Primer probe combination and detection kit for screening or predicting colorectal cancer

Abstract

The invention provides a primer probe combination for colorectal cancer screening or prediction and a detection kit. According to the invention, through a large amount of exploration, it is found for the first time that joint detection of DPP10-AS1 gene methylation and MIR3681HG gene methylation can be used for colorectal cancer screening and diagnosis. A primer probe combination is developed aiming at the double methylation sites for combined quantitative detection, so that the sensitivity of colorectal cancer detection is up to 90% or above, the specificity is up to 95% or above, and the kit is particularly suitable for early screening of colorectal cancer.

Description

Technical Field

[0001] The present invention relates to the technical field of gene detection, and in particular to a primer-probe combination and a detection kit for colorectal cancer screening or prediction. Background Art

[0002] Colorectal cancer is a common malignant tumor of the digestive tract. It has the second highest incidence and the fifth highest cancer mortality rate in China. The incidence rate is showing a clear upward trend and is becoming younger.

[0003] Colorectal cancer is one of the cancers that can be cured and prevented. According to clinical data, if the precancerous lesions are found through early cancer screening and removed by surgery in time before colorectal cancer, the survival rate can be as high as 100%; the survival rate of colorectal cancer stage I is reduced to 91.8%; the survival rate of colorectal cancer stage II is 82.4%; the survival rate of colorectal cancer stage III is 57%; the survival rate of colorectal cancer stage IV is only 10.8%, and the mortality rate of colorectal cancer in the late stage is extremely high. The progression of colorectal cancer is slower than other types of cancer and has a clear precancerous lesion stage, which provides a valuable window period for effective colorectal cancer screening and early intervention.

[0004] Although there are many methods for clinical detection of colorectal cancer, such as colonoscopy, CT colonography, stool examination, etc. However, the sensitivity of stool screening for precancerous lesions is extremely limited, colonoscopy is invasive, causes certain trauma, has low patient compliance, and cannot be detected in the early stages. Other screening methods such as FIT testing are inexpensive and easy to examine, but the sensitivity of the method is not high, and the detection rate for advanced adenomas is only 20%-30%.

[0005] In addition, methylation changes occur in the early stages of carcinogenesis. DNA methylation can regulate gene expression, thereby promoting or inhibiting the occurrence and metastasis of tumors. The accumulation of genetic and epigenetic changes in colorectal cancer leads to significant differences in the gene methylation status between colorectal cancer patients and healthy people. The occurrence of tumors is accompanied by abnormal DNA methylation. After some tumor cells fall off, their DNA will enter the blood circulation. DNA methylation testing can be used to detect early cancer lesions. Summary of the invention

[0006] Based on this, it is necessary to provide a primer probe combination and a detection kit for colorectal cancer screening or prediction, which can screen early colorectal cancer, and the screening test has a sensitivity of more than 90% and a specificity of more than 95%.

[0007] The present invention adopts the following technical solution:

[0008] The present invention provides a methylation site combination for colorectal cancer screening or prediction, including a DPP10-AS1 gene methylation site and a MIR3681HG gene methylation site.

[0009] Among them, the methylated region in the DPP10-AS1 gene is chr2:115919287-115920535, especially the Chr2:115919895 methylation site.

[0010] The methylated region in the MIR3681HG gene is Chr2:12245378-12245764, especially the Chr2:12245464 methylation site.

[0011] The present invention further provides a primer-probe combination for colorectal cancer screening or prediction, comprising:

[0012] A first upstream primer, a first downstream primer and a first probe set for detecting methylation of the DPP10-AS1 gene, wherein the sequence of the first upstream primer is shown in SEQ ID NO.1, the sequence of the first downstream primer is shown in SEQ ID NO.2, and the sequences of the first probe set are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively;

[0013] The second upstream primer, the second downstream primer and the second probe used to detect methylation of the MIR3681HG gene, the sequence of the second upstream primer is shown in SEQ ID NO.5, the sequence of the second downstream primer is shown in SEQ ID NO.6, and the sequences of the second probe group are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively.

[0014] In some embodiments, the reporter fluorescent group of the above-mentioned probe is selected from any one of FAN and HEX, and the reporter quencher group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA, and MGB.

[0015] In some of the embodiments, the final concentration of the primers for colorectal cancer screening or prediction is 100-500 nM, and the concentration of the probe is 50-100 nM.

[0016] The present invention provides the use of a primer-probe combination for colorectal cancer screening or prediction in preparing a detection kit.

[0017] The present invention further provides a detection kit for colorectal cancer screening or prediction, comprising the above-mentioned primer-probe combination for colorectal cancer screening or prediction.

[0018] Furthermore, the detection kit may also include one or more combinations of a positive control, a negative control, a free DNA extraction reagent, a sulfite conversion reagent, and a ddPCR amplification reagent.

[0019] The positive control includes the nucleotide sequence shown as SEQ ID NO.9 and the nucleotide sequence shown as SEQ ID NO.10.

[0020] The negative control is normal human WBC cell DNA.

[0021] The detection process of the detection kit includes: obtaining a blood sample, extracting free DNA, and performing sulfite conversion; using template DNA, a first upstream primer, a first downstream primer and a first probe for detecting a methylated region chr2:115919287-115920535 in a DPP10-AS1 gene, and a second upstream primer, a second downstream primer and a second probe for detecting a methylated region Chr2:12245378-12245764 in a MIR3681HG gene to prepare a reaction system, and performing ddPCR amplification; obtaining the methylation rates of the DPP10-AS1 gene and the MIR3681HG gene.

[0022] Furthermore, when the detection kit for colorectal cancer screening or prediction of the present invention is used, the method steps for predicting colorectal cancer positivity are as follows: if the methylation rate of the Chr2:115919895 site of the DPP10-AS1 gene is ≥40% or the methylation rate of the Chr2:12245464 site of the MIR3681HG gene is ≤30%, then the sample is jointly predicted to be positive for colorectal cancer; otherwise, the sample is jointly predicted to be negative for colorectal cancer.

[0023] Compared with the prior art, the core advantages of the present invention are:

[0024] The present invention first discovered through extensive research that combined detection of DPP10-AS1 gene methylation and MIR3681HG gene methylation can be used for early screening of colorectal cancer. The present invention specifically develops a primer probe combination for the above gene methylation, and the combined detection can make the colorectal cancer detection for the above double methylation sites as sensitive as more than 90% and as specific as more than 95%.

[0025] In addition, it is worth mentioning that the current methods for detecting or predicting colorectal tumors are mostly based on qPCR methods; the present invention uses ddPCR, which is an absolute quantitative technology that can detect single copies. Its accuracy and sensitivity are higher than qPCR, and it can count mutation rates and detect low abundance without the need for a standard curve. The detection limit can be as low as a single copy, is independent of the ct value, is independent of the amplification efficiency, and can overcome the influence of PCR inhibitors. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the ROC curve diagram for combined detection of Chr2:115919895 and Chr2:12245464. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly. The following embodiments are only used to illustrate the present invention, but are not only used to limit the scope of the present invention. Based on the specific embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the protection scope of the present invention. In the embodiments of the present invention, unless otherwise specified, all raw material components are commercially available products well known to those skilled in the art; in the embodiments of the present invention, if not specifically specified, the technical means used are conventional means well known to those skilled in the art.

[0028] The present invention has found through a large number of experimental studies that the combined detection of DPP10-AS1 gene methylation and MIR3681HG gene methylation can be used for early screening of colorectal cancer.

[0029] Among them, the methylated region in the DPP10-AS1 gene is chr2:115919287-115920535, especially the Chr2:115919895 methylation site.

[0030] The methylated region in the MIR3681HG gene is Chr2:12245378-12245764, especially the Chr2:12245464 methylation site.

[0031] The primer-probe combination preferably developed by the present invention comprises:

[0032] The first upstream primer DPP10-AS1-F, the first downstream primer DPP10-AS1-R and the first probe set used to detect methylation at Chr2:115919895 of the DPP10-AS1 gene, the sequences are shown in the table below:

[0033]

[0034] The second upstream primer, the second downstream primer and the second probe set used to detect methylation at the Chr2:12245464 site of the MIR3681HG gene, the sequences are shown in the table below:

[0035]

[0036] It is worth noting that the region for detecting DPP10-AS1 gene methylation in the present invention is selected from UCSC GenomeBrowser on Human (GRCh37 / hg19) U, hg19_dna range = chr2:115919287-115920535 region, and the nucleotide sequence is:

[0037]

[0038] The nucleotide sequence of the DPP10-AS1 (chr2:115919287-115920535) gene containing the methylation site Chr2:115919895 after bisulfite modification is as follows:

[0039] TTTGGGTGGCGGGGGGCGGGGAGAGCGGGGAGTTAGAGGGTTTGCGGTGGTCGAGGGAGGGATTTTACGACGGGGAGTTCGTTCGGTGTCGTTTTTTTTTTTTTTTTCGTTTTTTCGTTTTTTTTATTTCGTTTTTTTCGTCGATTTCGGGAGCGACGGGCGTTCGTGATTTGCGAACGTTGTTAAGTGACGGTTTTCGAGTTTGAAGCGTTCGCGAGGAAGCGAGCGTTAGCGCGGGTCGTCGGCGATGACGGTCGCGAAGTAGGAGTCGTAGTTTATTTCGGGGGTTAGGGCGAGTTAGGCGTAGTCGGCGGATTAGGTGAGAGTCGGTAGTCGCGGTTAGGTTTTTTCGGGAGGGGTGGTTTTAGTGCGCGTTTCGTTCGTTTTTCGTTTTTTAGGTTGGGTTTTCGCGTTTTTTTTTTTTTATTTTTTTTCGTTTCGTTTTAGTTTTAGGTTTTTTTGTTTTTTTACGGATTTTGCGGGAAGTTAGAGTTTTTGCGTGCGTTTCGGGGTTCGGCGAGAGGATGCGTAAGGTGGAGAGTCGCGGGGAAGGGGGTAGAGAGGTAAAGGTTGAAGGTGTTTCGGGGAATTTCGGCGGGCGGTTTAT CGAGGGAGGGAGAGGCGGTCGGGATTAAGGAATGGGGTTTTTTGGTTTTTTATTAACGTACGTTGAAGAAATTTGTTGCGTTTTTGACGGTCGTTTATCGGGTTCGAGTTTCGTTTTTTTATAGTCGGGGCGTTCGTTGGTTAAAGCGATTCGAGTAGGCGAATGATTTTTAGGCGGACGGGGTTTTTTTTTTGTTTTTTTGTTTTTTTTGAGGAGACGGGTGTGTGTTTGTGAGGTGGGGATGGGGGAAGAGTGTTTTAGATATTCGTAGTTTGTTGAGCGGAACGGAGTTTGGGGAGCGGCGAGGTATTAACGATTAAGTGGAGTCGGGAAGGCGTTGGTTTTGGTGATGTGTTGGGTTTGGATGTGTCGCGTTTGTATAGATGAGGTGTTTTGCGTGGGTTGAGGGTTATTTTTGTTTTTTTTTCGTTCGTTTATATTCGTTAATTTTTTTTTGTTTTGGTTTTTAGAAATTTGTAGTATAATCGTATCGTCGTGGATTTTTATTTCGTTTTTGTTTTTGATTTGGGGTGATTTGGGATTTCGGTGTCGTTTTTTTTTTAAAGTTGGAGGGTCGGGAGCGTCGAGATATTTTGGCGAGGAGGAGGAGGAGGAGGAGGGAGGTTGCGTTGAGTCGGGTGTA(SEQ ID NO.9).

[0040] The region for detecting the methylation of the MIR3681HG gene in the present invention is selected from UCSC Genome Browser on Human (GRCh37 / hg19), the hg19_dna range = Chr2: 12245378-12245764 region, and the nucleotide sequence is:

[0041] AGTGTACAGATGAGCCCCCAAGGGTGATTCTGCACTGGGTACCTGAATCAGGGATGGGCGAGAGGCTTCGTGTCCACTGAATTGTCGCCAAATGCCCCATAGCATTGCCCGGGTTTGAGCGCATAGTAGGCATTCAATAAATACTGGCTTTCTTCCATAGAGCACGTAGAGCTGGAAGGTATCTAAGATCTTCACAAGCCCAAACTTCCCCCTGTAGAAAGTGGGAGTTGAGGCCCAAGGAGGTGAAATGAGTTGCAGATCTGGAGCTCCCGACTCCAGGTCGGTAATGCTGAGTTCTATTCTCTGCCTTTCTCAGGTGCTGGTTCTCTGGTGCTGGGAGTGAAAATAAAAATGGTGTACCACAGGCCATAGATGAGACACTTGAGCC。

[0042] The nucleotide sequence after bisulfite modification of the MIR3681HG (Chr2: 12245378-12245764) gene containing the methylation site Chr2: 12245464 is as follows:

[0043] AGTGTATAGATGAGTTTTTAAGGGTGATTTTGTATTGGGTATTTGAATTAGGGATGGGCGAGAGGTTTCGTGTTTATTGAATTGT CG TTAAATGTTTTATAGTATTGTTTGGGTTTGAGTGTATAGTAGGTATTTAATAAATATTGGTTTTTTTTTATAGAGTACGTAGAGTTGGAAGGTATTTAAGATTTTTATAAGTTTAAATTTTTTTTTGTAGAAAGTGGGAGTTGAGGTTTAAGGAGGTGAAATGAGTTGTAGATTTGGAGTTTTCGATTTTAGGTCGGTAATGTTGAGTTTTATTTTTTGTTTTTTTTAGGTGTTGGTTTTTTGGTGTTGGGAGTGAAAATAAAAATGGTGTATTATAGGTTATAGATGAGATATTTGAGTT(SEQ ID NO.10).

[0044] Among them, the underlined part in the above gene sequence is the methylation site.

[0045] The following is an example.

[0046] Example 1

[0047] This embodiment provides a method for screening gene methylation sites related to colorectal cancer, comprising:

[0048] Methylation libraries were constructed for more than 6,000 methylated gene sites in colorectal cancer patients and normal subjects, and NGS sequencing was performed. The methylation differences were obtained through analysis and calculation, and the sites with methylation gene sites with a difference of more than 20% between colorectal cancer patients and normal subjects were selected for subsequent analysis.

[0049] Two methylation gene sites with a difference greater than 20% were screened out: the Chr2:115919895 methylation site in the chr2:115919287-115920535 region of the DPP10-AS1 gene and the Chr2:12245464 methylation site in the Chr2:12245378-12245764 region of the MIR3681HG gene.

[0050] Example 2

[0051] By constructing methylation libraries for colorectal cancer cell lines (hct116) and normal human WBC cell lines, the methylation rates of Chr2:12245464 in the Chr2:12245378-12245764 region of the MIR3681HG gene and Chr2:115919895 in the Chr2:115919287-115920535 region of the DPP10-AS1 gene in hct116 and WBC cells were obtained respectively by NGS sequencing.

[0052] The statistical results are shown in the following table:

[0053]

[0054] Based on the above test results, it is speculated that:

[0055] If the methylation rate of Chr2:12245464 in the Chr2:12245378-12245764 region of the MIR3681HG gene is ≤30%, the site is positively methylated.

[0056] If the methylation rate of Chr2:115919895 in the chr2:115919287-115920535 region of the DPP10-AS1 gene is ≥40%, the site is methylated positive;

[0057] In this example, the differential site detection results of the methylation rates of the above regions in the MIR3681HG gene and the DPP10-AS1 gene were further analyzed. The primer probes of the methylation sites of the above genes were designed and optimized using the primer5 software. The DNA of the colorectal cancer positive cell line and the normal human WBC cell line were used as templates to construct the methylation ddPCR detection system of the Chr2:12245378-12245764 region of the MIR3681HG gene and the chr2:115919287-115920535 region of the DPP10-AS1 gene. FAM and HEX were used as the fluorescence signal detection objects. The primer probes and reaction systems of the two genes were optimized to obtain the above-mentioned preferred primer probe combination (SEQ ID NO.1 to SEQ ID NO.8).

[0058] In addition, for the sulfite-modified nucleotide sequence of the Chr2:12245378-12245764 region (including the Chr2:12245464 methylation site) of the MIR3681HG gene, the non-preferred primer-probe combinations found during the experiment include:

[0059] MIR3681HG-F-2:GAGGTTTCGTGTTTATTGAATT(SEQ ID NO.11);

[0060] MIR3681HG-R-2: TGAGTTTGGGTTTGTT (SEQ ID NO. 12);

[0061] MIR3681HG-M probe: TTGTCGTTAAATGTTT (SEQ ID NO. 13); MIR3681HG-uM probe: TTGTTGTTAAATGTTT (SEQ ID NO. 14);

[0062] MIR3681HG-F-3: TGGGCGAGAGGTTTCGT (SEQ ID NO. 15);

[0063] MIR3681HG-R-3: CCCAAACAATACTATAA (SEQ ID NO. 16); MIR3681HG-M probe: TTGTCGTTAAATGTTT (SEQ ID NO. 17); MIR3681HG-uM probe: TTGTTGTTAAATGTTT (SEQ ID NO. 18);

[0064] MIR3681HG-F-4: TTCGTGTTTATTGA (SEQ ID NO. 19);

[0065] MIR3681HG-R-4:TTTTTTTCTTAAAT (SEQ ID NO. 20);

[0066] MIR3681HG-M probe: TTGTCGTTAAATGTTT (SEQ ID NO. 21); MIR3681HG-uM probe: TTGTTGTTAAATGTTT (SEQ ID NO. 22).

[0067] For the sulfite-modified nucleotide sequence of the chr2:115919287-115920535 region (including the Chr2:115919895 methylation site) of the DPP10-AS1 gene, the non-preferred primer-probe combinations found during the experiment include:

[0068] DPP10-AS1-F2: AAGGTGGAGAGT (SEQ ID NO. 23);

[0069] DPP10-AS1-R2:CCCACCTCAAAACACACACC (SEQ ID NO. 24);

[0070] DPP10-AS1-M probe: TTATCGAGGGAGGGAGAGG (SEQ ID NO. 25);

[0071] DPP10-AS1-uM probe: TTATTGAGGGAGGGAGAGG (SEQ ID NO.26); DPP10-AS1-F3: ATTTTGCGGGAAGTTAGAG (SEQ ID NO.27); DPP10-AS1-R3: CCCGTCCGCCAAAAAACA (SEQ ID NO.28); DPP10-AS1-M probe: TTATCGAGGGAGGGAGAGG (SEQ ID NO.27); NO.29);

[0072] DPP10-AS1-uM probe: TTATTGAGGGAGGGAGAGG (SEQ ID NO. 30); DPP10-AS1-F4: TAGTTTTAGGTTTTTTTGTTT (SEQ ID NO. 31);

[0073] DPP10-AS1-R4:GACTATAAAAAAACGAAACT(SEQ ID NO.32) 。

[0074] The above non-preferred primer-probe combination can also be used for early screening of colorectal cancer, but its sensitivity is 80% and its specificity is 85%, which is slightly lower than the preferred probe combination.

[0075] Example 3

[0076] In this example, blood samples of 20 colorectal cancer patients and 20 healthy people (negative control) were tested, and the specific process steps are as follows:

[0077] (1) Sample processing, DNA extraction and transformation

[0078] The collected 5 mL of fresh blood was centrifuged at 4°C and 1400 g to separate the serum. The serum free DNA was extracted using the free DNA extraction kit of Eppendorf, and the extracted serum free DNA was subjected to sulfite conversion using the methylation conversion kit of Zymo.

[0079] (2) ddPCR amplification and detection

[0080] Using hct116 cell line DNA as a template, ddPCR amplification was performed using a preferred MIR3681HG gene primer probe combination (SEQ ID NO. 5-8) and a preferred DPP10-AS1 primer probe combination (SEQ ID NO. 1-4). The ddPCR amplification reagent used was a Bio-Rad ddPCR amplification kit. The ddPCR reaction system included:

[0081]

[0082]

[0083] Each time a ddPCR amplification test is performed, a positive quality control and a negative quality control should be brought together. The positive quality control is the cell line DNA with methylation at the MIR3681HG site and the cell line DNA with methylation at the DPP10-AS1 site (colorectal cancer cell line); the negative quality control is the WBC (white blood cell) DNA with unmethylation at the MIR3681HG site and the DPP10-AS1 site.

[0084] Place the droplet generator card into the droplet generator, divide 20 μL of the reaction solution into 20,000 droplets, and move the droplets to a 96-well plate for PCR amplification. The ddPCR amplification procedure is as follows:

[0085]

[0086] The 96-well plate was transferred to a droplet analyzer for fluorescence reading and the sample methylation rate was calculated: the methylation rate was calculated as follows: the copy number of the methylated site obtained by ddPCR / (the copy number of the methylated site + the copy number of the non-methylated site).

[0087] The statistical test results are as follows:

[0088] Statistics of double-site methylation rates in 20 healthy people

[0089]

[0090]

[0091] The methylation rates of the Chr2:12245464 site in the Chr2:12245378-12245764 region of the MIR3681HG gene in the above 20 healthy people were between 50% and 54%, and the methylation rates of the Chr2:115919895 site in the chr2:115919287-115920535 region of the DPP10-AS1 gene were between 17% and 22%.

[0092] Statistics of dual-site methylation rates and prediction results of 20 colorectal cancer patients (blood samples)

[0093]

[0094] It can be seen from the above table that among the 20 clinical colorectal tumor patient samples, only 1 sample detected the methylation rate of Chr2:12245464 in MIR3681HG greater than 30%, and 2 samples detected the methylation rate of Chr2:115919895 in DPP10-AS1 less than 40%, which is inconsistent with the predicted results (the methylation rate of Chr2:12245464 in MIR3681HG ≤30%, the methylation rate of Chr2:115919895 in DPP10-AS1 ≥40%).

[0095] The detection results of the above samples were further analyzed by AUC and other calculations. The results are as follows Figure 1 As shown, the AUC of the clinical samples was 0.961, 95% CI: 0.951-0.971, and the diagnostic results were good.

[0096] Example 4

[0097] Referring to the method steps of Example 3, this example further verifies the reliability of the screening results for blood samples of 100 patients with colorectal cancer, and the statistics and prediction of the two-site methylation rate (based on the methylation rate of Chr2:115919895 in DPP10-AS1 ≥40%, and the methylation rate of Chr2:12245464 in MIR3681HG ≤30%) are shown in the following table:

[0098]

[0099] As can be seen from the table above, by expanding the test validation effect of the patient group, it was found that:

[0100] The combined quantitative detection of the DPP10-AS1 gene methylation site Chr2:115919895 and the MIR3681HG gene methylation site Chr2:12245464 in the Chr2:12245378-12245764 region has an overall positive coincidence rate of up to 96%, which can predict or detect colorectal cancer and is suitable for early screening of colorectal cancer.

[0101] In addition, it is worth emphasizing that the combined detection of methylation at the Chr2:115919895 site in the chr2:115919287-115920535 region of the DPP10-AS1 gene and the Chr2:12245464 site in the Chr2:12245378-12245764 region of the MIR3681HG gene can achieve low requirements for cfDNA input (only 1 ng is required for detection) and high sensitivity and specificity of detection, with a sensitivity of more than 95% and a specificity of more than 95%.

[0102] It is necessary to point out that the above embodiments are limited to further elaboration and explanation of the technical solution of the present invention, and are not further limitations of the technical solution of the present invention. The method of the present invention is only a preferred implementation scheme, and is not used to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A methylation site combination for colorectal cancer screening or prediction, characterized in that: Including DPP10-AS1 gene methylation site and MIR3681HG gene methylation site.

2. A primer-probe combination for colorectal cancer screening or prediction, characterized in that: include: A first upstream primer, a first downstream primer and a first probe set for detecting methylation of the DPP10-AS1 gene, wherein the sequence of the first upstream primer is shown in SEQ ID NO.1, the sequence of the first downstream primer is shown in SEQ ID NO.2, and the sequences of the first probe set are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively; The second upstream primer, the second downstream primer and the second probe group are used to detect methylation of the MIR3681HG gene, the sequence of the second upstream primer is shown in SEQ ID NO.5, the sequence of the second downstream primer is shown in SEQ ID NO.6, and the sequences of the second probe group are shown in SEQ ID NO.7 and SEQ ID NO.8 respectively.

3. The primer-probe combination for colorectal cancer screening or prediction according to claim 2, characterized in that: The reporter fluorescent group of the first probe and the second probe is selected from any one of FAN and HEX, and the reporter quencher group is selected from any one of BHQ1, BHQ2, BHQ3, TAMRA and MGB.

4. The primer-probe combination for colorectal cancer screening or prediction according to claim 2, characterized in that: The final concentration of primers for colorectal cancer screening or prediction is 100-500 nM, and / or the concentration of probes is 50-100 nM.

5. Use of the primer-probe combination for colorectal cancer screening or prediction according to any one of claims 2 to 4 in the preparation of a detection kit.

6. A detection kit for colorectal cancer screening or prediction, characterized in that: It comprises the primer-probe combination for colorectal cancer screening or prediction as described in any one of claims 2 to 4.

7. The colorectal cancer screening or prediction detection kit according to claim 6, characterized in that: Also include positive and / or negative controls; The positive control includes the nucleotide sequence shown in SEQ ID NO.9 and the nucleotide sequence shown in SEQ ID NO.10; The negative control is normal human WBC cell DNA.

8. The colorectal cancer screening or prediction detection kit according to claim 6 or 7, characterized in that: It also includes one or more combinations of free DNA extraction reagents, sulfite conversion reagents, and ddPCR amplification reagents.

9. The colorectal cancer screening or prediction detection kit according to claim 6 or 7, characterized in that: The detection process of the detection kit includes: Obtain blood samples, extract free DNA, and perform sulfite conversion; A reaction system is prepared using template DNA, a first upstream primer, a first downstream primer and a first probe group for detecting methylation of the DPP10-AS1 gene, and a second upstream primer, a second downstream primer and a second probe group for detecting methylation of the MIR3681HG gene, and ddPCR amplification is performed; The methylation rates of the DPP10-AS1 gene and the MIR3681HG gene were obtained.

Images