GBS detection composition, system and method based on one-pot MIRA amplification CRISPR cutting

Abstract

The invention discloses a GBS detection composition, system and method based on one-pot method MIRA amplification CRISPR cutting. The composition comprises an MIRA amplification reaction system, a GBS amplification primer, an LbCas12a enzyme, crRNA for recognizing a last superior PAM sequence of a GBS nucleic acid target sequence, and an ssDNA reporter. According to the invention, nucleic acid extraction-free MIRA isothermal amplification and CRISPR-Cas12a cleavage reaction are combined, the two systems are integrated into one reaction tube, the kit can be used for rapid and accurate GBS detection, the detection sensitivity can reach 3.2 copies / [mu] L, the whole detection process can be completed at a constant temperature of 39 DEG C, the detection operation is portable and efficient, the detection result can be obtained in a short time, and the kit has high specificity. The method has high application value, can detect clinical samples, and can become a novel technology for detecting GBS infection of pregnant women in the perinatal period.

Description

Technical Field

[0001] The present invention relates to the field of biological diagnosis technology, and in particular to a GBS detection composition, system and method based on one-pot MIRA amplification and CRISPR cleavage. Background Art

[0002] Group B streptococcus (GBS) is a Gram-positive coccus that colonizes the human reproductive tract and gastrointestinal tract. Some of them colonize the upper respiratory tract of children and adults, posing a threat to the health of pregnant women and newborns. Over the years, a large number of studies have shown that GBS infection is the main risk factor for early neonatal infection. About 50% of GBS-positive pregnant women will transmit the infection to their newborns. Among these cases, 1%-2% will cause early-onset GBS infection in neonates, which is typically manifested as sepsis, pneumonia and meningitis, which seriously threatens their lives, with a mortality rate of up to 5%. Therefore, before delivery, perinatal pregnant women need to be screened for group B streptococci, and targeted prevention and treatment measures should be provided to pregnant women based on the screening results, so as to minimize the incidence of premature rupture of membranes, premature birth and perinatal death, thereby minimizing the harm of reproductive tract infection to mothers and infants and improving the quality of life of mothers and infants.

[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein systems (CRISPR / Cas) provide new opportunities for sensitive and specific molecular detection of pathogens. In the CRISPR family, Cas12a has the ability to recognize and cis-cut specific nucleic acid sequences using customized CRISPR RNA (crRNA) programming. After recognizing the sequence, Cas12a exhibits nonspecific side chain cleavage (trans-cleavage) activity to cut surrounding single-stranded DNA (ssDNA). This unique property can be used for the detection of amplified nucleic acids. In recent years, a variety of CRISPR-based nucleic acid detection platforms with high sensitivity, specificity and accuracy have been developed in combination with Cas enzymes.

[0004] The usual gene detection technology process includes nucleic acid extraction and amplification, followed by detection of the amplified products. Common technologies include fluorescent quantitative PCR, loop-mediated isothermal amplification (LAMP), etc., which have high sensitivity and satisfactory accuracy. However, the reliance of PCR-based detection technology on expensive equipment and highly specialized personnel has hindered the detection of GBS in a wider range of scenarios such as primary health clinics, and it is difficult to achieve simple, rapid, and immediate POC molecular diagnosis. Isothermal amplification technology represented by LAMP is subject to the principle of nucleic acid amplification and is prone to false positives, which hinders its further application. Combining isothermal amplification technology with CRISPR detection technology can achieve high sensitivity and high specificity at the same time without the need for too many equipment and processes. However, there is a certain degree of mutual exclusivity between nucleic acid amplification and CRISPR cleavage reaction, so amplification is required before CRISPR detection, and solution transfer and reaction tube opening are required, which can easily cause environmental aerosol contamination and secondary contamination of reagents. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a GBS detection composition, system and method based on one-pot MIRA amplification and CRISPR cleavage in view of the deficiencies in the above-mentioned prior art. The present invention uses crRNA that can recognize suboptimal PAM sequences in the CRISPR system instead of crRNA that can recognize classical PAM sequences, combines MIRA isothermal amplification with CRISPR in one tube, and does not require nucleic acid washing, elution and other steps. The lysed sample is directly added to the system to start the reaction. Only heating is required, and no complex procedures such as solution transfer and equipment operation are required to complete GBS detection with high efficiency, high sensitivity and high specificity.

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] In a first aspect of the present invention, a GBS detection composition based on one-pot MIRA amplification CRISPR cleavage is provided, comprising: a MIRA amplification reaction system, a GBS amplification primer, an LbCas12a enzyme, a crRNA that recognizes a suboptimal PAM sequence on a GBS nucleic acid target sequence, and a ssDNA reporter.

[0008] Preferably, the total volume of the GBS detection composition is 30-200 μL, and the amount of sample added is 5-10% of the total volume of the system.

[0009] Preferably, the MIRA amplification reaction system comprises: 200-300 ng / μL recombinase, 200-300 ng / μL recombinase cofactor, 600-800 ng / μL single-stranded DNA binding protein, 100-200 ng / μL DNA polymerase, 200-400 ng / μL creatine kinase, 30-50 mM Tris-HCl and 20-100 mM potassium acetate, 20-100 mM magnesium acetate, 20-100 mM creatine phosphate, 1-6 mM tris(2-carbonylethyl)phosphohydrochloride, 200-400 μM dNTPs, 1-4 mM ATP, 8%-10% w / v polyethylene glycol 10000 and 1-4% w / v polyvinyl pyrrolidone.

[0010] Preferably, the GBS amplification primer is used to amplify the target sequence in the GBS cAMP gene, and the target sequence is based on the sequence of SEQ ID NO.1:

[0011] TGCCAACCCTGAGACAGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGATGTGATTGAAGCAATCACTTTTTCAACTCAACATTTAACAAATAAGGTTAGTCAAGCAAATATTGATATGGGA TTTGGGATAACTAAGCTAGTTATTCGCATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAACGATGTAAAGGCATTAGAACAAAAAGTTTTAACTTATCCTGATTTAAAACCAACTGATAGAG;

[0012] GBS amplification primers include GBS upstream primer and GBS downstream primer;

[0013] The GBS upstream primer sequence is SEQ ID NO.2:

[0014] TGCCAACCCTGAGACAGTTTATGATTTGAA;

[0015] The GBS downstream primer sequence is SEQ ID NO.3:

[0016] CTCTATCAGTTGGTTTTAAATCAGGATAAG.

[0017] Preferably, the concentration of GBS upstream primer and GBS downstream primer is 0.2-0.5 μM each.

[0018] Preferably, the PAM sequence is SEQ ID NO.4: CTTA; this PAM sequence has a lower efficiency than the traditional PAM sequence (TTTN), which is conducive to simultaneous MIRA amplification and CRISPR cutting.

[0019] The crRNA sequence is SEQ ID NO.5:

[0020] UAAUUUCUACUAAGUGUAGAUACAGAUGUGAUUGAAGCAAU.

[0021] Preferably, the crRNA concentration is 50-200 nM, and the crRNA to LbCas12a enzyme concentration ratio is 1:1.

[0022] Preferably, the sequence of the ssDNA reporter is SEQ ID NO. 5: TTATT; the 5' end of the ssDNA reporter is labeled with a fluorescent dye FAM, and the 3' end is labeled with a BHQ1 or Biotin.

[0023] In a second aspect, the present invention provides a GBS detection system based on one-pot MIRA amplification and CRISPR cleavage, the system comprising the GBS detection composition as described above and a fluorescence detection device, wherein the fluorescence detection device determines whether GBS exists by detecting the fluorescence intensity of the reaction product, wherein the 5' end of the ssDNA reporter is labeled with a fluorescent FAM and the 3' end is labeled with a BHQ1.

[0024] Preferably, the fluorescence detection device can be a real-time fluorescence detector or an endpoint fluorescence intensity detection device.

[0025] The third aspect of the present invention provides a detection method of the system provided by the second aspect of the present invention, comprising the following steps:

[0026] S1. Mixing the sample to be tested with the nucleic acid releasing agent to prepare a sample solution;

[0027] S2. adding the sample solution to the GBS detection composition according to any one of claims 1 to 6, wherein the amount of the sample solution added is 5-10% of the total volume of the GBS detection composition;

[0028] S3, constant temperature amplification, after the reaction is completed, the reaction product solution is subjected to fluorescence detection by a fluorescence detection device to determine whether the sample to be tested contains GBS. For example, when a real-time fluorescence detector is used for detection, if an "S"-shaped fluorescence curve appears at the end, it means that the test sample is positive, and if an "S"-shaped fluorescence curve does not appear, it means that the test sample is negative.

[0029] Preferably, the main components of the nucleic acid releaser are 60-100mM Tris-HCl, 50-100mM EDTA, 1%-4% Tween, 1-2mM guanidine hydrochloride, 1-2mM guanidine isothiocyanate, 0.5-2M NaCl, 2%-4% sodium dodecyl sulfate, 2-4% sodium dodecyl sarcosine, and water, and the lysate volume is 200-800μL.

[0030] In a fourth aspect of the present invention, another GBS detection system based on one-pot MIRA amplification and CRISPR cleavage is provided, the system comprising the GBS detection composition as described above and a nucleic acid test strip capable of detecting CRISPR cleavage products, the quality control line (C line) of the nucleic acid test strip being marked with streptavidin, the detection line (T line) being marked with anti-mouse antibodies, and the sample pad being loaded with colloidal gold labeled with anti-FAM antibodies;

[0031] The 5' end of the ssDNA reporter is labeled with a fluorescent marker FAM, and the 3' end is labeled with a biotin.

[0032] A fifth aspect of the present invention provides a detection method of the system provided by the fourth aspect of the present invention, comprising the following steps:

[0033] S1. Mixing the sample to be tested with the nucleic acid releasing agent to prepare a sample solution;

[0034] S2. adding the sample solution to the GBS detection composition according to any one of claims 1 to 6, wherein the amount of the sample solution added is 5-10% of the total volume of the GBS detection composition;

[0035] S3. Constant temperature amplification. After the reaction is completed, take the reaction product, dilute it and drop it onto the sample pad of the nucleic acid test strip. Observe the colors of the quality control line and the test line to determine whether the sample to be tested contains GBS: if the quality control line is colored and the test line is not colored, it means that there is no GBS in the sample to be tested; if both the quality control line and the test line are colored, or the test line is colored and the quality control line is not colored, it means that the sample to be tested contains GBS; if both the quality control line and the test line are not colored, it means that the test result is wrong and needs to be retested.

[0036] When testing the product, the one-step MIRA amplification / CRISPR cleavage system product is diluted 10-20 times and transferred to the sample pad of the test strip. The reporter (FAM-TTATT-Biotin) in the negative sample binds to the gold-labeled anti-FAM on the binding pad and then chromatographs forward, and is captured by streptavidin at the C line, so that the C line is colored; in the positive sample, there is a cleaved reporter, in which the FAM-broken chain binds to the gold-labeled anti-FAM antibody and then chromatographs forward and is captured by the anti-mouse antibody at the T line, so that the T line is colored, and the reporter that has not been cleaved binds to the gold-labeled anti-FAM and is captured at the C line.

[0037] The beneficial effects of the present invention are:

[0038] The present invention provides a GBS detection composition based on one-pot MIRA amplification CRISPR cleavage, a detection system based on the composition, and a detection method. The present invention combines the nucleic acid extraction-free MIRA isothermal amplification system and the CRISPR-Cas12a cleavage reaction system, and integrates the two systems into one reaction tube, including Cas12a enzyme, crRNA for recognizing suboptimal PAM sequence, ssDNA reporter, MIRA isothermal amplification reagent and reaction enzyme, amplification primer, etc., which can be used for simple, rapid and accurate GBS detection. Its detection sensitivity can reach 3.2 copies / μL, and the entire detection process can be completed under a constant temperature of 39°C. The detection operation is portable and efficient, and the test results can be obtained in a short time, and it has high specificity.

[0039] The present invention does not require steps such as nucleic acid washing and elution. The lysed sample can be directly added to the system to start the reaction. It only needs heating, and no complex processes such as solution transfer and equipment operation are required to complete the efficient, highly sensitive and highly specific detection of GBS. The present invention has a high application value, can detect clinical samples, and can become a new technology for detecting GBS infection in perinatal pregnant women. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The sensitivity test result of the fluorescence method in Example 5 is shown in FIG.

[0041] Figure 2 The sensitivity test results of the test strip method in Example 5 are as follows;

[0042] Figure 3 The specific detection result of the fluorescence method in Example 6;

[0043] Figure 4 is the specific detection result of the test strip method in Example 6;

[0044] Figure 5 The sample test results of the fluorescence method in Example 7;

[0045] Figure 6 This is the sample test result of the test strip method in Example 7. DETAILED DESCRIPTION

[0046] The present invention is further described in detail below in conjunction with embodiments so that those skilled in the art can implement the invention with reference to the description.

[0047] It should be understood that terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0048] The test methods used in the following examples are conventional methods unless otherwise specified. The materials and reagents used in the following examples are all commercially available unless otherwise specified. In the following examples, if no specific conditions are specified, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0049] Example 1

[0050] A GBS detection system based on one-pot MIRA amplification CRISPR cleavage comprises: a GBS detection composition and a real-time fluorescence detector, and is equipped with a nucleic acid releaser.

[0051] The GBS detection composition includes: a MIRA amplification reaction system, a GBS amplification primer, an LbCas12a enzyme, a crRNA that recognizes the suboptimal PAM sequence on the GBS nucleic acid target sequence, and a ssDNA reporter.

[0052] MIRA amplification reaction reagents may preferably include: 300 ng / μL recombinase, 300 ng / μL recombinase cofactor, 750 ng / μL single-stranded DNA binding protein, 150 ng / μL DNA polymerase, 250 ng / μL creatine kinase, 40 mM Tris-HCl and 75 mM potassium acetate, 75 mM magnesium acetate, 75 mM creatine phosphate, 3 mM tris (2-carbonylethyl) phosphate hydrochloride, 300 μM dNTPs, 3 mM ATP, 8% w / v polyethylene glycol 10000 and 3% w / v polyvinyl pyrrolidone.

[0053] The total volume of the GBS detection composition is 50 μL, and the amount of sample added is 5 μL.

[0054] GBS amplification primers are used to amplify the target sequence in the GBS cAMP gene. The target sequence is based on the sequence of SEQ ID NO.1:

[0055] TGCCAACCCTGAGACAGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGATGTGATTGAAGCAATCACTTTTTCAACTCAACATTTAACAAATAAGGTTAGTCAAGCAAATATTGATATGGGA TTTGGGATAACTAAGCTAGTTATTCGCATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAACGATGTAAAGGCATTAGAACAAAAAGTTTTAACTTATCCTGATTTAAAACCAACTGATAGAG.

[0056] GBS amplification primers include GBS upstream primer and GBS downstream primer; GBS upstream primer and GBS downstream primer are 0.4 μM each.

[0057] The GBS upstream primer sequence is SEQ ID NO.2:

[0058] TGCCAACCCTGAGACAGTTTATGATTTGAA;

[0059] The GBS downstream primer sequence is SEQ ID NO.3:

[0060] CTCTATCAGTTGGTTTTAAATCAGGATAAG.

[0061] The PAM sequence is SEQ ID NO.4: CTTA; this PAM sequence has lower efficiency than the traditional PAM sequence (TTTN), which is conducive to simultaneous MIRA amplification and CRISPR cutting.

[0062] The crRNA sequence is SEQ ID NO.5:

[0063] UAAUUUCUACUAAGUGUAGAUACAGAUGUGAUUGAAGCAAU.

[0064] The crRNA concentration was 100 nM, and the crRNA to LbCas12a enzyme concentration ratio was 1:1.

[0065] The sequence of the ssDNA reporter is SEQ ID NO. 5: TTATT; the 5' end of the ssDNA reporter is labeled with a fluorescent marker FAM, and the 3' end is labeled with a BHQ1.

[0066] The temperature of the isothermal amplification reaction was set at 39°C, the time was set at 30 minutes, and the fluorescence signal was collected every 90 seconds. The appearance of an "S"-shaped fluorescence curve at the end indicated that the test sample was positive, and the absence of a fluorescence curve indicated that the test sample was negative.

[0067] The nucleic acid release agent includes 100 mM Tris-HCl, 50 mM EDTA, 5% Tween, 0.5 mM guanidine hydrochloride, 1 mM guanidine isothiocyanate, 0.5 M NaCl, 2% sodium dodecyl sulfate, 2% sodium dodecyl sarcosine, and water, and the lysate volume is 500 μL.

[0068] Example 2

[0069] The difference between this example and Example 1 is that:

[0070] A nucleic acid test strip is used instead of a real-time fluorescence detector to detect the product, and the result is visually judged; and in this example, the 5' end of the ssDNA reporter is labeled with a fluorescent FAM and the 3' end is labeled with a Biotin.

[0071] The temperature of the isothermal amplification reaction was set to 39°C and the time was set to 30 min. After the reaction was completed, the reaction product was diluted 10 times with clean water and 80 μL was transferred to the sample pad of the test strip. The results were observed within ten minutes. If the C line of the test strip was colored and the T line was not colored, it indicated that the sample was a negative sample; if both the C line and the T line of the test strip were colored or the T line was colored and the C line was not colored, it indicated that the sample was a positive sample; if both the C and T lines of the test strip were not colored, it indicated that there was a problem with the experimental process, the result was unreliable, and retesting was required.

[0072] Example 3 (Fluorescence method)

[0073] This embodiment provides a GBS detection method based on the detection system of Embodiment 1, and the specific steps are as follows:

[0074] 1. Sampling: With the help of the sampling aid, use a sampling swab to scrape vaginal secretions, use a one-step nucleic acid releaser to elute the vaginal secretions on the sampling swab and release nucleic acids, and save the solution as a sample. Optionally, the vaginal secretions can be eluted in a cell preservation solution and stored, and when testing is required, the cell preservation solution is mixed with the nucleic acid releaser in a 1:1 ratio as a sample solution.

[0075] 2. Test: Take 5 μL of the sample solution and add it to the GBS detection composition (50 μL) and mix well. Put it into the real-time fluorescence detector, set the temperature to 39°C, set the time to 30 min, collect fluorescence every 90 seconds, and judge the positive or negative of the sample by observing the fluorescence curve after the reaction is completed.

[0076] 3. Result judgment: If an "S"-shaped fluorescence curve is displayed on the real-time fluorescence detector, it means that the test sample is positive. If no fluorescence curve appears, it means that the test sample is negative.

[0077] Embodiment 4 (test strip method)

[0078] This embodiment provides a GBS detection method based on the detection system of Embodiment 2, and the specific steps are as follows:

[0079] 1. Sampling: With the help of the sampling aid, use a sampling swab to scrape vaginal secretions, use a one-step nucleic acid releaser to elute the vaginal secretions on the sampling swab and release nucleic acids, and save the solution as a sample. Optionally, the vaginal secretions can be eluted in a cell preservation solution and stored, and when testing is required, the cell preservation solution is mixed with the nucleic acid releaser in a 1:1 ratio as a sample solution.

[0080] 2. Test: Take 5 μL of the sample solution and add it to the GBS detection composition (50 μL) and mix well. Put it into a constant temperature heating device, set the temperature to 39°C, and set the time to 30 min. After the reaction is completed, take 10 μL of the reaction solution and mix it with 90 μL of pure water and transfer it to the sample pad of the test strip. The positive and negative of the sample can be judged by observing the color of the T line and C line on the test strip at 10 minutes.

[0081] 3. Result judgment: Observe the result within ten minutes. If the C line of the test strip is colored and the T line is not colored, it means that the sample is a negative sample; if the C line and T line of the test strip are colored or the T line is colored and the C line is not colored, it means that the sample is a positive sample; if both the C line and the T line of the test strip are not colored, it means that there is a problem in the experimental process and the result is unreliable.

[0082] Example 5

[0083] In order to improve the sensitivity of the detection system, in this example, a GBS nucleic acid standard diluted tenfold was used as a sample, with a copy number ranging from 0.32 copies to 32000 copies, and the detection method in Example 3 and Example 4 was used for detection. The detection results are shown in the attached Figure 1 As shown, using the real-time fluorescence detection system, the detection limit can reach 3.2 copies (0.64 copies / μL), and using the nucleic acid test strip detection system, the GBS detection limit can reach 32 copies (6.4 copies / μL). Figure 2 shown.

[0084] Example 6

[0085] In order to verify the specificity of the system, group B Streptococcus, Pseudomonas aeruginosa, Escherichia coli, Staphylococcus epidermidis, Staphylococcus aureus, Acinetobacter parvum, and Bacillus subtilis nucleic acid standard substances were used as samples (same concentration) in this example, and the specificity was verified by the fluorescence detection system and the test strip detection system according to the detection methods in Example 3 and Example 4, respectively. The results are shown in the attached Figure 3 and Figure 4 As shown, only GBS nucleic acid can be detected, demonstrating the good specificity of the system.

[0086] Example 7

[0087] In this example, real clinical samples were used, including 8 GBS positive samples and 12 GBS negative samples. The sample information is shown in Table 1. The detection methods in Examples 3 and 4 were used for detection. The detection results are shown in the attached table. Figure 5 , Attachment Figure 6 As shown, in the detection of these 20 clinical samples, the detection accuracy of both the fluorescence detection system and the test strip detection system reached 100%.

[0088] Table 1

[0089]

[0090]

[0091] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes. They can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to specific details.

Claims

1. A GBS detection composition based on one-pot MIRA amplification and CRISPR cleavage, characterized in that: include: MIRA amplification reaction system, GBS amplification primers, LbCas12a enzyme, crRNA that recognizes the suboptimal PAM sequence on the GBS nucleic acid target sequence, and ssDNA reporter.

2. The GBS detection composition based on one-pot MIRA amplification and CRISPR cleavage according to claim 1, characterized in that: The MIRA amplification reaction system includes: 200-300 ng / μL recombinase, 200-300 ng / μL recombinase cofactor, 600-800 ng / μL single-stranded DNA binding protein, 100-200 ng / μL DNA polymerase, 200-400 ng / μL creatine kinase, 30-50 mM Tris-HCl and 20-100 mM potassium acetate, 20-100 mM magnesium acetate, 20-100 mM creatine phosphate, 1-6 mM tris (2-carbonylethyl) phosphate hydrochloride, 200-400 μM dNTPs, 1-4 mM ATP, 8%-10% w / v polyethylene glycol 10000 and 1-4% w / v polyvinyl pyrrolidone.

3. The GBS detection composition based on one-pot MIRA amplification and CRISPR cleavage according to claim 1, characterized in that: The GBS amplification primers are used to amplify the target sequence in the GBS cAMP gene, and the target sequence is based on the sequence of SEQ ID NO.1: TGCCAACCCTGAGACAGTTTATGATTTGAATTCTATTGGTAGTCGTGTAGAAGCCTTAACAGATGTGATTGAAGCAATCACTTTTTCAACTCAACATTTAACAAATAAGGTTAGTCAAGCAAATATTGATATGGGA TTTGGGATAACTAAGCTAGTTATTCGCATTTTAGATCCATTTGCTTCAGTTGATTCAATTAAAGCTCAAGTTAACGATGTAAAGGCATTAGAACAAAAAGTTTTAACTTATCCTGATTTAAAACCAACTGATAGAG; GBS amplification primers include GBS upstream primer and GBS downstream primer; The GBS upstream primer sequence is SEQ ID NO.2: TGCCAACCCTGAGACAGTTTATGATTTGAA; The GBS downstream primer sequence is SEQ ID NO.3: CTCTATCAGTTGGTTTTAAATCAGGATAAG.

4. The GBS detection composition based on one-pot MIRA amplification and CRISPR cleavage according to claim 3, characterized in that: The PAM sequence is SEQ ID NO. 4: CTTA; The crRNA sequence is SEQ ID NO.5: UAAUUUCUACUAAGUGUAGAUACAGAUGUGAUUGAAGCAAU.

5. The GBS detection composition based on one-pot MIRA amplification and CRISPR cleavage according to claim 4, characterized in that: The crRNA concentration was 50-200 nM, and the crRNA to LbCas12a enzyme concentration ratio was 1:

1.

6. The GBS detection composition based on one-pot MIRA amplification and CRISPR cleavage according to claim 5, characterized in that: The sequence of the ssDNA reporter is SEQ ID NO. 5: TTATT; the 5' end of the ssDNA reporter is labeled with a fluorescent dye FAM, and the 3' end is labeled with a BHQ1 or Biotin.

7. A GBS detection system based on one-pot MIRA amplification and CRISPR cleavage, characterized in that: The system comprises the GBS detection composition as claimed in any one of claims 1 to 6 and a fluorescence detection device, wherein the fluorescence detection device determines whether GBS exists by detecting the fluorescence intensity of the reaction product, wherein the 5' end of the ssDNA reporter is labeled with a fluorescent FAM and the 3' end is labeled with a BHQ1.

8. A detection method of the system as claimed in claim 7, characterized in that: The following steps are involved: S1. Mixing the sample to be tested with the nucleic acid releasing agent to prepare a sample solution; S2. adding the sample solution to the GBS detection composition according to any one of claims 1 to 6, wherein the amount of the sample solution added is 5-10% of the total volume of the GBS detection composition; S3. Constant temperature amplification. After the reaction is completed, a fluorescence detection device is used to perform fluorescence detection on the reaction product solution to determine whether the sample to be tested contains GBS.

9. A GBS detection system based on one-pot MIRA amplification and CRISPR cleavage, characterized in that: The system comprises the GBS detection composition as claimed in any one of claims 1 to 6 and a nucleic acid test strip capable of detecting CRISPR cleavage products, wherein the quality control line of the nucleic acid test strip is marked with streptavidin, the detection line is marked with anti-mouse antibody, and the sample pad is loaded with colloidal gold labeled with anti-FAM antibody; The 5' end of the ssDNA reporter is labeled with a fluorescent marker FAM, and the 3' end is labeled with a biotin.

10. A detection method of the system according to claim 9, characterized in that: The following steps are involved: S1. Mixing the sample to be tested with the nucleic acid releasing agent to prepare a sample solution; S2. adding the sample solution to the GBS detection composition according to any one of claims 1 to 6, wherein the amount of the sample solution added is 5-10% of the total volume of the GBS detection composition; S3. Constant temperature amplification. After the reaction is completed, take the reaction product, dilute it and drop it onto the sample pad of the nucleic acid test strip. Observe the colors of the quality control line and the test line to determine whether the sample to be tested contains GBS: if the quality control line is colored and the test line is not colored, it means that there is no GBS in the sample to be tested; if both the quality control line and the test line are colored, or the test line is colored and the quality control line is not colored, it means that the sample to be tested contains GBS; if both the quality control line and the test line are not colored, it means that the test result is wrong and needs to be retested.

Images