Composition for detecting colonic cell proliferative diseases and application thereof

Abstract

The invention discloses a composition for detecting colonic cell proliferative diseases and application of the composition. The composition includes an agent for detecting the methylation level of any two or more markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7, and NTMT1 in a sample. The detection sensitivity of the composition to a sample (such as blood) can reach about 95%, and the specificity can also reach about 95%.

Description

Technical Field

[0001] The present application relates to the field of biomarkers, and in particular to a composition for detecting colon cell proliferative disorders and its application. Background Art

[0002] Colon cell proliferative disorders are relatively common diseases, such as disorders or diseases of abnormal proliferation of colon or rectal cells. The disease seriously affects the quality of life of patients and is difficult to cure completely. Take colorectal cancer as an example. Colorectal cancer is the most common malignant tumor in the world. The latest statistics show that the incidence and mortality of colorectal cancer in the United States rank third among all cancers. The incidence of colorectal cancer in China ranks second among all cancers, and the mortality rate ranks fourth among all cancers. Every year, 240,000 people die from colorectal cancer in my country.

[0003] At present, in the past 30 years, the screening methods for colorectal cancer have gradually evolved from gFOBT to FIT, and then to the emerging multi-target fecal DNA test (Cologuard), intestinal flora test (Lifekit), and methylated SEPT9 test (Epi proColon). In clinical practice, colonoscopy is mainly used for colorectal cancer screening, but this method requires advance bowel cleansing, takes a long time to prepare, and is an invasive examination with low human acceptance, making it unsuitable for large-scale screening. In order to facilitate large-scale early screening, from 2015 to 2024, more than a dozen gene methylation fluorescent quantitative PCR detection kits that have obtained national Class III registration certificates and several that are undergoing clinical trials have appeared in China for the detection of "feces and blood samples."

[0004] Compared with the testing of stool samples, both the subjects and doctors have a better inclination and higher acceptance for the testing of blood samples. Therefore, using plasma or serum in the blood as the test sample will help to increase the detection ratio and promote the clinical application scope of gene methylation fluorescence quantitative PCR detection kits. However, the sensitivity of the existing colorectal cancer blood sample fluorescence quantitative PCR detection kits is generally low, and there are no products close to or reaching 95%.

[0005] As early as 2008, a foreign research team discovered Septin9, a gene methylation marker for colorectal cancer blood sample detection, and continued to conduct clinical trials of fluorescent quantitative PCR detection kit products and submitted them to the FDA for approval. Then, four similar fluorescent quantitative PCR detection kits that only detect the single gene marker Septin9 in the blood appeared on the domestic market. The performance data of the above five products all showed low sensitivity, only 62~77%, indicating that the accuracy of the Septin9 single marker is low, and it is of little help to doctors in determining the results when used as an auxiliary detection method.

[0006] Then in 2022, a domestic test kit with a single non-Septin9 marker (a combination of Septin9, SDC2 and BACT1 markers) that was approved for a national III medical device certificate significantly increased its sensitivity to about 85%, and its specificity reached 94%. In 2024, the sensitivity of another domestic dual-marker combination of NTMT1 and MAP3K14-AS1 that has obtained a national III medical device certificate increased to 91%, but its specificity was only 92%. The sensitivity of the foreign three-marker combination of LASS4, LRRC4 and PPP2R5C has been further increased to 94%, but its specificity has dropped to 91%.

[0007] Therefore, there is an urgent need in this field to develop new marker combinations that can balance sensitivity and specificity. Summary of the invention

[0008] Based on this, it is necessary to provide at least a composition for detecting colon cell proliferative disorders and its application.

[0009] In a first aspect of the present application, a composition for detecting a proliferative disorder of colon cells is provided, the composition comprising a reagent for detecting the methylation level of any two or more markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7 and NTMT1 in a sample.

[0010] In a second aspect of the present application, there is provided a use of the composition of the first aspect in preparing a product for diagnosing and / or predicting a colon cell proliferative disorder in a subject.

[0011] In a third aspect of the present application, a system for diagnosing and / or prognosing a colon cell proliferative disorder in a subject is provided, the system comprising:

[0012] A data processing module, used for calculating the methylation level data of any two or more markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7 and NTMT1 in the received or input subject sample to obtain a calculation result; and

[0013] The judgment and output module is used to judge whether the calculation result meets the preset judgment conditions to diagnose and / or predict the colon cell proliferative disorder of the subject and output the prediction result.

[0014] In a fourth aspect of the present application, a computer-readable storage medium is provided, which stores a computer program. When the computer program is executed by a processor, the functions of the system described in the third aspect can be realized.

[0015] In a fifth aspect of the present application, a computer device is provided, comprising a memory and a processor, wherein the memory stores a computer program, and the processor is configured to execute the computer program to implement the functions of the system as described in the third aspect.

[0016] In the sixth aspect of the present application, a device for diagnosing and / or predicting a proliferative disorder of colon cells is provided, which comprises one or more of the system as described in the third aspect, the computer-readable storage medium as described in the fourth aspect, and the computer device as described in the fifth aspect.

[0017] The present application has discovered a new marker combination that can achieve a detection sensitivity of about 95% and a specificity of about 95% for samples (such as blood), which is significantly better than the detection performance of the above-mentioned 6 domestic test kits of the same type, and the specificity is also significantly better than the above-mentioned 2 foreign test kits of the same type. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the implementation methods and examples of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for use in the description of the implementation methods or examples. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without creative work. It should also be noted that the drawings are all drawn in a simplified form and are only used to conveniently and clearly assist in explaining the present application.

[0019] Figure 1 This is a fluorescence quantitative PCR original curve of 15 pairs of healthy human plasma samples combined in one embodiment of the present application.

[0020] Figure 2 This is a fluorescence quantitative PCR original curve of 5 pairs of healthy human plasma samples combined in one embodiment of the present application.

[0021] Figure 3 The original fluorescence quantitative PCR curve of 15 pairs of plasma samples from colorectal cancer patients in one embodiment of the present application is shown in FIG.

[0022] Figure 4 This is a fluorescence quantitative PCR original curve of 14 pairs of plasma samples from colorectal cancer patients combined in one embodiment of the present application. DETAILED DESCRIPTION

[0023] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present application are given in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0025] In this application, unless otherwise specified, "one or more" means any one of the listed items or any combination of the listed items. Similarly, "one or more" and the like, when used in other ways to mean "one or more", are also understood in the same way unless otherwise specified.

[0026] The terms "combination thereof", "any combination thereof", "any combination thereof" and the like used in this application include all suitable combinations of any two or more of the listed items.

[0027] In this application, the word "suitable" in "suitable combination", "suitable method", "any suitable method", etc. is based on the ability to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0028] In this application, "further", "further", "particularly", "for example", "such as", "example", "for example", etc. are used for descriptive purposes, indicating that the previous and subsequent different technical solutions are related in terms of the content covered, but should not be understood as a limitation on the previous technical solution, nor can it be understood as a limitation on the protection scope of this application. In this application, unless otherwise specified, A (such as B) means that B is a non-limiting example of A, and it can be understood that A is not limited to B.

[0029] In this application, "optionally", "optional", and "optional" mean optional, that is, any one of the two parallel solutions of "yes" or "no". If there are multiple "optional" in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent. Unless otherwise specified, the descriptions of "optionally include", "optionally contain", etc. in this application, taking "optionally include" as an example, mean "may include or not include".

[0030] The terms "contain", "include" and "include" used in this application are synonymous, which are inclusive or open-ended and do not exclude additional, uncited members or features. Members or features include materials or components, structures, elements, instruments, etc.; non-limiting examples of members or features include actions, conditions for the occurrence of actions, timing, states, etc.

[0031] In this application, the technical features or technical solutions described in open language include closed technical features or technical solutions composed of the listed contents, and also include open technical features or technical solutions containing the listed contents.

[0032] In the present application, exemplary descriptions such as "in some implementation modes (or examples)" and "in one implementation mode (or example)" may include but are not limited to the following meanings: these solutions may be combined with other solutions in a suitable manner to form new technical solutions.

[0033] In the present application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0034] In the present application, when it comes to a numerical interval (i.e., a numerical range), unless otherwise specified, the distribution of the optional numerical values ​​in the numerical interval is considered to be continuous, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical interval, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to an integer in the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints, which is equivalent to directly listing each integer. When multiple numerical ranges are provided to describe features or characteristics, these numerical ranges can be merged. In other words, unless otherwise specified, the numerical range disclosed herein should be understood to include any and all sub-ranges included therein. The "numerical value" in the numerical interval can be any quantitative value, such as a number, a percentage, a ratio, etc. "Numerical interval" allows broadly including numerical interval types such as percentage intervals, ratio intervals, and ratio intervals.

[0035] In this application, if there are multiple steps involved in the method flow, unless there is a clear different description in this document, there is no strict order restriction for the execution of these steps, and they can be executed in other orders than described. Moreover, any step can include multiple sub-steps or multiple stages, and these sub-steps or stages are not necessarily executed at the same time, but can be executed at different times, and their execution order is not necessarily sequential, but can be executed in turn, alternating or simultaneously with other steps or parts of sub-steps or stages of other steps.

[0036] As used herein, the "specificity" of a marker refers to the percentage of samples characterized by the absence of an event or state of interest, wherein the measurement of the marker accurately indicates the absence of an event or state of interest (true negative rate). In various embodiments, the characterization of negative samples is independent of the marker and can be achieved by any relevant measurement, such as any relevant measurement known to those skilled in the art. Therefore, specificity reflects the probability that a marker will detect the absence of an event or state of interest when measured in a sample that does not characterize an event or state of interest. In the specific embodiment in which an event or state of interest is a colon cell proliferative disorder, specificity refers to the probability that a marker will detect the absence of a colon cell proliferative disorder in a subject lacking a colon cell proliferative disorder. The absence of a colon cell proliferative disorder can be determined, for example, by histology.

[0037] As used herein, the "sensitivity" of a marker refers to the percentage of samples characterized by the presence of an event or state of interest, wherein the measurement of the marker accurately indicates the presence of an event or state of interest (true positive rate). In various embodiments, the characterization of positive samples is independent of the marker and can be achieved by any relevant measurement, such as any relevant measurement known to those skilled in the art. Therefore, sensitivity reflects the probability that a marker will detect the presence of an event or state of interest when measured in a sample characterized by the presence of an event or state of interest. In the specific embodiment in which an event or state of interest is a colon cell proliferative disorder, sensitivity refers to the probability that a marker will detect the presence of a colon cell proliferative disorder in a subject suffering from a colon cell proliferative disorder. The presence of a colon cell proliferative disorder can be determined, for example, by histology.

[0038] As used herein, the term "subject" refers to an organism, typically a mammal (eg, a human). In some embodiments, in one embodiment, the subject suffers from cancer. In one embodiment, the subject suffers from colorectal cancer.

[0039] In some embodiments, the cell proliferative disorder of the colon is selected from advanced adenoma, high-grade epithelial neoplasia, stage I colorectal cancer, stage II colorectal cancer, stage III colorectal cancer, or stage IV colorectal cancer.

[0040] In some embodiments, the biological sample obtained from the subject is selected from the group consisting of: cell-free DNA, cell-free RNA, body fluids, feces, colonic discharge, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, and combinations thereof.

[0041] In some embodiments, the biological sample is nucleic acid, DNA, ribonucleic acid (RNA), or cell-free nucleic acid (cfDNA or cfRNA).

[0042] As used herein, the term "colon cell proliferative disorder" generally refers to a disorder or disease involving the disorder or abnormal proliferation of cells of the colon or rectum. In some embodiments, the disorder is selected from: high-grade epithelial neoplasia, advanced adenoma, adenoma (adenomatous polyp), sessile serrated adenoma (SSA), advanced adenoma, colorectal dysplasia, colorectal adenoma, colorectal cancer, colon cancer, rectal cancer, colorectal epithelial carcinoma, colorectal adenocarcinoma, carcinoid tumor, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), lymphoma and sarcoma. In some embodiments, the colon cell proliferative disorder includes colorectal cancer.

[0043] As used herein, the term "subject" generally refers to an entity or medium with testable or detectable genetic information. The subject can be an individual, individual or patient. The subject can be a vertebrate, such as a mammal. Non-limiting examples of mammals include humans, apes, farm animals, sports animals, rodents and pets. The subject can be a person suffering from cancer or suspected of suffering from cancer. The subject can show symptoms indicating the health or physiological state or condition of the subject, such as cancer or other diseases, disorders or conditions of the subject. As an alternative, the subject can be asymptomatic in terms of such health or physiological state or condition.

[0044] As used herein, the term "sample" and "specimen" are used interchangeably, generally referring to a biological sample obtained from or derived from one or more objects. A biological sample can be a cell-free biological sample or a substantially cell-free biological sample, or can be processed or fractionated to produce a cell-free biological sample. For example, a cell-free biological sample may include cell-free ribonucleic acid (cfRNA), cell-free deoxyribonucleic acid (cfDNA), cell-free fetal DNA (cffDNA), plasma, serum, urine, saliva, amniotic fluid and derivatives thereof. Ethylenediaminetetraacetic acid (EDTA) collection tubes, cell-free RNA collection tubes (e.g., ) or cell-free DNA collection tubes (e.g.) can be used to obtain or derive a cell-free biological sample from an object. A cell-free biological sample can be derived from a whole blood sample by fractionation (e.g., centrifugation into cell components and cell-free components). A biological sample or its derivatives may contain cells. For example, a biological sample can be a blood sample or its derivatives (e.g., blood collected by a collection tube or blood droplets).

[0045] As used herein, the term "nucleic acid" generally refers to a polymeric form of nucleotides of any length, whether deoxyribonucleotides (dNTPs) or ribonucleotides (rNTPs), or analogs thereof. Nucleic acids can have any three-dimensional structure and can perform any known or unknown function. Non-limiting examples of nucleic acids include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), coding or non-coding regions of genes or gene fragments, loci defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant nucleic acids, branched nucleic acids, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers. Nucleic acids can include one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after nucleic acid assembly. The nucleotide sequence of nucleic acids can be interrupted by non-nucleotide components. The nucleic acids can be further modified after polymerization, such as by conjugation or attachment to a reporter.

[0046] As used herein, the terms "amplifying" and "amplification" generally refer to increasing the size or number of a nucleic acid molecule. A nucleic acid molecule can be single-stranded or double-stranded. Amplification can include generating one or more copies or "amplification products" of a nucleic acid molecule. Amplification can be performed, for example, by extension (e.g., primer extension) or ligation. Amplification can include performing a primer extension reaction to generate a strand complementary to a single-stranded nucleic acid molecule, and in some cases generating one or more copies of the strand and / or the single-stranded nucleic acid molecule. The term "DNA amplification" generally refers to generating one or more copies of a DNA molecule or "amplified DNA product." The term "reverse transcription amplification" generally refers to the generation of a deoxyribonucleic acid (DNA) product from a ribonucleic acid (RNA) template by the action of a reverse transcriptase.

[0047] As used herein, the term "cell-free nucleic acid (cfNA)" generally refers to nucleic acids in a biological sample that are not contained in cells, such as cell-free RNA ("cfRNA") or cell-free DNA ("cfDNA"). cfDNA can circulate freely in body fluids, such as in the bloodstream.

[0048] As used herein, the term "cell-free sample" generally refers to a biological sample that is substantially devoid of intact cells. This may be derived from a biological sample that is itself substantially devoid of cells, or may be derived from a sample from which cells have been removed. Examples of cell-free samples include those derived from blood, such as serum or plasma; urine; or samples derived from other sources, such as semen, sputum, feces, ductal exudate, lymph, or recovered lavage fluid.

[0049] The term "composition" in the present application is not limited to its form, for example, it can be in the form of a kit. The reagents contained therein can exist independently, for example, the primers and probes used to detect the methylation levels of different genes can exist separately and independently.

[0050] In a first aspect of the present application, a composition for detecting a proliferative disorder of colon cells is provided, the composition comprising a reagent for detecting the methylation levels of any two or more markers selected from the group consisting of SND1 gene (hereinafter referred to as SND1), ITGA4 gene (hereinafter referred to as ITGA4), GRASP gene (hereinafter referred to as GRASP), SPATA32 gene (hereinafter referred to as SPATA32), TRBJ2-7 gene (hereinafter referred to as TRBJ2-7) and NTMT1 gene (hereinafter referred to as NTMT1) in a sample.

[0051] In some embodiments, the composition includes reagents for detecting the methylation levels of any two markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7, and NTMT1 in a sample.

[0052] In some embodiments, the composition includes a reagent for detecting the methylation level of any two or more of the sequences such as region 1 shown in SEQ ID NO: 1, region 2 shown in SEQ ID NO: 2, region 3 shown in SEQ ID NO: 3, region 4 shown in SEQ ID NO: 4, region 5 shown in SEQ ID NO: 5, and region 6 shown in SEQ ID NO: 6.

[0053] In some embodiments, the two markers are SND1 and ITGA4.

[0054] In some embodiments, the two markers are SND1 and GRASP.

[0055] In some embodiments, the two markers are SND1 and SPATA32.

[0056] In some embodiments, the two markers are SND1 and TRBJ2-7.

[0057] In some embodiments, the two markers are ITGA4 and GRASP.

[0058] In some embodiments, the two markers are ITGA4 and SPATA32.

[0059] In some embodiments, the two markers are ITGA4 and TRBJ2-7.

[0060] In some embodiments, the two markers are SPATA32 and TRBJ2-7.

[0061] In some embodiments, the two markers are ITGA4 and TRBJ2-7.

[0062] In some embodiments, the two markers are GRASP and TRBJ2-7.

[0063] In some embodiments, the two markers are SND1 and NTMT1.

[0064] In some embodiments, the two markers are GRASP and NTMT1.

[0065] In some embodiments, the two markers are ITGA4 and NTMT1.

[0066] In some embodiments, the two markers are SPATA32 and NTMT1.

[0067] In some embodiments, the two markers are TRBJ2-7 and NTMT1.

[0068] In some embodiments, the composition includes reagents for detecting the methylation levels of any three, four or five markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7 and NTMT1 in a sample.

[0069] Any three of them are, for example, SPATA32, TRBJ2-7 and NTMT1, SND1, ITGA4 and GRASP, SND1, TRBJ2-7 and NTMT1, ITGA4, TRBJ2-7 and NTMT1, SND1, ITGA4, and SPATA32, ITGA4, SPATA32 and NTMT1, ITGA4, GRASP and SPATA32, etc.

[0070] Any four of them are, for example, SND1, NTMT1, ITGA4 and GRASP, SND1, GRASP, ITGA4 and TRBJ2-7, SND1, TRBJ2-7, ITGA4 and SPATA32, etc.

[0071] Any five, for example, SND1, ITGA4, GRASP, SPATA32 and TRBJ2-7, SND1, ITGA4, GRASP, SPATA32 and NTMT1, SND1, ITGA4, GRASP, TRBJ2-7 and NTMT1, SND1, ITGA4, SPATA32, TRBJ2-7 and NTMT1, SND1, GRASP, SPATA32, TRBJ2-7 and NTMT1, or ITGA4, GRASP, SPATA32, TRBJ2-7 and NTMT1, etc.

[0072] In some embodiments, the composition includes reagents for detecting the methylation levels of six markers, namely, SND1, ITGA4, GRASP, SPATA32, TRBJ2-7, and NTMT1, in a sample.

[0073] Among them, the corresponding relationship between different regions and genes is as follows:

[0074] For the marker SND1, the region covered by the reagent (eg, primer, probe) is region 1 whose sequence is shown in SEQ ID NO: 1.

[0075] For the marker ITGA4, the region covered by the reagent (eg, primer, probe) is region 2 whose sequence is shown in SEQ ID NO: 2.

[0076] For the marker GRASP, the region covered by the reagents (eg, primers, probes) is region 3 whose sequence is shown in SEQ ID NO: 3.

[0077] For the marker SPATA32, the region covered by the reagent (eg, primer, probe) is region 4 whose sequence is shown in SEQ ID NO: 4.

[0078] For marker TRBJ2-7, the region covered by the reagent (eg, primer, probe) is region 5 whose sequence is shown in SEQ ID NO: 5.

[0079] For the marker NTMT1, the region covered by the reagent (eg, primer, probe) is region 6 whose sequence is shown in SEQ ID NO: 6.

[0080] The reagents in the present application are, for example, reagents used in amplification-sequencing, chip detection or methylation fluorescence quantitative PCR detection of methylation levels.

[0081] In some embodiments, the reagents include one or more of nucleic acid primers, sequencing tag sequences, methylation chips, and nucleic acid probes.

[0082] In some embodiments, the reagents include nucleic acid primers and nucleic acid probes.

[0083] In some embodiments, the sequences of the nucleic acid primers and nucleic acid probes for detecting the region 1 are shown as SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15.

[0084] In some embodiments, the sequences of the nucleic acid primers and nucleic acid probes for detecting the region 2 are shown as SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18.

[0085] In some embodiments, the sequences of the nucleic acid primers and nucleic acid probes for detecting the region 3 are shown as SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21.

[0086] In some embodiments, the sequences of the nucleic acid primers and nucleic acid probes for detecting the region 4 are shown as SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24.

[0087] In some embodiments, the sequences of the nucleic acid primers and nucleic acid probes for detecting the region 5 are shown as SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27.

[0088] In some embodiments, the sequences of the nucleic acid primers and nucleic acid probes for detecting the region 6 are shown as SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO: 30.

[0089] The design of primer probes using the sequences within the 200 bp human genome before and after the CpG site covered by the above-mentioned marker primer probes as templates, and the design of primer probes using the positive and negative chain sequences after bisulfite conversion of the sequences within the above-mentioned human genome as templates, are alternative solutions even if they are inconsistent with the primer probe sequences provided in the present application.

[0090] In some embodiments, the composition further comprises an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for detection.

[0091] In some embodiments, hot start Taq enzyme, PCR buffer, dNTPs and Mg 2+ At least one of .

[0092] In some embodiments, the composition detects cell proliferative disorders of the colon including colorectal cancer and precancerous lesions.

[0093] In some embodiments, the sample detected by the composition is selected from one or more of the group consisting of plasma, blood cells, whole blood, peripheral blood, serum, human feces, tissue, urine, saliva and amniotic fluid; for example, plasma.

[0094] A second aspect of the present application provides use of the composition of the first aspect in the preparation of a product for diagnosing and / or predicting a colon cell proliferative disorder in a subject.

[0095] In a third aspect of the present application, a system for diagnosing and / or prognosing a colon cell proliferative disorder in a subject is provided, the system comprising:

[0096] A data processing module, used for calculating the methylation level data of any two or more markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7 and NTMT1 in the received or input subject sample to obtain a calculation result; and

[0097] The judgment and output module is used to judge whether the calculation result meets the preset judgment conditions to diagnose and / or predict the colon cell proliferative disorder of the subject and output the prediction result.

[0098] In a fourth aspect of the present application, a computer-readable storage medium is provided, which stores a computer program. When the computer program is executed by a processor, the functions of the system described in the third aspect can be realized.

[0099] In a fifth aspect of the present application, a computer device is provided, comprising a memory and a processor, wherein the memory stores a computer program, and the processor is configured to execute the computer program to implement the functions of the system as described in the third aspect.

[0100] The computer device may be a terminal. The computer device includes a processor, a memory, a communication interface, a display screen and an input device connected through a system bus. The processor of the computer device is used to provide computing and control capabilities. The memory of the computer device includes a non-volatile storage medium and an internal memory. The non-volatile storage medium stores an operating system and a computer program. The internal memory provides an environment for the operation of the operating system and the computer program in the non-volatile storage medium. The communication interface of the computer device is used to communicate with an external terminal in a wired or wireless manner, and the wireless manner can be achieved through WIFI, a mobile cellular network, NFC (near field communication) or other technologies. When the computer program is executed by the processor, a method for determining the battery performance of an energy storage system is implemented. The display screen of the computer device may be a liquid crystal display screen or an electronic ink display screen, and the input device of the computer device may be a touch layer covered on the display screen, or a key, trackball or touchpad provided on the housing of the computer device, or an external keyboard, touchpad or mouse, etc.

[0101] Those skilled in the art can understand that all or part of the processes in the above-mentioned method implementation can be completed by instructing the relevant hardware through a computer program, and the computer program can be stored in a non-volatile computer-readable storage medium. When the computer program is executed, it can include the processes of the implementation of the above-mentioned methods. Among them, any reference to the memory, database or other medium used in the embodiments provided in this application can include at least one of non-volatile and volatile memory. Non-volatile memory can include read-only memory (ROM), magnetic tape, floppy disk, flash memory, optical memory, high-density embedded non-volatile memory, resistive random access memory (ReRAM), magnetoresistive random access memory (MRAM), ferroelectric random access memory (FRAM), phase change memory (PCM), graphene memory, etc. Volatile memory can include random access memory (RAM) or external cache memory, etc. As an illustration and not limitation, RAM can be in various forms, such as static random access memory (SRAM) or dynamic random access memory (DRAM). The database involved in each embodiment provided in this application may include at least one of a relational database and a non-relational database. Non-relational databases may include distributed databases based on blockchains, etc., but are not limited to this. The processor involved in each embodiment provided in this application may be a general-purpose processor, a central processing unit, a graphics processor, a digital signal processor, a programmable logic device, a data processing logic device based on quantum computing, etc., but are not limited to this.

[0102] In the sixth aspect of the present application, a device for diagnosing and / or predicting a proliferative disorder of colon cells is provided, which comprises one or more of the system as described in the third aspect, the computer-readable storage medium as described in the fourth aspect, and the computer device as described in the fifth aspect.

[0103] This application identifies a combination of multiple gene methylation markers, whose sensitivity and specificity for blood (plasma) samples can approach or reach 95% at the same time, which will be very beneficial to the acceptance and promotion of gene methylation fluorescence quantitative PCR detection kits for colon cell proliferative disorders (such as colorectal cancer).

[0104] Some examples are provided below.

[0105] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which the conditions are not specified in the following examples are preferably referred to the guidance given in the present application, and can also be based on the experimental manual or normal conditions in the art, or can also be based on the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0106] Example 1

[0107] Zhengzhou Zhijie Biotechnology Co., Ltd. cooperated with the Department of Anorectal Surgery of Henan Provincial People's Hospital and the Department of Colorectal and Anorectal Surgery of the First Affiliated Hospital of Zhengzhou University. From June 2023 to September 2024, a total of 108 cancer samples of different stages of colorectal cancer and 120 samples of healthy volunteers were obtained. The inclusion criteria for colorectal cancer are: regardless of age or gender, and all patients with preoperative blood samples (10 mL) diagnosed as "high-grade glandular intraepithelial neoplasia, adenoma, hyperplastic polyp, adenomatous polyp, adenocarcinoma, tubular adenoma, malignant tumor I, II, III and IV" in the left colon, right colon, colon, rectum, sigmoid colon, ascending colon and rectosigmoid junction by laboratory tests, electronic colonoscopy, biopsy and pathology. The inclusion criteria for healthy people are: blood samples (10 mL) of adult volunteers (regardless of gender) who have no routine diseases after physical examination.

[0108] Cancer plasma samples (500 μL) and healthy plasma samples (500 μL) were extracted using the Novezan Magnetic Bead Extraction Kit (Cat. No. N902-02), and 30 μL was used for transformation and purification using the Novezan Magnetic Bead Transformation Kit (Cat. No. EM103-01). The detailed steps of the above extraction and transformation and purification were all referred to the manual instructions of the kit.

[0109] Probe-based fluorescence quantitative PCR was used to detect the bisulfite DNA (bisDNA) samples of the above cancer plasma and healthy human plasma. The PCR system was 0.1 μL of the Hanhaixin enzyme hot start Taq enzyme (Cat. No. HMD0206-01), 2.5 μL of 10×Taq buffer, 0.25 μL of 10 μM forward primer and reverse primer, 0.25 μL of 10 μM probe, 10 μL of bisDNA template of cancer plasma and healthy human plasma samples, and pure water was added to 25 μL. The PCR program was 25℃, 10 min; 95℃, 2 min; 95℃, 15 s, 60℃, 20 s (collecting fluorescence signals), and the number of cycles was 50.

[0110] In this application, the SDC2 gene, the most commonly used DNA methylation marker for colorectal cancer in the domestic market, is used as the control group 1, and the NTMT1 and MAPK3K14-AS1 dual marker combination with a sensitivity and specificity of more than 90% in the latest domestic test kit for detecting blood (plasma) samples is used as the control group 2. The experimental data on sensitivity and specificity for plasma samples are shown in Table 1.

[0111] Table 1: Sensitivity and specificity of the comparison groups

[0112]

[0113] The above experimental results are basically close to the sensitivity and specificity of the SDC2 single marker or the NTMT1 and MAPK3K14-AS1 double marker combination in the existing colorectal cancer kit, indicating that the markers or combinations selected in the control group of this application and the primer and probe sequences of the corresponding markers are all effective. The primer and probe sequences used for SDC2, NTMT1 and MAPK3K14-AS1 in the control group are shown in Table 2.

[0114] Table 2: Primers and probes for markers in the control group

[0115]

[0116] Characterization data and efficacy data of new and old dual-marker combinations

[0117] The sensitivity and specificity of the new gene methylation dual marker combination (10 in total) for plasma samples are shown in Table 3.

[0118] Table 3: Sensitivity and specificity of the novel dual marker combination

[0119]

[0120] The results in Table 3 show that the sensitivity and specificity of the above-mentioned new dual-marker combination for plasma samples are close to or exceed 95%, and the performance is significantly improved compared with the control group. The primer probe sequences used for the above-mentioned 5 single markers are shown in Table 4. The key CpG sites covered by the primer probes and their corresponding adjacent sequences within 200 bp before and after the human genome (Table 5) are all within the scope of protection of this application.

[0121] Table 4: Primer probe sequences used for 5 single markers

[0122]

[0123] Table 5: CpG sites covered by the primer probe sequences used for the five single markers and their adjacent sequences in the human genome

[0124]

[0125] The CpGs (bold, underlined) of each biomarker in Table 5 and their corresponding human genome flanking sequence information are shown below.

[0126] SND1 gDNA seq:

[0127] GCCCCCTCTAGACGAGCGGAGCGGGGCCAGGGCGAGCGGGCGAGCGAGCCGGAGTGAGCGTCAAGTGAGGGGC CG CGCGCAAGTCGCAGGCGTTCGCAGCTATTTTGGGCCGGTCGGAGGGAGCAGTTGGGTGGCCGCTGATAGGCTGGAGCGGCGCGGGGCTGCGGCGGGAGAGCCCGCGCCGGCCCCCGCCCTCCGGCCCGCACCCGGGGCCCCCTGGCTCTGAAGAGCGGGGCTCAGGG (SEQ ID NO: 1)

[0128] ITGA4 gDNA seq:

[0129] GGACGGCGGCCCTTCGGGGGCCGGGTTCGCGCCTCGCTTCCCAAGCCATGCGCTCTCGGTGGGGAACATTCAACACTAAACGGCCACTACCCCAAAGTTGCACGGGATGCGACGGTTGGCCAACGGGGAAGAACGCCCCAAGAGATGAGG CG CAGCGTGTCCGGCGCCAGCGGGCTAAAGGAAGGAGAGAGGGAAGAGGAGGGGAAGTCGGCCCACCGCGGGCGGAGCGTTCGGGCCGGCCTGGGATGCCGCGCACTCGCCCGGCCCCACTCCCGGTTTCTGCCGCCAGCCGGGAGCTTC (SEQ ID NO: 2)

[0130] GRASP gDNA seq:

[0131] CGGGGAGGCGGGGCATGGGGGGCAGAAAGCCAGATGGAGCGGGTAGGAGAAGGGGGGTGCTGGGAGGAGTCAAGGAGGGAGAGAGGGGGCGTGCATGGGGCGCGGAGTTAAGAGCCACCGAGCCTGGGCGCGGTGTGCAGGCGAGGGCCA CG GCCTTCGCAGCAGCGGGGAACGCGGGGAGTCGAGGCACCCAGCGGGCCGGGGAAGAAGGTGGGGGACTCCGCGGACGCCGAGGAGAGGGCACTGCGGAGTCAGCAGGCCCTGTAGGGAGTCGGAGAGGGGCTGAGCAGATCCTGAAGGC(SEQ ID NO: 3)

[0132] SPATA32 gDNA seq:

[0133] CGGGGGTTTGGGAGCAGGGGAACGGGCCCTGGGCGGATTCCTGACCGCCCCCTTCGCGCCCCTCCCCCTCTCACTTTCGCTTTCCCCGCCTGCCCCAACCCTCGCCCCCGGG CG CTCGGCCGCTCCCACCTGTCACCCCCATGCAGACCGAGGCTCTGTCCTGGAGGCGGGGAGCGGGCTGGTGGATGCTGCCTCTCCGCCTCCAGTGTGCTCTTTGGCTGAGGGACTGGTGGGCGCTGGAAATATTAGAGGCGCCGGTGCCTGTGATGTCGCCGCCTCTGTGACGTCCCCGCCGCGACC(SEQ ID NO: 4)

[0134] TRBJ2-7 gDNA seq:

[0135] CGGCTCCTGGTGCTCGGTGAGCGCGGGCTGCTGGGGCGCGGGCGCGGGCGGCTTGGGTCTGGTTTTTGCGGGGAGTCCCCGGGCTGTGCTCTGGGGCCAACGTCCTGACTTTCGGGGCCGGCAGCAGGCTGACCGTGCTGGGTGAGTTTT CGCGGGACCACCCGGGCGGCGGGATTCAGGTGGAAGGCGGCGGCTGCTTCGCGGCACCCGGTCCGGCCCTGTGCTGGGAGACCTGGGCTGGGTCCCCAGGGTGGGCAGGAGCTCGGGGAGCCTTAGAGGTTTGCATGCGGGGGTGCACCT (SEQ ID NO: 5)

[0136] NTMT1 gDNA seq:

[0137] CGCGGCGGGAGGCGTCCGACGCCCACCCCGGGCTTGGCGTCCCCTTCCGGCCACCACGCGGCGCCGCCCCCCGGGATCCTCCAGTCCCCGGAGCCCCGCGCGCCCAGAGCCGCTCGGAGCGCGGGCGGGGTCAGCTTGGGCAGCCGCGGGT CG CTGCTGCGTCGGAAGTCTCCGTCGCCAGGGAGCCCCTTGGGCGCCAGGTCCTGGGCCCCTGGGCGAAGTCGACGCCAGAACATGCTTGGCCCCGCACTCAGCTCACCGCACCCTCAGCGCGCGTGGGTGGGGGGCGCCGGCTGAGGTG (SEQ ID NO: 6)

[0138] The sensitivity and specificity of the new and old gene dual marker combinations (5 combinations in total) for plasma samples are shown in Table 6.

[0139] Table 6: Sensitivity and specificity of the new and old dual marker combinations

[0140]

[0141] As shown in Table 6, the sensitivity and specificity of the above five experimental groups (i.e., five combinations of new and old markers) for plasma samples were close to or exceeded 95%, and were also better than the control group.

[0142] In summary, the sensitivity of experimental groups 1 to 15 was significantly better than that of control groups 1 and 2, and the specificity was significantly better than that of control group 2, achieving the goal of sensitivity and specificity approaching or exceeding 95% at the same time.

[0143] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0144] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description and drawings may be used to interpret the contents of the claims.

Claims

1. A composition for detecting a proliferative disorder of colon cells, It is characterized in that The composition includes reagents for detecting the methylation levels of any two or more markers selected from the group consisting of SND1, ITGA4, GRASP, SPATA32, TRBJ2-7 and NTMT1 in a sample.

2. The composition according to claim 1, It is characterized in that The composition includes a reagent for detecting the methylation level of any two or more of the sequences such as region 1 shown in SEQ ID NO: 1, region 2 shown in SEQ ID NO: 2, region 3 shown in SEQ ID NO: 3, region 4 shown in SEQ ID NO: 4, region 5 shown in SEQ ID NO: 5, and region 6 shown in SEQ ID NO:

6.

3. The composition according to claim 2, It is characterized in that The reagent is a reagent used in amplification-sequencing, chip detection or methylation fluorescence quantitative PCR detection of methylation levels; Optionally, the reagents include one or more of nucleic acid primers, sequencing tag sequences, methylation chips, and nucleic acid probes; Further optionally, the reagents include nucleic acid primers and nucleic acid probes.

4. The composition according to claim 3, It is characterized in that The sequences of the nucleic acid primers and nucleic acid probes for detecting the region 1 are shown in SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15; The sequences of the nucleic acid primers and nucleic acid probes for detecting the region 2 are shown in SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18; The sequences of the nucleic acid primers and nucleic acid probes for detecting the region 3 are shown in SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21; The sequences of the nucleic acid primers and nucleic acid probes for detecting the region 4 are shown in SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24; The sequences of the nucleic acid primers and nucleic acid probes for detecting the region 5 are shown in SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27; The sequences of the nucleic acid primers and nucleic acid probes for detecting the region 6 are shown in SEQ ID NO: 28, SEQ ID NO: 29 and SEQ ID NO:

30.

5. The composition according to any one of claims 1 to 4, It is characterized in that The composition also comprises an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for detection; and / or, hot-start Taq enzyme, PCR buffer, dNTPs and Mg 2+ At least one of .

6. The composition according to any one of claims 1 to 4, It is characterized in that Colon cell proliferative disorders detected by the composition include colorectal cancer and precancerous lesions; Optionally, the cell proliferative disorder of the colon is selected from the group consisting of advanced adenoma, high-grade epithelial neoplasia, stage I colorectal cancer, stage II colorectal cancer, stage III colorectal cancer, and stage IV colorectal cancer.

7. The composition according to any one of claims 1 to 4, It is characterized in that The sample detected by the composition is selected from one or more of the group consisting of plasma, blood cells, whole blood, peripheral blood, serum, human feces, tissue, urine, saliva and amniotic fluid.

8. The composition according to claim 7, It is characterized in that The sample is plasma.

9. Use of the composition according to any one of claims 1 to 8 in the preparation of a product for diagnosing and / or predicting a colon cell proliferative disorder in a subject.

10. The use according to claim 9, It is characterized in that The cell proliferative disorder of the colon is selected from the group consisting of advanced adenoma, high-grade epithelial neoplasia, stage I colorectal cancer, stage II colorectal cancer, stage III colorectal cancer, and stage IV colorectal cancer.

Images