Drug-resistant tuberculosis early warning method and kit for heterogeneity drug resistance semi-quantitative detection

Abstract

The invention relates to a drug-resistant tuberculosis early warning method and kit for heterogeneity drug resistance semi-quantitative detection. The early warning method comprises the following steps: designing an amplification primer, a retardation probe and an extension primer for a target gene; extracting DNA of an object to be detected; adding the amplification primer and the retardation probe into a nucleic acid amplification system, and carrying out nucleic acid amplification on the DNA of the object to be detected; digesting an amplification product by using shrimp alkaline phosphatase (SAP); adding the extension primer into a system subjected to SAP digestion, and carrying out single base extension; and finally, carrying out resin desalination on the extension product, and detecting by using matrix-assisted laser desorption ionization-time-of-flight mass spectrometry. The invention also discloses a kit, which comprises an amplification primer, a retardation probe, an extension primer, an amplification reaction solution, a digestion reaction solution, an extension reaction solution, resin and a chip. According to the invention, trace mutation sites can be rapidly, efficiently and simply detected; and the proportion of mutation sites of a sample can be semi-quantitatively detected.

Description

Technical Field

[0001] The present invention belongs to the field of gene mutation detection, and in particular relates to a tuberculosis resistance early warning method and a detection kit based on semi-quantitative detection of rifampicin heterogeneous resistance. Background Art

[0002] The cure rate of drug-resistant tuberculosis is low and the mortality rate is high. Statistics from the WHO's "Global Tb report 2022" show that 3.6% (95% UI: 2.7-4.4%) of the world's multidrug-resistant or rifampicin-resistant tuberculosis cases are from new cases, and 18% (95% UI: 11-26%) are from retreated cases. The Chinese Center for Disease Control and Prevention estimates that the rifampicin resistance rate of new patients in my country is 3.4%, and the rifampicin resistance rate of retreated patients is 19.0%. In 2021, there will be approximately 33,000 new rifampicin-resistant patients, which poses a huge challenge to the prevention and control of tuberculosis transmission and the reduction of the disease burden, and is a major obstacle for my country to achieve the goal of "ending tuberculosis by 2035".

[0003] Heterogeneous drug resistance refers to the phenomenon that drug-resistant bacteria and sensitive bacteria coexist in the same sample. This reflects the transformation process of the bacterial population from partial drug resistance to complete drug resistance, and is a critical early warning window before drug resistance. Dynamic monitoring of heterogeneous drug resistance levels and early warning of high-risk cases that may develop drug resistance are important means to achieve early intervention and control the spread of drug resistance. Therefore, clinical practice urgently needs fast, efficient, and accurate technology to detect heterogeneous bacterial populations with drug-resistant subpopulations accounting for about 0.5-1%, so as to achieve early warning of drug resistance, advance the prevention and control of drug-resistant tuberculosis, and reduce the risk of population transmission.

[0004] Traditional phenotypic drug resistance testing is the gold standard for determining the drug resistance of Mycobacterium tuberculosis. Theoretically, it can detect drug-resistant bacteria with a drug-resistant subpopulation ratio ≥ 1%, but generally a ratio of 5% is required for stable detection. However, it is time-consuming and has strict biosafety requirements for the testing site. It is difficult to meet the needs of rapid testing and is not conducive to early detection of drug resistance and prevention and control of its spread.

[0005] With the rapid development of molecular detection technology, drug resistance can be predicted by detecting specific regions of the Mycobacterium tuberculosis genome, that is, genotypic drug sensitivity. However, the sensitivity of existing molecular detection technology for detecting drug-resistant subpopulations is lower than that of phenotypic drug sensitivity. For example, the drug resistance detection ratio of the LiPA nucleic acid hybridization probe technology recommended by the WHO is 5%-50%, the Xpert-MTB / RIF drug resistance detection ratio is about 60% mutations, and the melting curve method detection ratio is about 20-30% mutations. In recent years, the emerging nucleic acid mass spectrometry can also detect a ratio higher than 20%. When high-throughput deep sequencing detects heterogeneous drug-resistant subpopulations with a ratio greater than 1%, 400-fold fragment coverage is required, which greatly increases the detection time and cost.

[0006] However, the sensitivity of existing molecular detection technologies for detecting drug-resistant subgroups is lower than that of phenotypic drug sensitivity. For example, the resistance detection ratio of the LiPA nucleic acid hybridization probe technology recommended by WHO is 5%-50%, the resistance detection ratio of Xpert-MTB / RIF is about 60% mutations, and the detection ratio of the melting curve method is about 20-30% mutations. In recent years, the emerging nucleic acid mass spectrometry can also detect a ratio higher than 20%, and high-throughput deep sequencing requires 400 times fragment coverage when detecting heterogeneous resistance subgroups with a ratio greater than 1%, which greatly increases the detection time and cost. Therefore, the sensitivity of existing technologies is not enough to detect heterogeneous resistance with a ratio of less than 1%, and cannot meet the needs of early warning of drug resistance. Summary of the invention

[0007] In view of the above problems, the present invention provides a method and a kit for early warning of drug-resistant tuberculosis for semi-quantitative detection of heterogeneous drug resistance, which can quickly, efficiently and simply detect trace mutation sites; and can semi-quantitatively detect the proportion of mutation sites in samples.

[0008] To this end, the present invention adopts the following technical solutions:

[0009] A method for early warning of drug-resistant tuberculosis by semi-quantitative detection of heterogeneous drug resistance, characterized by the steps of:

[0010] 1-1: Design amplification primers, blocking probes, and extension primers for the target gene;

[0011] 1-2: Extract the DNA of the object to be tested;

[0012] 1-3: adding the amplification primers and the blocking probe to a nucleic acid amplification system to perform nucleic acid amplification on the DNA to be tested;

[0013] 1-4: Digest the amplified product with shrimp alkaline phosphatase (SAP);

[0014] 1-5: adding the extension primer to the system after SAP digestion to perform single base extension;

[0015] 1-6: After the extension product is desalted on the resin, it is detected using matrix-assisted laser desorption ionization-time of flight mass spectrometry;

[0016] The timing of steps 1-1 and 1-2 may be reversed.

[0017] Preferably, the amplification primers include an upstream amplification primer and a downstream amplification primer, and the 3' end of the upstream amplification primer overlaps with the 5' end of the blocking probe by 1 to 6 bases; the blocking probe is completely consistent with the wild-type gene sequence.

[0018] Preferably, the base sequence of the target gene in step 1-1 of the present invention is shown in SEQ ID NO.1, the amplification primer sequences are shown in SEQ ID NO.2 and 3, the blocking probe sequence is shown in SEQ ID NO.4, and the extension primer sequence is shown in SEQ ID NO.5

[0019] Preferably, the 3' end of the blocking probe is phosphorylated or has an "AAAA" base added; the 3' end of the extension primer is the base before the mutation site.

[0020] Preferably, the concentration of the amplification primer is 0.1-1 uM; the concentration of the blocking probe is 0.5-2 uM; and the annealing temperature is 58-68°C.

[0021] Preferably, in step 1-1, multiple sets of amplification primers, multiple sets of blocking probes, and extension primers are designed for the target gene, and in step 1-3, the multiple sets of amplification primers and multiple sets of blocking probes are matched into 4 different combinations, and added to the nucleic acid amplification system respectively, and the same test DNA is divided into 4 different systems for nucleic acid amplification. By using different combinations of amplification primers and blocking probes, different blocking effects on wild templates in samples can be achieved, so that samples with different mutation ratios can be judged as mutation negative or positive.

[0022] Preferably, the concentration of the amplification primer is 0.1-1 uM; the concentration of the blocking probe is 0-2 uM; and the annealing temperature is 58-68°C.

[0023] Preferably, the multiple sets of amplification primers are shown as SEQ ID NO.2, 3 or 6; the multiple sets of blocking probes are shown as SEQ ID NO.4 or 7; and the extension primers are shown as SEQ ID NO.5.

[0024] Preferably, the amplification well 1 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.2 (0.1-1uM), SEQ ID NO.3 (0.1-1uM), SEQ ID NO.4 (0.1-1uM); the amplification well 2 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.2 (0.1-1uM), SEQ ID NO.3 (0.1-1uM), SEQ ID NO.4 (0.1-0.5uM); the amplification well 3 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.2 (0.1-1uM), SEQ ID NO.3 (0.1-1uM), SEQ ID NO.7 (0.05-0.5uM); the amplification well 4 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.6 (0.1-1uM), SEQ ID NO.3 (0.1-1uM), SEQ ID NO.4(0~0.5uM).

[0025] The present invention also discloses a kit, which includes amplification primers, blocking probes, extension primers, amplification reaction solution, digestion reaction solution, extension reaction solution, resin and chip. The sequences of the amplification primers are shown in SEQ ID NO.2 and 3, the blocking probe sequence is shown in SEQ ID NO.4, and the extension primer sequence is shown in SEQ ID NO.5. The chip is dotted with pre-placed matrix spots, which can dilute and separate products, and finally bring the analyte into the gas phase after laser irradiation in the mass spectrometer.

[0026] The traditional method for quantitative or semi-quantitative detection of target genes is mainly fluorescent quantitative PCR technology (usually 1-2 components), but the proportion of heteroplasmic mutation genes is usually low, defined as less than 1% in Mycobacterium tuberculosis, and traditional methods cannot work effectively. Nucleic acid mass spectrometry methods (usually 1-7 components) can be used to qualitatively detect heteroplasmic mutations. Usually, the proportion of heteroplasmy needs to be above 20%, so the sensitivity is relatively low and it is impossible to identify the occurrence of drug resistance at an early stage.

[0027] The difference between the present invention and the current fluorescent quantitative PCR technology is that a nucleic acid mass spectrometry detection technology is added to identify the amplification product.

[0028] The difference between the present invention and the current nucleic acid mass spectrometry technology is that a blocking probe is introduced into component 1, and the detection is performed in separate wells at the same time, and the primers, probe types and dosages are adjusted, so as to achieve the effect of being able to detect low-abundance mutations and semi-quantitatively detect mutations.

[0029] The beneficial effects of the present invention are as follows:

[0030] 1. It can quickly, simply and efficiently detect extremely high-frequency drug-resistant mutation gene loci, and can detect 0.1% mutation ratio. It can meet the clinical needs for early detection of heterogeneous drug resistance, has early warning value for drug-resistant tuberculosis, and reduces report acquisition time and testing costs.

[0031] 2. It can semi-quantitatively report lower mutation ratios, such as <0.1%, 0.1%-0.5%, 0.5%-1%, 1%-5%, and >5%. It can be used to observe the treatment effect during clinical diagnosis and treatment, especially to dynamically monitor high-risk patients, adjust treatment plans, and reduce the risk of drug-resistant tuberculosis transmission. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is a schematic diagram showing that the amplification of the wild template is inhibited in the present invention.

[0033] Figure 2 It is a schematic diagram showing that amplification of mutant templates is not inhibited in the present invention.

[0034] Figure 3 This is the detection result of all wild-type samples.

[0035] Figure 4 This is the test result of a sample with a known 0.1% mutation rate.

[0036] Figure 5 This is the test result of a sample known to have 1% mutation.

[0037] Figure 6 The figure shows the result of amplification well 1 of a sample with a known mutation ratio of about 3%.

[0038] Figure 7 The figure shows the result of amplification well 2 of a sample with a known mutation ratio of about 3%.

[0039] Figure 8 The figure shows the result of amplification well 3 of a sample with a known mutation ratio of about 3%.

[0040] Fig. 9 The result diagram of amplification well 4 is a test result of a sample with a known mutation ratio of about 3%. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with specific embodiments.

[0042] The present invention discloses a kit comprising the following main components:

[0043] 1. Amplification primer mix: including specifically designed upstream primers, downstream primers and blocking probes related to the target drug-resistant gene mutation;

[0044] 2. Amplification reaction mixture: contains Taq enzyme, dNTPs, Mg 2+ , BSA, DSMO and other buffer components; 3. Digestion reaction mixture: contains SAP enzyme, Mg 2+ , Tris-HCl, glycerol and other buffer components;

[0045] 4. Extension primer mix: contains extension primers specifically designed for the target drug resistance gene mutation site;

[0046] 5. Extension reaction mixture: contains Taq enzyme, ddNTPs, Mg 2+ , BSA, DSMO and other buffer components; 6. Resin: styrene or acrylic acid, propylene ester, which generates a three-dimensional spatial network structure through polymerization reaction, and then introduces different types of chemically active groups to form a high-molecular spherical granular polymer, which has the function of adsorbing various salt ions in the system.

[0047] 7. Chip: There are pre-placed matrix spots on the silicon chip, which can dilute and separate the products, and finally bring the analytes into the gas phase after laser irradiation in the mass spectrometer. The matrix components include α-cyano-4-hydroxycinnamic acid, 2,5-dihydroxybenzoic acid, 3,5-dimethoxy-4-hydroxycinnamic acid and 2,6-dihydroxyacetophenone.

[0048] The upstream primer sequence of the amplification primer is shown as SEQ ID NO.2, the downstream primer sequence is shown as SEQ ID NO.3, the blocking probe sequence is shown as SEQ ID NO.4, and the extension primer sequence is shown as SEQ ID NO.5.

[0049] Taking the mutation of S to L (S>L, codon TCG to TTG) at position 531 of the rpoB gene of Mycobacterium tuberculosis, which has the highest frequency of rifampicin resistance, as an example, the operation method of the kit of the present invention is described.

[0050] Example 1: Detection of trace amounts of the S>L mutation at position 531 of the rpoB gene of Mycobacterium tuberculosis.

[0051] First, for the rpoB gene of wild Mycobacterium tuberculosis H37Rv (NCBI Reference Sequence: NC_000962.3), Primer 5.0 software was used to design amplification primers, blocking probes, and extension primers, and IDT (http: / / sg.idtdna.com / calc / analyze) and blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) were used to evaluate and synthesize the designed primers and probes. Specifically, the upstream amplification primer sequence is SEQ ID NO.2; the downstream amplification primer sequence is SEQ ID NO.3; the blocking probe sequence is SEQ ID NO.4; and the extension primer sequence is SEQ ID NO.5.

[0052] Nucleic acid extraction and purification kit (Shanghai Kangli Diagnostic Technology Co., Ltd., catalog number: 0290504003) was used to extract nucleic acid from Mycobacterium tuberculosis positive samples according to the kit instructions.

[0053] Using TB Premix Ex Taq TM GC enzyme system (Takara, catalog number: RR071A), refer to the reagent instructions, prepare the amplification reaction system: TB Green Premix Ex Taq GC (2X) 12.5ul, upstream primer (10uM) 0.4ul, downstream primer (10uM) 0.4ul, blocking probe (10uM) 2ul, extract DNA 5ul, fill to 25ul with nuclease-free water. After the system is prepared, use Applied Biosystems TM The system was amplified using SimpliAmp PCR instrument with the following program: 95°C, 3 min, and 40 cycles of (95°C, 10 s; 65°C, 45 s).

[0054] After amplification, use Applied Biosystems TM Shrimp alkaline phosphatase (SAP) (Cat. No.: 783901000UN) was used to digest the amplified product. The digestion system was: SAP 2ul, amplified product 5ul. After the system was prepared, the digestion reaction was performed using a SimpliAmp PCR instrument. The program was: 37°C, 15min, 85°C, 15min.

[0055] After digestion, Taq FS DNA polymerase (Xinhai Gene, catalog number: A1901A) was used to prepare the extension reaction system: Taq FS DNA Polymerase (5U / ul) 0.1ul, 10X Taq FS PCR Buffer 0.7ul, Ipex termination Mix (Agena) 0.2ul, SAP product 7ul, extension primer (2uM) 0.8ul, nuclease-free water 1.2ul. After the system was prepared, the digestion reaction was performed using a SimpliAmp PCR instrument, and the program was: 96°C, 30s, (96°C, 5s, (52°C, 5s, 80°C, 5s) 5 cycles) 40 cycles, 72°C, 3min.

[0056] After extension, the product was first desalted with a resin, and then spotted on a chip using the MassARRAY system from Agena Bioscience and detected by time-of-flight mass spectrometry.

[0057] Figure 3-Figure 5 The test results of the present invention on three samples are shown. Figure 3 This is a fully wild-type sample. It can be seen that there is an obvious wild-type extension peak (C) in the results, but no mutant extension peak (T); Figure 4 For a sample with a known 0.1% mutation rate, it can be seen that in addition to the wild-type extension peak, the mutant extension peak can also be seen in the results; Figure 5 This is a known 1% mutation sample, and it can be seen that there is an obvious mutation extension peak in the results.

[0058] Example 1 solves the problem that the prior art cannot quickly, efficiently, and simply detect trace mutation sites. The principle of solving this problem is that in an amplification system where both wild template and mutant template exist, the blocking probe can completely match the wild template, so that the upstream amplification primer cannot completely bind to the wild template. At the same time, although the 3' end of the blocking probe binds to the wild template, it cannot be extended because the 3' end is phosphorylated or has an unmatched "AAAA" sequence. Therefore, the amplification of the wild template in the system is inhibited. Figure 1 .

[0059] However, because the mutant template in the system cannot completely match the blocking probe, under certain temperature conditions, the upstream primer binds to the mutant template before the blocking probe, and the blocking probe cannot block the amplification of the upstream primer. Therefore, the amplification of the mutant template in the system is not inhibited. Figure 2 Therefore, under the effect of enriching mutant template amplification and blocking wild template amplification, even if there is only a trace amount of mutant template in the initial system, it can still be detected.

[0060] Example 2: Semi-quantitative detection of the S>L mutation ratio at position 531 of the rpoB gene of Mycobacterium tuberculosis.

[0061] On the basis of Example 1, an upstream amplification primer SEQ ID NO.6 and a blocking probe SEQ ID NO.7 were additionally designed.

[0062] Based on step 1-1, multiple sets of amplification primers, multiple sets of blocking probes, and extension primers are designed for the target gene. Based on step 1-3, the multiple sets of amplification primers and multiple sets of blocking probes are combined into 4 different combinations, and added into nucleic acid amplification systems respectively, and the same test DNA is divided into 4 different systems for nucleic acid amplification.

[0063] When preparing the amplification reaction system, it is divided into 4 amplification wells with different combinations. Amplification well 1: upstream primer SEQ ID NO.2 (10uM) 0.4ul, downstream primer SEQ ID NO.3 (10uM) 0.4ul, blocking probe SEQ ID NO.4 (10uM) 2ul, other component categories and dosages are the same as in Example 1. Amplification well 2: upstream primer SEQ ID NO.2 (10uM) 0.4ul, downstream primer SEQ ID NO.3 (10uM) 0.4ul, blocking probe SEQ ID NO.4 (10uM) 0.8ul, other component categories and dosages are the same as in Example 1. Amplification well 3: upstream primer SEQ ID NO.2 (10uM) 0.4ul, downstream primer SEQ ID NO.3 (10uM) 0.4ul, blocking probe SEQ ID NO.7 (10uM) 1ul, other component categories and dosages are the same as in Example 1. Amplification well 4: upstream primer SEQ ID NO.6 (10 uM) 0.4 ul, downstream primer SEQ ID NO.3 (10 uM) 0.4 ul, blocking probe SEQ ID NO.4 (10 uM) 0.5 ul, other component types and amounts are the same as in Example 1.

[0064] The subsequent digestion reaction, extension reaction and time-of-flight mass spectrometry detection process are the same as in Example 1.

[0065] like Figure 6-9 Shown is a schematic diagram of the test results of a sample with a known mutation ratio of about 3% in the present invention. Figure 6 This is the result of well 1, where a clear mutation extension peak (T) can be seen; Figure 7 This is the result of well 2, where a clear mutation extension peak (T) can be seen; Figure 8 The result of well 3 shows the mutant extension peak (T) and the wild-type extension peak (C). Fig. 9 The result of well 4 shows only the wild extension peak (C). That is, the results of the four wells are "+++-". According to the interpretation criteria in Table 1, the semi-quantitative mutation ratio of the sample is greater than 1% and less than 5%, which is consistent with the known results.

[0066] Table 1 Semi-quantitative mutation ratio determination table

[0067]

[0068] Example 2 solves the problem that the existing technology cannot semi-quantitatively detect the proportion of mutation sites in samples. Based on the principle of Example 1, by using different combinations of amplification primers and blocking probes, different blocking effects on wild templates in samples can be achieved, so that samples with different mutation ratios can be judged as negative or positive for mutations. After system optimization testing using templates with quantitatively prepared different mutation ratios, the threshold for detecting mutation positives in amplification well 1 is about 0.1%; the threshold for detecting mutation positives in amplification well 2 is about 0.5%; the threshold for detecting mutation positives in amplification well 3 is about 1%; the threshold for detecting mutation positives in amplification well 4 is about 5%. That is, as shown in Table 1, the same sample can semi-quantitatively determine the mutation ratio in the sample through the negative and positive detection results of the four wells.

[0069] The sequence information in the present invention is as follows:

[0070] SEQ ID NO.1: aaccagatccgggtcggcatgtcgcggatggagcgggtggtccgggagcggatgaccacccaggacgtggaggcgatcacaccgcagacgttgatcaacatccggccggtggtcgc cgcgatcaaggagttcttcggcaccagccagctgagccaattcatggaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctggggcccggcggtctgtcacgt gagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccctgaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcggg tcaacccgttcgggttcatcgaaacgccgtaccgcaaggtggtcgacggcgtggttagcgacgagatcgtgtacctgaccgccgacgaggaggaccgccacgtggtggcacaggccaattcg

[0071] SEQ ID NO.2: acccacaagcgccgact

[0072] SEQ ID NO.3: cgtacaccgacagcgagc

[0073] SEQ ID NO.4: cgactgtcggcgctggg-p

[0074] SEQ ID NO.5: acaagcgccgactgt

[0075] SEQ ID NO.6: gttgacccacaagcgcc

[0076] SEQ ID NO.7: cgactgtcggcActgggg-p

[0077] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope limited by the appended claims of the application.

Claims

1. A method for early warning of drug-resistant tuberculosis by semi-quantitative detection of heterogeneous drug resistance. Features The steps are: 1-1: Design amplification primers, blocking probes, and extension primers for the target gene; 1-2: Extract the DNA of the object to be tested; 1-3: adding the amplification primers and the blocking probe to a nucleic acid amplification system to perform nucleic acid amplification on the DNA to be tested; 1-4: Digest the amplified product with shrimp alkaline phosphatase (SAP); 1-5: adding the extension primer to the system after SAP digestion to perform single base extension; 1-6: After the extension product is desalted on the resin, it is detected using matrix-assisted laser desorption ionization-time of flight mass spectrometry; The timing of steps 1-1 and 1-2 may be reversed.

2. The early warning method according to claim 1, Features The amplification primers include an upstream amplification primer and a downstream amplification primer. The 3' end of the upstream amplification primer overlaps with the 5' end of the blocking probe by 1 to 6 bases. The blocking probe is completely consistent with the wild-type gene sequence.

3. The early warning method according to claim 1 or 2, Features The base sequence of the target gene in step 1-1 of the present invention is shown in SEQ ID NO.1, the amplification primer sequences are shown in SEQ ID NO.2 and NO.3, the blocking probe sequence is shown in SEQ ID NO.4, and the extension primer sequence is shown in SEQ ID NO.

5.

4. The early warning method according to claim 3, Features The 3' end of the blocking probe is phosphorylated or added with an "AAAA" base; the 3' end of the extension primer is the base before the mutation site.

5. The early warning method according to claim 1, Features The concentration of the amplification primer is 0.1-1uM; the concentration of the blocking probe is 0.5-2uM; and the annealing temperature is 58-68°C.

6. The early warning method according to claim 1, Features In step 1-1, multiple sets of amplification primers, multiple sets of blocking probes, and extension primers are designed for the target gene. In step 1-3, the multiple sets of amplification primers and multiple sets of blocking probes are combined into 4 different combinations and added into nucleic acid amplification systems respectively, and the same test DNA is divided into 4 different systems for nucleic acid amplification.

7. The early warning method according to claim 6, Features The concentration of the amplification primer is 0.1-1uM; the concentration of the blocking probe is 0-2uM; and the annealing temperature is 58-68°C.

8. The early warning method according to claim 7, Features The sequences of the multiple sets of amplification primers are shown in SEQ ID NO. 2, 3 or 6; the sequences of the multiple sets of blocking probes are shown in SEQ ID NO. 4 or 7; and the sequence of the extension primers is shown in SEQ ID NO.

5.

9. The early warning method according to claim 8, Features Amplification well 1 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.2 (0.1~1uM), SEQ ID NO.3 (0.1~1uM), SEQ ID NO.4 (0.1~1uM); amplification well 2 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.2 (0.1~1uM), SEQ ID NO.3 (0.1~1uM), SEQ ID NO.4 (0.1~0.5uM); amplification well 3 uses amplification primers, blocking probe combinations and dosages: SEQID NO.2 (0.1~1uM), SEQ ID NO.3 (0.1~1uM), SEQ ID NO.7 (0.05~0.5uM); amplification well 4 uses amplification primers, blocking probe combinations and dosages: SEQ ID NO.6 (0.1~1uM), SEQ ID NO.3 (0.1~1uM), SEQID NO.4 (0~0.5uM).

10. A kit, Features The invention comprises an amplification primer, a blocking probe, an extension primer, an amplification reaction solution, a digestion reaction solution, an extension reaction solution, a resin and a chip. The sequences of the amplification primers are shown in SEQ ID NO.2 and NO.3, the sequence of the blocking probe is shown in SEQ ID NO.4, and the sequence of the extension primer is shown in SEQ ID NO.

5. The chip is dotted with pre-placed matrix spots, which can dilute and separate products, and finally bring the analyte into the gas phase after laser irradiation in the mass spectrometer.

Images