733 inhibitors can inhibit the proliferation, invasion, and migration of colorectal cancer cells.

[0016] The present invention verifies that piRNA-362733 is upregulated in colorectal cancer tissues and cells, which is statistically significant, the experimental process is rigorous, and the results are authentic and reliable.

[0017] The piRNA-362733 inhibitor provided by the present invention can be used as a colorectal cancer targeted therapeutic agent, providing a reliable product for improving the therapeutic efficacy of colorectal cancer.

[0018] In the verification process of the present invention, the highly expressed piRNA-362733 was first screened out in colorectal cancer tissues, and the piRNA-362733 inhibitor can effectively downregulate the expression of piRNA-362733 in colorectal cancer cells. In addition, the piRNA-362733 inhibitor can inhibit the proliferation, invasion and migration of colorectal cancer cells.

[0019] The present invention detected clinical tissue samples (n=60) and found that piRNA-362733 was highly expressed in colorectal cancer tissues. The use of piRNA-362733 inhibitors can inhibit the proliferation, invasion and migration of colorectal cancer cells. The present invention provides a powerful molecular biological tool for tumor diagnosis and treatment, and has far-reaching clinical significance and important prospects for promotion and application.

[0020] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, but will not be limited to the present invention. Description of the drawings:

[0021] Figure 1 A is the differential piRNA expression analysis between 3 pairs of colorectal cancer tissues and corresponding normal tissues, and cluster heat map analysis of differentially expressed piRNAs; Figure 1 B is the volcano plot analysis of differentially expressed piRNAs.

[0022] Figure 2 A is the expression analysis of piRNA-362733 in colorectal cancer tissues and normal tissues; Figure 2 B is the expression level of piRNA-362733 in colorectal cancer cells (SW480 and HCT116); Figure 2 C is the expression level of piRNA-362733 after piRNA-NC and piRNA-inhibitor transfection of colorectal cancer cells (SW480 and HCT116). (The two groups were statistically analyzed by independent sample t-test, ** represents p<0.01, *** represents p<0.001).

[0023] Figure 3The ROC curve was used to evaluate the sensitivity and specificity of piRNA-362733 for the diagnosis of colorectal cancer. The AUC value was 0.762, the sensitivity was 0.875, and the specificity was 0.649.

[0024] Figure 4 To inhibit the proliferation, invasion and migration of colorectal cancer cells HCT116 after using piRNA-362733 inhibitor; Figure 4 A shows the cell proliferation of HCT116 cell lines after transfection of piRNA-NC and piRNA-inhibitor; Figure 4 B shows the effect of piRNA-362733 inhibitor on the clone formation ability of HCT116 cells; Figure 4 C shows the effect of piRNA-362733 inhibitor on the invasion and migration ability of HCT116 cells. (The two groups were statistically analyzed using independent sample t-test, ** represents p<0.01). Specific implementation method:

[0025] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0026] Collection of patient samples

[0027] 60 normal tissues and 60 cancer tissues from patients with primary colorectal cancer were collected. The specimens were from patients who were hospitalized for surgery in Guizhou Provincial People's Hospital from 2019 to 2023. The collection of all medical records and specimens has obtained informed consent from the patients or their families and signed relevant informed consent forms, which were reviewed by the Ethics Committee of Guizhou Provincial People's Hospital. Primary colorectal cancer tissues and normal tissue specimens were selected to extract tissue RNA.

[0028] Example 1: RNA-Seq sequencing to screen differentially expressed piRNAs

[0029] RNA-Seq sequencing was performed on colorectal cancer tissues to screen for differentially expressed piRNAs. This part of the experiment was completed by Shanghai Kangcheng Bioengineering Co., Ltd. The specific steps are as follows: First, the total RNA sample was pre-treated and then synthesized into cDNA, mixed with Arraystar Green qPCR Master Mix and cDNA template were loaded into the well plate and amplified by real-time fluorescence quantitative PCR equipment ABI7900 qPCR. The piRNAs with significant abnormal expression were screened based on the differential expression fold change ≥ 2 and p value < 0.05.

[0030] RNA-seq results analysis

[0031] RNA sequencing was performed on total RNA obtained from three pairs of colorectal cancer and normal tissues. Based on the differential expression levels of dysregulated piRNAs (|fold change| ≥ 2 and p value < 0.05), heat maps and volcano plots of piRNA differential expression were plotted ( Figure 1 We selected piRNA-362733, which was the most significantly overexpressed in colorectal cancer tissues, for qPCR validation.

[0032] Example 2: qPCR detection of piRNA-362733 expression in colorectal cancer tissues and cells

[0033] Extraction and reverse transcription of total RNA from tissues and cell lines

[0034] RNA is extracted from tissues or cells using an RNA extraction kit, and the RNA concentration is measured using Nano Drop, and then reversed into cDNA using a reverse transcription kit. The synthesized cDNA is directly used for downstream fluorescence quantitative detection or stored at –20°C.

[0035] qRT-PCR experimental steps and reaction procedures

[0036] (1) The reaction system is as follows:

[0037] qRT-PCR experimental system

[0038]

[0039] (2) The reaction procedure is as follows:

[0040] qRT-PCR reaction procedure

[0041]

[0042] (3) Export the reaction results and calculate the Ct value, ΔCt value and 2 -ΔΔCt The specific calculation method is as follows:

[0043] The Ct value was calculated by ABI 7500Manager software; ΔCt1 = Ct of the gene to be tested in the experimental group - Ct of the reference gene in the experimental group; ΔCt2 = Ct of the gene to be tested in the control group - Ct of the reference gene in the control group; ΔΔCt = ΔCt1 - ΔCt2; 2 -ΔΔCt Calculated by formula.

[0044] piRNA-362733 is highly expressed in colorectal cancer tissues. In addition, compared with normal intestinal epithelial cells NCM460, piRNA-362733 is significantly more highly expressed in colorectal cells (SW460 and HCT116). The use of piRNA-362733 inhibitors can reduce the expression of colorectal cells SW460 and HCT116) ( Figure 2 AC).

[0045] Example 3: Inhibitory effect of piRNA-362733 inhibitor on colorectal cancer cells

[0046] 1. Selection of piRNA-362733 inhibitors

[0047] Based on the sequence of piRNA-362733, a specific piRNA-362733 inhibitor (Shanghai Sangon Biotechnology Co., Ltd.) was designed. Its sequence: TTCAACATCAGTCTGATAAGCTACC.

[0048] 2. piRNA-362733 Inhibitor Transfection

[0049] Colorectal cancer cell lines SW480 and HCT116 cells were placed in 24-well plates and transfected with Lipo3000 transfection reagent (purchased from Thermo Fisher). 25 pmol of piRNA-362733 inhibitor was added to each well. Cell RNA was extracted after 72 hours, and the expression of piRNA-362733 was detected by real-time fluorescence quantitative PCR.

[0050] 3. CCK-8 detection of cell proliferation

[0051] The colorectal cancer cells HCT116 were suspended in the holes of a 96-well plate, 100 μL was added to each well, and 3 duplicate wells were set up; the plate was placed in a 5% CO2, 37°C incubator and cultured until the entire bottom of the well was covered; 10 μL of CCK-8 solution was added to each well, and the culture plate was gently tapped to mix the cells and the solution, and incubated in a cell culture incubator for 4 hours. The absorbance value was calculated using an ELISA reader at 450nm visible light (note that the absorbance value of the wells with culture medium and CCK8 solution but no cells needs to be subtracted from the results), and the absorbance value of each group of cells was analyzed.

[0052] 4. Plate clone formation ability test

[0053] The colorectal cancer cells HCT116 with good growth in each group were collected after trypsin digestion, and the cell pellets were resuspended in complete culture medium to form a single cell suspension. After the cell suspension was diluted in a gradient, the number of cells was inoculated into a six-well plate according to the optimal conditions explored in the pre-experiment. The six-well plate with cells was placed in an environment of 37°C, 5% CO2 and 95% humidity for continued culture. The six-well plate was statically cultured for 2 weeks. When the cell clones visible to the naked eye were observed, the cell culture was considered to be terminated. After the six-well plate with cell clones was taken out of the incubator, the cells were gently washed twice with PBS, fixed with methanol solution for 15 minutes, and dried at room temperature. After that, the cells were stained with Giemsa stain for 30 minutes and air-dried at room temperature. Calculation formula: clone formation rate = number of clones / number of inoculated cells × 100%.

[0054] 5. Transwell assay

[0055] piRNA-NC or piRNA-inhibitor was transfected into colorectal cancer cells HCT116 for 48 h, and 250 μL of 2×10 5 The cell resuspension (medium without FBS) was added to the upper chamber of the Transwell chamber, and the medium containing 10% FBS was added to the lower chamber. Incubate at 37°C, 5% CO2 for 24 hours, scrape the cells in the upper chamber, and rinse twice with PBS. Fix the cells with 4% paraformaldehyde for 10 minutes, discard the formaldehyde, and rinse twice with PBS. Observe and count the cells under a microscope, and perform statistical analysis.

[0056] The experimental results showed that the piRNA-362733 inhibitor can significantly inhibit the proliferation, invasion and migration of colorectal cancer cells HCT116 ( Figure 4 ). The results suggest that piRNA-362733 inhibitors have an inhibitory effect on colorectal cancer cells.

Claims

1. Use of the piRNA-362733 biomarker in the preparation and / or screening of drugs for the treatment of colorectal cancer, wherein the piRNA-362733 nucleic acid sequence is: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAACA.

2. The use according to claim 1, characterized in that: The colorectal cancer therapeutic drug includes a preparation that inhibits the expression level of piRNA-362733.

3. The use according to claim 2, characterized in that: The preparation for inhibiting the expression level of piRNA-362733 includes: a piRNA-362733 inhibitor.

4. The use according to claim 3, characterized in that: The piRNA-362733 inhibitor sequence is TTCAACATCAGTCTGATAAGCTACC.

5. A piRNA-362733 biomarker for diagnosis or treatment, characterized in that: The nucleotide sequence is GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTTCAACA.

6. A drug for treating colorectal cancer, characterized in that: Agents that inhibit the expression level of piRNA-362733 are included.

7. The drug for treating colorectal cancer according to claim 6, characterized in that: The agent for inhibiting the expression level of piRNA-362733 is a piRNA-362733 inhibitor, and the inhibitor sequence is preferably: TTCAACATCAGTCTGATAAGCTACC.

8. Use of a reagent for detecting piRNA-362733 according to claim 1 in the preparation of a colorectal cancer diagnosis and / or prognosis preparation.

9. The use according to claim 8, characterized in that: The reagent for detecting the piRNA-362733 includes a reagent for detecting the expression amount of piRNA-362733.

10. The use according to claim 9, characterized in that: The reagent for detecting the expression amount of piRNA-362733 includes a PCR reagent, and the preferred PCR primer sequence is: F:5'-GTAGCTTATCAGACTGATGTTG-3' R:5'-GTCGTATCCAGTGCAGGGTCCGAGGT-3'.

Images