Primer system, kit and method for detecting cattle, sheep, pig, horse, chicken, duck and goose derived components in agricultural products
Through LAMP detection technology and specific primer system, combined with calcein color change agent or Sybr green dye, the high cost and professional technical needs of PCR technology are solved, and a simple and fast detection of multiple poultry ingredients for agricultural products is achieved, suitable for grassroots and on-site use.
Patent Information
- Application Number
- CN202410472160.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-19
- Publication Date
- 2024-12-13
AI Technical Summary
In the prior art, PCR technology detects animal-derived ingredients in agricultural products requires high-end instruments and professional and technical personnel. It is costly and has limited application scope, making it difficult to meet the testing needs of grassroots institutions and small enterprises.
Using LAMP detection technology, a specific primer system and kit for cattle, sheep, pigs, horses, chickens, ducks, and geese are designed, combined with calcein color changers or Sybr green dyes, to achieve simple and fast detection methods, suitable for fast on-site Inspection and grassroots quick inspection.
It reduces the detection cost and hardware environment requirements, and realizes rapid and accurate detection of a variety of avian-derived components. It is especially suitable for grassroots and on-site inspections. It has low cost and short time. The results can be judged by naked eyes or fluorescence maps.
Smart Images
Figure CN119120713A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biological detection, and in particular relates to a primer system, a kit and a method for detecting components derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products. Background Art
[0002] Since humans began to trade in animal products, the phenomenon of substituting inferior products for good ones has been inevitable. In recent years, market supervision departments in various places have seized countless cases, including: duck meat is used to make frozen lamb rolls, lamb rolls and goat milk powder contain bovine ingredients, fresh pork is specially processed to pass as fresh beef, pig lungs are passed as cow lungs, pork, horse meat and beef are mixed into beef jerky, chicken and pork are mixed into beef balls, etc. The above-mentioned counterfeit products are basically indistinguishable through sensory evaluation because they are processed with flavors and seasonings, physical and chemical methods, or deep processing.
[0003] The current mainstream method of authenticity identification and adulteration detection is to amplify and detect animal-derived genes through PCR technology. Existing technologies such as CN107663543A and CN 105969839 A disclose fluorescent PCR methods for detecting poultry-derived components, which play an important role in daily monitoring. PCR technology mainly includes two steps: extracting sample DNA and PCR detection. It has the advantages of high sensitivity and specificity, but it has high requirements for laboratories and operators. PCR technology amplification detection requires the construction of a laboratory that meets the requirements of GB / T27403. The quotation of the key instrument qPCR instrument is usually more than 300,000 yuan, and the quality requirements for operating technicians are high. The detection fee for monitoring 1 to 6 genes using PCR technology for ordinary samples is about 2,000-3,000 yuan / batch, which limits its scope of application to a certain extent and makes it difficult to meet the detection needs of grassroots institutions, small and medium-sized enterprises, small workshops, and individuals.
[0004] In contrast, constant temperature amplification detection technologies such as LAMP, HAD, and RPA / RAA have the core characteristics of a single reaction temperature and are not restricted by thermal cyclers. They can usually be operated in simple constant temperature equipment in a general environment, do not require expensive qPCR instruments, have low requirements on the quality of operators, and have visualized results. Therefore, it is of great significance to provide a method for detecting multiple poultry-derived components in agricultural products that has low hardware environment requirements, is simple and fast, and has a wide range of applications. Summary of the invention
[0005] In order to solve the problems existing in the prior art, the present invention targets seven common meat-producing livestock and poultry in my country, namely cattle, sheep, pigs, horses, chickens, ducks and geese, and rationally uses LAMP (loop-mediated isothermal amplification) detection technology to provide a primer system, a kit and a method for detecting cattle, sheep, pigs, horses, chickens, ducks and geese-derived components in agricultural products. The primer system, a kit and a method have the advantages of low requirements for the hardware environment, simplicity and speed, a wide range of applications, low detection cost, and are particularly suitable for on-site rapid testing and grassroots rapid testing.
[0006] The invention provides a primer system for detecting components derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products, comprising a cattle primer group A, a sheep primer group B, a pig primer group C, a horse primer group D, a chicken primer group E, a duck primer group F and a goose primer group G; the cattle primer group A comprises: a first outer primer F3 cttctgactcctccctcc as shown in SEQ ID No.1, a first outer primer B3 gatggctcctaaaattgagg as shown in SEQ ID No.2, a first inner primer FIPcacggttcagcctgttcctgctcattcctactactcctcg as shown in SEQ ID No.3, and a first inner primer BIPtcccttagcaggcaacctagtcctgctaagtgtaaagagaa as shown in SEQ ID No.4; the sheep primer group B comprises: a second outer primer F3 agtcggaatagacgtcga as shown in SEQ ID No.5, a first outer primer B3 gatggctcctaaaattgagg as shown in SEQ ID No.6 The second outer primer B3aggacaatgtcaagggag as shown in SEQ ID No.6, the second inner primer FIP gcgttgctagtcaactgaatacttacgtcagctactataattatcgc as shown in SEQ ID No.7, the second inner primer BIP ggtaatatcaaatgatctcctgccaacaattccagttaagcctcc as shown in SEQ ID No.8; the porcine primer group C comprises: the third outer primer F3gcccaaagagtaaataatgtact as shown in SEQ ID No.9, the third outer primer B3 acaaaggcatgagctgta as shown in SEQ ID No.10, the third inner primer FIPtgccgatgtctttgtggtttgctgcaggtcctgatgttc as shown in SEQ ID No.11, The third inner primer BIPgcactgccttgagcctactaagatttgatcatcgccaagt as shown in SEQ ID No.12; the horse primer set D includes: the fourth outer primer F3 ccgtaaaaagctacaaccaa as shown in SEQ ID No.13, the fourth outer primer B3 atggaacaggctcctcta as shown in SEQ ID No.14, the fourth inner primer FIPagtggggtatctaatcccagtttgctacgaaagtgactttaatacctc as shown in SEQ ID No.15, the fourth outer primer FIPagtggggtatctaatcccagtttgctacgaaagtgactttaatacctc as shown in SEQ ID No.16, the fourth outer primer FIPagtggggtatctaatcccagtttgctacgaaagtgactttaatacctc as shown in SEQ ID No.17.16; the chicken primer set E comprises: the fifth outer primer F3 gcccccaaacctttcttcc as shown in SEQ ID No.17, the fifth outer primer B3tctttacgccgggtagct as shown in SEQ ID No.18, the fifth inner primer FIPtgagtacccgtgggggtgtgaaaggagcaggtatcaggca as shown in SEQ ID No.19, and the fifth inner primer BIPtagccatagcaacccagggttgtgggtttcttgtatgaccgc as shown in SEQ ID No.20; the duck primer set F comprises: the sixth outer primer F3aaacttcggatctctgctcg as shown in SEQ ID No.21, the sixth outer primer B3 gtgcaggtagatgcagatga as shown in SEQ ID No.22, and the fifth inner primer FIPtgagtacccgtgggggtgtgaaaggagcaggtatcaggca as shown in SEQ ID No.23. The sixth inner primer FIP agggatgtgtctgcggtgtagtctggccacacaaatcctcac as shown in SEQ ID No.23, the sixth inner primer BIP tcagtagccaacacatgccgaacattggcgtggaggttgc as shown in SEQ ID No.24; the goose primer group G includes: the seventh outer primer F3 tcagcaacccgttgcatat as shown in SEQ ID No.25, the seventh outer primer B3 ggcgccaaaaagctggaa as shown in SEQ ID No.26, the seventh inner primer FIPggcgcaaaaatgtgaggagggcggtatgactagcttcaggc as shown in SEQ ID No.27, and the seventh inner primer BIPggttcactcacctctccttgccgccgcgattacgcattga as shown in SEQ ID No.28.
[0007] By adopting the above technical scheme, the LAMP primer system is designed according to the COX 1 gene of cattle, sheep and pigs, the 12S rRNA gene of horses, the Cytb gene of chickens and ducks, and the tRNA-Glu gene of geese, so as to realize the simultaneous detection of cattle, sheep, pigs, horses, chickens, ducks and geese-derived components. The primer sets for cattle, sheep, pigs, horses, chickens, ducks and geese respectively include outer primer F3, outer primer B3, inner primer FIP and outer primer BIP, which have good specificity and no cross reaction or interference will occur between different primer sets.
[0008] Accordingly, the present invention also provides a kit for detecting cattle, sheep, pig, horse, chicken, duck, and goose-derived ingredients in agricultural products, comprising: the primer system, LAMP reagent, reaction enzyme, positive control, negative control, and blank control. Preferably, the reaction enzyme is Bst polymerase, and its concentration is 8U / μL; the positive control includes a concentration of 10 6 The test sample was prepared by mixing 100 copies / μL of DNA from cattle, pigs, horses, sheep, chickens, ducks and geese, and the DNA included the amplification sequences of the corresponding F3 primer sequences and B3 primer sequences in cattle primer set A to goose primer set G; as a negative control, DNA from non-target genes was used; as a blank control, triple-distilled water was used.
[0009] Preferably, the components of the LAMP reagent include 20mmol / L Tris-HCl, 10mmol / L KCl, 10mmol / L (NH4)2SO4, 6mmol / LMgCl2, 2mmol / LMgSO4, 1.4mmol / L dNTP, 0.1% TritonX-100, and 1.2mol / L betaine. 22μL of the LAMP reagent is added to a 100μL reaction tube.
[0010] Preferably, the concentrations of the F3 primer, B3 primer, FIP primer and BIP primer in the bovine primer set A to the goose primer set G are 2 μmol / L, 2 μmol / L, 8 μmol / L and 8 μmol / L, respectively.
[0011] Preferably, the kit further comprises a visual agent; the visual agent is a calcein color-changing agent, which is added to the reaction system during detection. If it turns green, it indicates that the test result is positive, and if it remains orange, it indicates that the test result is negative.
[0012] Preferably, the kit further comprises Sybr green dye added to the reaction system; during detection, if the fluorescence spectrum obtained by the fluorescence PCR instrument is an S-type amplification curve, it indicates that the detection result is positive, and if the fluorescence spectrum obtained by the fluorescence PCR instrument is not an S-type amplification curve, it indicates that the detection result is negative.
[0013] Preferably, when the kit is used for testing, when the amplification value detected by the turbidity meter exceeds a threshold value, it indicates that the test result is positive, and when the amplification value detected by the turbidity meter does not exceed the threshold value, it indicates that the test result is negative.
[0014] In addition, the present invention also provides a method for detecting cattle, sheep, pig, horse, chicken, duck, and goose-derived components in agricultural products, comprising the following steps:
[0015] S1: Prepare the agricultural products to be tested in advance to obtain DNA sample liquid;
[0016] S2: Using the DNA sample solution as a reaction template, performing LAMP amplification and detection using a kit as described in any one of claims 2 to 5, and determining the results.
[0017] Preferably, step S1 comprises: placing the agricultural product to be tested in a grinding tube containing stainless steel beads, adding triple distilled water, grinding in a portable grinder, centrifuging, taking the supernatant, and obtaining a DNA sample solution. More preferably, step S1 comprises: placing 0.5 g of the agricultural product to be tested in a grinding tube containing three 304 stainless steel beads, adding 500 μL triple distilled water, grinding in a portable grinder at 60 Hz for 100 s, centrifuging at 5 krpm for 1 min, taking the supernatant, and obtaining a DNA sample solution.
[0018] Preferably, in the step S2, the step of performing LAMP amplification and detection comprises: adding 1 μL of the primer system as claimed in claim 1, 1 μL of the DNA sample solution or the positive control or the negative control or the blank control, and 1 μL of the reaction enzyme to 22 μL of the LAMP reagent, lightly mixing, and then proceeding according to step S2.1, S2.2 or S2.3; S2.1: putting a drop of calcein color changing agent on the lid of the reaction tube, tightly covering it, placing it in a constant temperature device, and subjecting it to a program of 65°C, 60 min and 80°C, 10 min, and then centrifuging it at 3 krpm to observe the color change; S2.2: adding 1 μL of Sybr green dye to the reaction system, tightly covering it, and placing it in a fluorescent PCR, with 63°C 15s and 63°C 45s as one cycle, collecting the fluorescent signal at 63°C 45s, and observing the amplification curve results for 45 cycles; S2.3: placing the reaction tube in a turbidity meter, tightly covering it, and subjecting it to a program of 65°C, 60min and 80°C, 10min, and then observing the amplification value results.
[0019] Preferably, in step S2, the step of result judgment includes: 1) quality control judgment: the positive control result is positive, the negative control and blank control results are negative, indicating that the kit is effective, and entering the sample test result judgment step; 2) sample test result judgment: when the test result of bovine primer group A of the sample DNA is negative, it indicates that the sample does not contain bovine components; when the test result of bovine primer group A of the sample DNA is positive, it indicates that the sample contains bovine components; when the test result of sheep primer group B of the sample DNA is negative, it indicates that the sample does not contain sheep components; when the test result of sheep primer group B of the sample DNA is positive, it indicates that the sample contains sheep components; when the test result of pig primer group C of the sample DNA is negative, it indicates that the sample does not contain pig components; when the test result of pig primer group C of the sample DNA is positive, it indicates that the sample does not contain pig components. When the test result of horse primer group D of sample DNA is negative, it indicates that the sample does not contain horse origin components; when the test result of horse primer group D of sample DNA is positive, it indicates that the sample contains horse origin components; when the test result of chicken primer group E of sample DNA is negative, it indicates that the sample does not contain chicken origin components; when the test result of chicken primer group E of sample DNA is positive, it indicates that the sample contains chicken origin components; when the test result of duck primer group F of sample DNA is negative, it indicates that the sample does not contain duck origin components; when the test result of duck primer group F of sample DNA is positive, it indicates that the sample contains duck origin components; when the test result of goose primer group G of sample DNA is negative, it indicates that the sample does not contain goose origin components; when the test result of goose primer group G of sample DNA is positive, it indicates that the sample contains goose origin components.
[0020] Compared with the prior art, the beneficial effects of the present invention include:
[0021] The primer system for detecting cattle, sheep, pigs, horses, chickens, ducks, and geese-derived components in agricultural products provided by the present invention has good specificity, and there will be no cross-reaction or interference between different primer groups, and can be used for related product detection. The kit for detecting cattle, sheep, pigs, horses, chickens, ducks, and geese-derived components in agricultural products provided by the present invention has the advantages of being simple, fast, and having a wide range of applications, and has low detection cost (the cost of detecting a single derived component can be as low as about 50 yuan / batch), and is particularly suitable for on-site rapid detection and grassroots rapid detection. In the case of using a calcein color-changing agent, the result can be directly judged by observing the obvious orange / green discoloration phenomenon with the naked eye. In addition, the method for detecting cattle, sheep, pigs, horses, chickens, ducks, and geese-derived components in agricultural products provided by the present invention has good specificity, low requirements for the hardware environment, and is simple and fast (the time for detecting a single derived component can be as low as about 1h / batch), and can effectively detect cattle, sheep, pigs, horses, chickens, ducks, and geese-derived components in agricultural products, which is conducive to strengthening daily monitoring and combating counterfeit products. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1The fluorescence spectra of the samples detected by the LAMP detection method (using the visual method) of Example 3 of the present invention and the positive, negative and blank controls of the kit are shown.
[0023] Figure 2 The fluorescence spectra of the positive, negative and blank controls of the LAMP detection method (using fluorescence method) detection kit of Example 3 of the present invention are shown.
[0024] Figure 3 This is the fluorescence spectrum of the sample detected by the LAMP detection method (using fluorescence method) of Example 3 of the present invention.
[0025] Figure 4 The turbidity spectra of the positive, negative and blank controls of the LAMP detection method (using turbidity method) detection kit of Example 3 of the present invention are shown.
[0026] Figure 5 This is the turbidity spectrum of the sample detected by the LAMP detection method (using turbidity method) of Example 3 of the present invention. DETAILED DESCRIPTION
[0027] The present invention is further described in detail below with reference to the accompanying drawings and embodiments.
[0028] In the present invention, the reagents and materials involved are conventional commercial products, or can be obtained by conventional technical means in the art. Unless otherwise specified, % refers to volume percentage.
[0029] Example 1 Design of LAMP primers for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products
[0030] When designing LAMP primers for cattle, sheep, pigs, horses, chickens, ducks, and geese, their taxonomic status should be clarified first. The academic species classification and daily name range of domestic cattle (Bostaurusdomestica), domestic pigs (Sus scrofa domestica), domestic horses (Equus caballus caballus), domestic chickens (Gallusgallusdomesticus), and domestic ducks (Anasplatyrhynchos domesticus) are clear and consistent, so relevant gene data are directly collected through online library searches; at the same time, the gene sequences are verified by combining offline sampled agricultural products. Domestic sheep are divided into domesticated goats (Capra aegagrus hircus) and sheep (Ovisaries), and domestic geese are divided into Chinese geese (Anser cygnoides domestica) and European geese (Anser anserdomestica). The above situations have certain differences in edible agricultural products, such as meat, milk, and by-products. Therefore, when collecting online data and checking offline sampling, the common sequences of the two are selected for analysis to improve species coverage.
[0031] In the screening of primer target genes, the present invention focuses on mitochondrial genes, which, as extranuclear genetic material, have a higher mutation rate than nuclear genome, have a wide range of polymorphisms both between species and within species, and have a high degree of individual specificity, which is more conducive to comparing the differences between species. More than 3 specific genes of cattle, sheep, pigs, horses, chickens, ducks, and geese were collected in Genbank of NCBI, and more than 30 data were collected for each gene. The conserved gene fragments within 2kbp were aligned using the MegAlign software in Lasergene v7.1.0, and the primer sets (Table 1) were generated using the loop-mediated primer online design software LAMP primerdesigningsoftwave primerexplorer V5.0 of Japan Rongyan Co., Ltd.
[0032] Table 1 Primer sets for seven animal-derived specific genes
[0033]
[0034]
[0035] Example 2 LAMP Primer Screening of Ingredients from Cattle, Sheep, Pigs, Horses, Chickens, Ducks, and Goose in Edible Agricultural Products
[0036] Primers can be synthesized by a company with primer synthesis capabilities. In this example, synthesis services were purchased from Sangon Biotech (Shanghai) Co., Ltd. 100 μmol / L of FIP, BIP, F3, and B3 independent primer solutions of each primer set were prepared into mixed solutions with final concentrations of 8, 8, 2, and 2 μmol / L.
[0037] Positive controls and negative controls can be obtained by purchasing quality control samples, extracting fresh meat, etc. In this embodiment, nucleic acid quality control samples derived from cattle, sheep, pigs, horses, chickens, ducks, and geese were purchased from Shangcheng Beina Chuanglian Biotechnology Co., Ltd.
[0038] The blank control was triple-distilled water.
[0039] Reaction solution: 20mmol / L Tris-HCl, 10mmol / L KCl, 10mmol / L (NH4)2SO4, 6mmol / L MgCl2, 2mmol / L MgSO4, 1.4mmol / L dNTP, 0.1% TritonX-100, and 1.2mol / L trehalose.
[0040] Reaction enzyme: Bst polymerase, purchased from Sangon Biotechnology (Shanghai) Co., Ltd. in this example, with an enzyme activity of 8 U / μL.
[0041] Visual agent: calcein indicator, purchased from Guangzhou Diao Biotechnology Co., Ltd. in this example, turns green when the test result is positive, and yellow when the test result is negative.
[0042] Reaction formula: Add 22 μL of the reagent, 1 μL of a primer set, 1 μL of Bst polymerase, and 1 μL of one of the positive, negative, and blank controls corresponding to the primer set into a 100 μL reaction tube, and mix gently.
[0043] How to use the visual agent: Place 1 μL of calcein indicator in the reaction tube cap and close it tightly.
[0044] Reaction conditions: 65°C, 60 min, 80°C, 10 min. The incubation equipment was Shanghai Jingqi Instrument MK-10S dry thermostat, and the reaction was centrifuged at 3krpm.
[0045] Verification method: Determine based on the expected results of positive, negative and blank controls.
[0046] Verification results: One primer set A2, B7, C10, D3, E11, F4, G10 for cattle, sheep, pig, horse, chicken, duck and goose were screened (Table 2), and the simplified numbering was primer set A, B, C, D, E, F, G for cattle, sheep, pig, horse, chicken, duck and goose.
[0047] Table 2 Primer verification results
[0048]
[0049]
[0050]
[0051]
[0052] Note: “+” indicates positive; “-” indicates negative; “ / ” indicates not tested.
[0053] Example 3: Assembly and verification of LAMP kit for ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products
[0054] Samples tested: Whole-cut steaks, bottled goat milk, fresh pork liver, frozen horse meat, fresh chicken offal, frozen duck breasts, and goose eggs purchased at the farmers' market.
[0055] 1. Basic components of the kit
[0056] ① Primer solution: This example purchased synthesis services from Sangon Biotech (Shanghai) Co., Ltd. 100 μmol / L of FIP, BIP, F3, and B3 independent primer solutions in primer sets A, B, C, D, E, F, and G were prepared into mixed solutions with final concentrations of 8, 8, 2, and 2 μmol / L, with a specification of 100 μL in a 1.5 mL centrifuge tube.
[0057] ② Positive control: Take the primers F3 and B3 of primer groups A, B, C, D, E, F, G and dilute them to 10 μmol / L respectively. Use the diluted primers to amplify the target gene in the nucleic acid quality control samples from cattle, sheep, pigs, horses, chickens, ducks and geese respectively. After the amplified target bands are cut and recovered, they are transferred into the pMV-20T vector and replicated with competent E.coli cells JM109. The plasmid is extracted and diluted to 10 6 Finally, the plasmid was diluted and mixed to 10 5 The positive plasmid control with 100 copies / μL is 100 μL in a 1.5 mL centrifuge tube.
[0058] ③Negative control: DNA extracted from salmon sperm, concentration 10 5 –10 6 copies / μL, the specification is 100μL in a 1.5mL centrifuge tube.
[0059] ④ Blank control: Same as Example 2, specification is 100 μL in a 1.5 mL centrifuge tube.
[0060] ⑤ Reaction enzyme: Same as Example 2, specification is 100 μL in a 1.5 mL centrifuge tube.
[0061] ⑥ Reaction solution: Same as in Example 2, with the specification of 1 mL in a 1.5 mL centrifuge tube.
[0062] 2.1 Visual verification:
[0063] ① Visual agent: calcein indicator.
[0064] ② Reaction formula: add 22 μL of the reaction solution, 1 μL of a primer set, 1 μL of Bst polymerase, and then add 1 μL of the positive, negative, blank control or sample corresponding to the primer set into a 100 μL reaction tube, and mix gently.
[0065] ③Reaction conditions: same as in Example 2.
[0066] ④ Result determination: After the reaction is completed, it turns green, indicating a positive test result, and turns yellow, indicating a negative test result.
[0067] 2.2 Fluorescence verification:
[0068] ① Fluorescent agent: 100 μL Sybr green solution.
[0069] ② Reaction formula: Add 22 μL of the reagent, 1 μL of a primer set, 1 μL of Bst polymerase, and 1 μL of the positive, negative, blank control or sample corresponding to the primer set into a 100 μL reaction tube, mix gently, and then add 1 μL of fluorescent agent.
[0070] ③ Reaction conditions: 63℃15s, 63℃45s as one cycle, collecting fluorescence signals at 63℃45s, 45 cycles, fluorescence PCR instrument is ABI Step one plus.
[0071] ④ Result determination: If the fluorescence spectrum is an S-shaped amplification curve, it indicates that the test result is positive; if it is not an S-shaped amplification curve, it indicates that the test result is negative.
[0072] 2.3 Turbidimetric verification:
[0073] ① Reaction formula: Add 22 μL of the reagent, 1 μL of a primer set, 1 μL of Bst polymerase, and 1 μL of the positive, negative, blank control or sample corresponding to the primer set into a 100 μL reaction tube, and mix gently.
[0074] ② Reaction conditions: 65℃, 60min, 80℃, 10min. Turbidimeter is LA320C.
[0075] ③Result determination: If the amplification exceeds the threshold, it indicates that the test result is positive; if it does not exceed the threshold, it indicates that the test result is negative.
[0076] 3. Verification results: The results of visual, fluorescence and turbidity methods are as follows Figures 1 to 5 As shown, it can be seen that the positive, negative and blank controls are in line with expectations and the sample test results are normal. Figure 2 In the figure, curves 1-7 are the S-type amplification curves of the positive control, and curves 8-21 are the amplification curves of the negative control and the blank control, respectively. Figure 3 In the figure, curves 22-28 are the amplification curves of samples such as original cut steak, bottled goat milk, and fresh pork liver. Figure 4 In the figure, curves 1-7 are turbidity detection curves of positive control, and curves 8-21 are turbidity detection curves of negative control and blank control, respectively. Figure 5 In the figure, curves 22-28 are the turbidity detection curves of samples such as original cut steak, bottled goat milk, and fresh pork liver.
[0077] 4. Inter-laboratory verification: The samples of this embodiment were tested in accordance with GB / T 31864-2019 and SN / T 3730.5-2013, and the experimental results were consistent; this kit was sent to two testing units in the same industry in Guizhou Province, and the experimental results were consistent.
[0078] In summary, the primer system provided by the present invention for detecting cattle, sheep, pig, horse, chicken, duck and goose-derived components in agricultural products has good specificity, and no cross-reaction or interference will occur between different primer sets. It can be used for related product detection. The provided detection kit and method have the advantages of simplicity, speed, easy operation and low cost, and have good practical value.
[0079] The above contents are further detailed descriptions of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions or substitutions can be made without departing from the concept of the present invention, which should be regarded as falling within the protection scope of the present invention.
Claims
1. A primer system for detecting ingredients from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products. Features: The invention comprises a cattle primer group A, a sheep primer group B, a pig primer group C, a horse primer group D, a chicken primer group E, a duck primer group F, and a goose primer group G; the cattle primer group A comprises: a first outer primer F3 as shown in SEQ ID No.1, a first outer primer B3 as shown in SEQ ID No.2, a first inner primer FIP as shown in SEQ ID No.3, and a first inner primer BIP as shown in SEQ ID No.4; the sheep primer group B comprises: a second outer primer F3 as shown in SEQ ID No.5, a second outer primer B3 as shown in SEQ ID No.6, a second inner primer FIP as shown in SEQ ID No.7, and a second inner primer BIP as shown in SEQ ID No.8; the pig primer group C comprises: a third outer primer F3 as shown in SEQ ID No.9, a third outer primer B3 as shown in SEQ ID No.10, a third inner primer FIP as shown in SEQ ID No.11, and a first inner primer BIP as shown in SEQ ID No.
12. The horse primer set D comprises: the fourth outer primer F3 as shown in SEQ ID No.13, the fourth outer primer B3 as shown in SEQ ID No.14, the fourth inner primer FIP as shown in SEQ ID No.15, and the fourth inner primer BIP as shown in SEQ ID No.16; the chicken primer set E comprises: the fifth outer primer F3 as shown in SEQ ID No.17, the fifth outer primer B3 as shown in SEQ ID No.18, the fifth inner primer FIP as shown in SEQ ID No.19, and the fifth inner primer BIP as shown in SEQ ID No.20; the duck primer set F comprises: the sixth outer primer F3 as shown in SEQ ID No.21, the sixth outer primer B3 as shown in SEQ ID No.22, the sixth inner primer FIP as shown in SEQ ID No.23, and the sixth inner primer BIP as shown in SEQ ID No.24; the goose primer set G comprises: the seventh outer primer F3 as shown in SEQ ID No.25, the seventh outer primer B3 as shown in SEQ ID No.26, the seventh inner primer FIP as shown in SEQ ID No.27; The seventh outer primer B3 shown in No.26, the seventh inner primer FIP shown in SEQ ID No.27, and the seventh inner primer BIP shown in SEQ ID No.
28.
2. A kit for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products. Features: include: The primer system, LAMP reagent, reaction enzyme, positive control, negative control and blank control as described in claim 1.
3. The kit for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 2, Features: The components of the LAMP reagent include 20mmol / L Tris-HCl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 、6mmol / LMgCl 2 , 2mmol / LMgSO 4 , 1.4mmol / L dNTP, 0.1% TritonX-100, 1.2mol / L betaine.
4. The kit for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 2 or 3, Features: It also includes a visual agent; the visual agent is a calcein color-changing agent, which is added to the reaction system during detection. If it turns green, it indicates that the test result is positive, and if it remains orange, it indicates that the test result is negative.
5. The kit for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 2 or 3, Features: It also includes Sybr green dye; when added to the reaction system during detection, if the fluorescence spectrum obtained by the fluorescence PCR instrument is an S-type amplification curve, it indicates that the test result is positive; if the fluorescence spectrum obtained by the fluorescence PCR instrument is not an S-type amplification curve, it indicates that the test result is negative.
6. The kit for detecting components derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 2 or 3, Features: During the test, when the amplification value detected by the turbidity meter exceeds the threshold value, it indicates that the test result is positive; when the amplification value detected by the turbidity meter does not exceed the threshold value, it indicates that the test result is negative.
7. A method for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products. Features: The steps include: S1: Extract the agricultural products to be tested to obtain DNA sample liquid; S2: Using the DNA sample solution as a reaction template, performing LAMP amplification and detection using a kit as described in any one of claims 2 to 6, and determining the result.
8. The method for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 7, Features: The step S1 comprises: placing the agricultural product to be tested into a grinding tube filled with stainless steel beads, adding triple distilled water, grinding the mixture in a portable grinder, centrifuging the mixture, and taking the supernatant to obtain a DNA sample solution.
9. The method for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 7, Features: In the step S2, the steps of performing LAMP amplification and detection include: adding the primer system as claimed in claim 1, the DNA sample solution or the positive control or the negative control or the blank control, and the reaction enzyme to the LAMP reagent, lightly mixing, and then proceeding according to the steps S2.1, S2.2 or S2.3; S2.1: putting a drop of calcein color changing agent on the lid of the reaction tube, tightly covering it and placing it in a constant temperature device, subjecting it to a program of 65°C, 60min and 80°C, 10min, and then instantaneously centrifuging it, and observing the color change; S2.2: adding Sybr green dye to the reaction system, tightly covering it and placing it in a fluorescent PCR, with 63°C 15s and 63°C 45s as one cycle, collecting the fluorescent signal at 63°C 45s, and observing the amplification curve results for 45 cycles; S2.3: tightly covering the reaction tube and placing it in a turbidity meter, subjecting it to a program of 65°C, 60min and 80°C, 10min, and then observing the amplification value results.
10. The method for detecting ingredients derived from cattle, sheep, pigs, horses, chickens, ducks and geese in agricultural products according to claim 7, Features: In the step S2, the step of result judgment includes: 1) quality control judgment: the positive control result is positive, the negative control and blank control results are negative, indicating that the kit is effective, and entering the sample test result judgment step; 2) sample test result judgment: when the test result of the bovine primer group A of the sample DNA is negative, it indicates that the sample does not contain bovine components; when the test result of the bovine primer group A of the sample DNA is positive, it indicates that the sample contains bovine components; when the test result of the sheep primer group B of the sample DNA is negative, it indicates that the sample does not contain sheep components; when the test result of the sheep primer group B of the sample DNA is positive, it indicates that the sample contains sheep components; when the test result of the pig primer group C of the sample DNA is negative, it indicates that the sample does not contain sheep components. When the test result of pig primer group C of sample DNA is positive, it indicates that the sample contains pig components; when the test result of horse primer group D of sample DNA is negative, it indicates that the sample does not contain horse components; when the test result of horse primer group D of sample DNA is positive, it indicates that the sample contains horse components; when the test result of chicken primer group E of sample DNA is negative, it indicates that the sample does not contain chicken components; when the test result of chicken primer group E of sample DNA is positive, it indicates that the sample contains chicken components; when the test result of duck primer group F of sample DNA is negative, it indicates that the sample does not contain duck components; when the test result of duck primer group F of sample DNA is positive, it indicates that the sample contains There are duck-derived ingredients; when the test result of goose primer group G of the sample DNA is negative, it indicates that the sample does not contain goose-derived ingredients; When the test result of goose primer group G of the sample DNA is positive, it indicates that the sample contains goose-derived components.