Bovine viral diarrhea virus loop-mediated isothermal amplification primer group and application thereof

Abstract

The invention provides a bovine viral diarrhea virus loop-mediated isothermal amplification primer group and application thereof, and relates to the technical field of biological detection, and the bovine viral diarrhea virus loop-mediated isothermal amplification primer group comprises an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB. The specificity and the detection comprehensiveness of the kit on bovine viral diarrhea virus gene amplification are ensured; the primer group can realize rapid detection of the bovine viral diarrhea virus loop-mediated isothermal amplification primer group, the detection sensitivity is higher than that of common PCR, and the result is judged through an amplification curve and a Tt value. And judging the result through a product fluorescence reaction according to conditions. The formed kit has the advantages of simplicity in operation, high specificity, no need of special equipment, low cost and easiness in result judgment, and is suitable for on-site rapid detection, clinical diagnosis of grassroots veterinarians or monitoring of epidemic diseases. The technical problem that in the prior art, the LAMP technology is lacked for rapidly and accurately detecting or identifying the bovine viral diarrhea virus is solved.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a bovine viral diarrhea virus loop-mediated isothermal amplification primer set and an application thereof. Background Art

[0002] Bovine viral diarrhea (BVD) is an infectious disease caused by bovine viral diarrhea virus (BVDV) that is widely distributed throughout the world and has caused huge economic losses to the breeding industry. BVDV is an "important pathogen" that seriously affects the cattle industry worldwide. This virus not only causes direct economic losses, such as productivity loss and increased treatment costs caused by clinical symptoms, but also causes indirect economic pressures, such as reduced production due to isolation of sick individuals. According to statistics, the economic losses caused by BVD in the United States are estimated to be as high as 67.5 million US dollars each year. This disease not only leads to increased animal mortality, but also affects growth performance and production efficiency, causing huge economic losses. BVDV belongs to the genus Pestivirus of the Flaviviridae family, which can be transmitted through various routes such as direct contact, semen, milk or placenta. After infection, it can cause a wide range of clinical symptoms including fever, digestive tract disorders and even reproductive disorders. A survey of pastures in Europe showed that BVD accounted for 5-6% of recorded animal epidemics ( 2009). This shows the prevalence of this virus infection in the global livestock industry. Currently, commonly used detection methods include enzyme-linked immunosorbent assay (ELISA), RT-PCR, etc. Although these methods have high sensitivity and specificity, they usually require expensive equipment and are complex and time-consuming to operate (Gray et al., 2007). With the deepening of understanding of BVD and the development of technology, a technology called LAMP (Loop-mediated isothermal amplification, LAMP) has gradually attracted attention. LAMP is an isothermal nucleic acid amplification technology that can achieve efficient amplification of large fragments of DNA at a specific temperature. Compared with the traditional PCR method, it is simpler to operate and has lower equipment requirements, and has higher flexibility when used on site. Studies in recent years have shown that molecular biological diagnostic methods based on LAMP have been successfully applied to the diagnosis of many important animal diseases. These methods have been proven to be very sensitive and can draw conclusions in a short time. For example, Mukherjee S.K. et al. successfully used LAMP to identify the presence or absence of BVDV RNA in milk samples, and the results showed that this method can effectively replace traditional PCR technology. Zhang Xiaoming and others developed a LAMP detection method for M.bovis and confirmed that it can still maintain good sensitivity and specificity under field conditions. According to Professor Li Hua: Compared with traditional laboratory diagnostic methods that require expensive instruments and long waits for results, LAMP is more suitable for the daily monitoring and early intervention needs of livestock farmers. This can not only control the spread of the virus in a timely manner, but also reduce treatment costs and improve economic benefits. By analyzing existing literature and case studies, it can be seen from the prevalence and etiological characteristics of the disease that for the complex multi-pathogenic disease-bovine viral diarrhea, the use of advanced LAMP technology can effectively improve the detection speed and accuracy, which is conducive to the realization of real-time monitoring and precise prevention and control strategies.

[0003] In view of this, the present invention is proposed. Summary of the invention

[0004] One of the purposes of the present invention is to provide a bovine viral diarrhea virus loop-mediated isothermal amplification primer set to solve the technical problem of the lack of rapid and accurate detection or identification of bovine viral diarrhea virus using LAMP technology in the prior art.

[0005] The second object of the present invention is to provide the use of the above-mentioned bovine viral diarrhea virus loop-mediated isothermal amplification primer set in the preparation of a product for detecting bovine viral diarrhea virus.

[0006] A third object of the present invention is to provide a reagent for detecting bovine viral diarrhea virus.

[0007] A fourth object of the present invention is to provide a kit for detecting bovine viral diarrhea virus.

[0008] In a first aspect, the present invention provides a bovine viral diarrhea virus loop-mediated isothermal amplification primer set, comprising an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB;

[0009] The nucleotide sequence of the outer primer F3 is shown in SEQ ID NO.1; the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO.2; the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO.3; the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO.4; the nucleotide sequence of the loop primer LF is shown in SEQ ID NO.5; the nucleotide sequence of the loop primer LB is shown in SEQ ID NO.6.

[0010] Furthermore, the molar ratio of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB is 1:1:3:3:1:1.

[0011] In a second aspect, the present invention provides use of the above-mentioned bovine viral diarrhea virus loop-mediated isothermal amplification primer set in the preparation of a product for detecting bovine viral diarrhea virus.

[0012] In a third aspect, the present invention provides a reagent for detecting bovine viral diarrhea virus, comprising the primer set described in the aforementioned embodiment.

[0013] Furthermore, the concentrations of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB are independently 5 to 10 μM.

[0014] In a fourth aspect, the present invention provides a kit for detecting bovine viral diarrhea virus, comprising the primer set described in the aforementioned embodiment or the reagent described in the aforementioned embodiment.

[0015] Furthermore, it also includes a reaction solution, a negative control substance, a positive control substance and a DNA polymerase;

[0016] Furthermore, the positive control is a plasmid DNA carrying a cloned bovine viral diarrhea virus target gene;

[0017] Preferably, the negative control is ddH2O.

[0018] Further, the reaction solution includes MgCl2, betaine, buffer and dNTP;

[0019] Preferably, the concentration of MgCl2 is 20-25 mM;

[0020] Preferably, the concentration of betaine is 5 to 10 μM;

[0021] Preferably, the concentration of the dNTP is 5 to 10 mM;

[0022] Preferably, the buffer is 10×Buffer.

[0023] Furthermore, the DNA polymerase includes Bst DNA polymerase or Bst DNA polymerase large fragment.

[0024] The bovine viral diarrhea virus loop-mediated isothermal amplification primer set provided by the present invention selects the bovine viral diarrhea gB gene as a target gene, designs a specific LAMP primer set, and the outer primer F3, the outer primer B3, the inner primer FIP and the inner primer BIP can specifically and completely identify the target gene, thereby ensuring the specificity of bovine viral diarrhea virus gene amplification and the comprehensiveness of detection; at the same time, the amplification efficiency is improved by cooperating with the loop primer; the primer set can realize the rapid detection of the bovine viral diarrhea virus loop-mediated isothermal amplification primer set, and the detection sensitivity is higher than that of ordinary PCR, and the amplification template concentration only needs 10 2 copies or less; using LAMP technology, no special instruments or equipment are required, just put it in a constant temperature environment of 55-65, and the target gene can be efficiently amplified in 30-60 minutes; the amplified product is subjected to PCR reaction, and the positive and negative results are significantly different, and the results are determined by the amplification curve and Tt value. On the other hand, the kit for detecting bovine viral diarrhea virus provided by the present invention can complete the efficient amplification of the target area within 30 minutes using the above-mentioned primer set or the above-mentioned reagent, and the result is determined by the product fluorescence reaction according to the conditions. The kit formed by it has simple operation, high specificity, no need for special equipment, low cost, and easy results. It is suitable for rapid on-site detection, primary veterinary clinical diagnosis or epidemic disease monitoring. It solves the technical problem of the lack of rapid and accurate detection or identification of bovine viral diarrhea virus using LAMP technology in the prior art. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0026] Figure 1 A map showing the location of the gene where the bovine viral diarrhea virus primers provided in Example 1 of the present invention are located;

[0027] Figure 2 The results of amplification reactions of different primer sets for bovine viral diarrhea virus provided in Example 1 of the present invention;

[0028] Figure 3 The results of LAMP reaction of bovine viral diarrhea virus with different Tm values ​​provided in Example 3 of the present invention;

[0029] Figure 4 The results of the LAMP reaction of different Betaine concentrations of bovine viral diarrhea virus provided in Example 3 of the present invention;

[0030] Figure 5 The results of the LAMP reaction of different forward and reverse outer primer concentrations of bovine viral diarrhea virus provided in Example 3 of the present invention;

[0031] Figure 6 The results of the LAMP reaction of different forward and reverse inner primer concentrations of bovine viral diarrhea virus provided in Example 3 of the present invention;

[0032] Figure 7 The results of the LAMP reaction of different forward and reverse loop primer concentrations of bovine viral diarrhea virus provided in Example 3 of the present invention;

[0033] Figure 8 The results of the LAMP reaction of bovine viral diarrhea virus at different Mg2+ concentrations provided in Example 3 of the present invention;

[0034] Fig. 9 The results of the LAMP reaction of different dNTP concentrations of bovine viral diarrhea virus provided in Example 3 of the present invention;

[0035] Fig.10 The results of the LAMP reaction of different concentrations of DNA polymerase of bovine viral diarrhea virus provided in Example 3 of the present invention;

[0036] Fig.11 The results of differential diagnosis of common pathogens of bovine viral diarrhea virus LAMP reaction provided in Example 4 of the present invention;

[0037] Fig.12 The results of the LAMP reaction of clinical samples infected with bovine viral diarrhea virus provided in Example 5 of the present invention;

[0038] Fig.13 The sensitivity test result of bovine viral diarrhea virus LAMP provided in Example 6 of the present invention;

[0039] Fig.14 This is the sensitivity test result of the common PCR for bovine viral diarrhea virus provided in Example 6 of the present invention. DETAILED DESCRIPTION

[0040] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms is non-limiting.

[0041] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0042] The invention provides a bovine viral diarrhea virus loop-mediated isothermal amplification primer set, comprising an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB;

[0043] The nucleotide sequence of the outer primer F3 is shown in SEQ ID NO.1; the nucleotide sequence of the outer primer B3 is shown in SEQ ID NO.2; the nucleotide sequence of the inner primer FIP is shown in SEQ ID NO.3; the nucleotide sequence of the inner primer BIP is shown in SEQ ID NO.4; the nucleotide sequence of the loop primer LF is shown in SEQ ID NO.5; the nucleotide sequence of the loop primer LB is shown in SEQ ID NO.6.

[0044] By selecting the bovine viral diarrhea gB gene as the target gene, a specific LAMP primer set was designed. The outer primer F3, outer primer B3, inner primer FIP and inner primer BIP can specifically and completely identify the target gene, thereby ensuring its specificity for bovine viral diarrhea virus gene amplification and comprehensiveness of detection; at the same time, it is combined with the loop primer to improve its amplification efficiency; the primer set can be used to realize the rapid detection of the bovine viral diarrhea virus loop-mediated isothermal amplification primer set, and its detection sensitivity is higher than that of ordinary PCR, and the amplification template concentration only needs 10 2 The LAMP technology is used, and no special instruments or equipment are needed. It only needs to be placed in a constant temperature environment of 55-65 degrees, and the target gene can be efficiently amplified in 30-60 minutes. The amplified product is subjected to PCR reaction, and the positive and negative results are significantly different. The results are determined by the amplification curve and Tt value. The technical problem of the lack of rapid and accurate detection or identification of bovine viral diarrhea virus using LAMP technology in the prior art is solved.

[0045] In some specific embodiments, the molar ratio of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB is 1:1:3:3:1:1.

[0046] Since the primer set can be used to quickly detect the bovine viral diarrhea virus ring-mediated isothermal amplification primer set, its detection sensitivity is higher than that of ordinary PCR, and the amplification template concentration only needs to be 10 2 The invention also provides the use of the above-mentioned bovine viral diarrhea virus loop-mediated isothermal amplification primer set in the preparation of a product for detecting bovine viral diarrhea virus.

[0047] According to another aspect of the present invention, there is also provided a reagent for detecting bovine viral diarrhea virus, comprising the above-mentioned primer set.

[0048] The above primer set can be used as a reagent in any product or application that utilizes LAMP technology to amplify the target gene of bovine viral diarrhea virus.

[0049] In some specific embodiments, the concentrations of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB are independently 5 to 10 μM.

[0050] Among them, the concentrations of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB are independently 5 to 10 μM, specifically including: the concentration of the outer primer F3 is 5 to 10 μM, the concentration of the outer primer B3 is 5 to 10 μM, the concentration of the inner primer FIP is 5 to 10 μM, the concentration of the inner primer BIP is 5 to 10 μM, the concentration of the loop primer LF is 5 to 10 μM, and the concentration of the loop primer LB is 5 to 10 μM.

[0051] According to another aspect of the present invention, a kit for detecting bovine viral diarrhea virus is provided, comprising the above-mentioned primer set or the above-mentioned reagent.

[0052] The above primer set or reagent can be used to complete the efficient amplification of the target region within 30 minutes, and the result can be determined by the product fluorescence reaction according to the conditions. The kit formed by it has the advantages of simple operation, high specificity, no need for special equipment, low cost, easy result determination, and is suitable for on-site rapid detection, primary veterinary clinical diagnosis or epidemic disease monitoring.

[0053] In some specific embodiments, the method further comprises a reaction solution, a negative control substance, a positive control substance and a DNA polymerase.

[0054] In some specific embodiments, the positive control is a plasmid DNA carrying a bovine viral diarrhea virus target gene clone.

[0055] Among them, the target gene specifically refers to the bovine viral diarrhea gB gene.

[0056] In some specific embodiments, the negative control is ddHO.

[0057] In some specific embodiments, the reaction solution includes MgCl2, betaine, buffer and dNTP.

[0058] In some specific embodiments, the concentration of MgCl2 is 20-25 mM.

[0059] In some specific embodiments, the concentration of betaine is 5-10 μM.

[0060] In some specific embodiments, the concentration of the dNTP is 5-10 mM.

[0061] In some specific embodiments, the buffer is 10×Buffer.

[0062] In some specific embodiments, the DNA polymerase includes Bst DNA polymerase or Bst DNA polymerase large fragment.

[0063] The above reagents and reagents described in the kit can be used to rapidly detect bovine viral diarrhea virus by isothermal amplification of the DNA of the sample to be tested. The specific detection method includes:

[0064] (1) Sample processing and template extraction

[0065] The sample comes from a tissue disease material, cell culture supernatant or serum and other virus samples to be tested. Take the sample (or add lysis buffer) and boil it for lysis, then centrifuge and take the supernatant as the LAMP template.

[0066] (2) Loop-mediated isothermal amplification of bovine viral diarrhea virus

[0067] Take the template, reaction solution and DNA polymerase prepared in step (1), add ddHO to 25 μL, 55-65, and the reaction time is 30-60 min.

[0068] The content of each component in the 25 μL LAMP amplification system is:

[0069]

[0070]

[0071] Specifically, the 25 μL LAMP amplification reaction system is:

[0072]

[0073] The preferred amplification conditions of LAMP are: reaction temperature of 56°C and reaction time of 30 min.

[0074] The nucleic acid reaction solution includes a reaction solution and a primer set.

[0075] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0076] Example 1 Primer Set for Loop-Mediated Isothermal Amplification of Bovine Viral Diarrhea Virus

[0077] This embodiment is based on loop-mediated isothermal nucleic acid amplification technology. According to the bovine viral diarrhea virus genome sequence published on Genebank, a highly homologous genome sequence is selected after comparison, and a specific LAMP primer set is designed with 834 nucleotide sequences at 817bp to 1651bp of the gene sequence of 32 domestic and foreign BVDV strains that are 100% homologous as the target region. A total of 3 different primer sets are designed, each primer set includes an outer primer F3, an outer primer B3, an inner primer FIP, an inner primer BIP, a loop primer LF and a loop primer LB, and the nucleotide sequence of each primer is shown in Table 1.

[0078] Table 1 Primer sequences of each primer set

[0079] serial number name Primer sequence 5′-3′ SEQ ID NO.1 F3-1 GGGAAGCTGGAGAATTCGT SEQ ID NO.2 B3-1 GTCAAAGCTCACCGCTACAG SEQ ID NO.3 FIP-1 TGGTTGCTGCTTTACCCACTTTTGAGTAATCCAGTACCCGGAC SEQ ID NO.4 BIP-1 CCCGGCTATGAGGGCAATTTTCCTGGAATGAATCCCATTCC SEQ ID NO.5 LF-1 CCGCTATTTGACATATTCAACAAGG SEQ ID NO.6 LB-1 ATGGCCAGCCTCACCT SEQ ID NO.7 F3-2 GGTGGAGGTACCCGTCA SEQ ID NO.8 B3-2 CCTCTTTCTGTTATCAGGAAGCC SEQ ID NO.9 FIP-2 GTGTCGGGTTGGCCACTTTTCATCAGACGGCGAAGTTTAC SEQ ID NO.10 BIP-2 GCCTTCTGTAAAAGCACAGGTTTTCCACACACATGGATTCTTGC SEQ ID NO.11 LF-2 CAGGGGATTCAGTAGGGT SEQ ID NO.12 LB-2 ACCCCTCTGACCATTCCT SEQ ID NO.13 F3-3 GTTCTGTTCTCACACTCCCG SEQ ID NO.14 B3-3 AAAGGAAGCTAAAGGCTACGG SEQ ID NO.15 FIP-3 GTGGCTGTGCTTCTCCCTTTTCCGGTCAGATGGGCTGA SEQ ID NO.16 BIP-3 GCTAAGATGGCAACAAGGTTGTTTTGCCTTCTCATAAGCTGTGCTAC SEQ ID NO.17 LF-3 ATTCCAGTGGAGAGAGGG SEQ ID NO.18 LB-3 GCCATGTAACTACTGGTG

[0080] The nucleotide sequence of the BVDV strain amplified by the primer set is shown in SEQ ID NO. 19. After comparison with the bovine viral diarrhea virus LAMP amplification reaction test, Figure 2 As shown, primer set 1 has the best amplification effect. Primer set 1 is selected in the following examples. The positions of the genes where the primers in primer set 1 are located are as shown in Figure 1 shown.

[0081] Among them, the Genbank accession numbers of 32 domestic and foreign BVDV strains were KT875142.1, KT875141.1, KT875140.1, KT875139.1, KT875138.1, KT875137.1, KT875136.1, KT875135.1, HG426481.1, MW528234.1, KT832818.1, KT875143.1, LC649064.1, KT875145.1, and KT875147.1. 6.1, MH231142.1, KT875148.1, LC727650.1, KT875150.1, HG426494.1, KT875152.1, KT875153.1, KT875154.1, KT875155.1, KT875156.1, JN380084.1, MH231128.1, MH231135.1, AF078539.1, AF078541.1, AF078542.1, and AF502399.1.

[0082] Example 2 Kit for detecting bovine viral diarrhea virus

[0083] The kit provided in this embodiment includes the primer set provided in Example 1, a reaction solution, a negative control substance, a positive control substance and a DNA polymerase.

[0084] Among them, the positive control is a plasmid DNA carrying the target gene clone of bovine viral diarrhea virus; the negative control is ddHO; the reaction solution includes MgCl2, betaine, buffer and dNTP;

[0085] The concentration of the forward outer primer F3 was 10 μM;

[0086] The concentration of the reverse outer primer B3 was 10 μM;

[0087] The concentration of the forward inner primer FIP was 10 μM;

[0088] The concentration of the reverse inner primer BIP was 10 μM;

[0089] The concentration of the forward loop primer LF was 10 μM;

[0090] The concentration of the reverse loop primer LB was 10 μM;

[0091] The concentration of MgCl2 is 25 mM;

[0092] The concentration of betaine was 8 μM;

[0093] The concentration of dNTP is 10 mM;

[0094] The buffer was 10× Buffer;

[0095] The DNA polymerase was Bst DNA polymerase at a concentration of 8 U / μL.

[0096] Example 3 Optimization of bovine viral diarrhea virus LAMP reaction conditions

[0097] In this example, only one condition / group of conditions in the reaction system is selected for gradient change, and other conditions remain unchanged. The conditions for the LAMP amplification reaction of bovine viral diarrhea virus using the primer set provided in Example 1 are optimized, and the reagents are selected from the reagents in the kit provided in Example 2.

[0098] 1. Optimization of different Tm value conditions of LAMP for bovine viral diarrhea virus

[0099] 25 μL of the reaction mixture was reacted at 56, 60, 62 and 65 for 30 min, and the FAM channel fluorescence signal was collected every 1 min for a total of 30 cycles. Figure 3 As shown, a to d: LAMP reaction results with Tm values ​​of 56, 60, 62, and 65, respectively. Figure 3 It can be seen that when the Tm value is 56, the fluorescence signal intensity obtained is the highest, so 56 is preferred.

[0100] 2. Optimization of concentration of different betaines in LAMP for bovine viral diarrhea virus infection

[0101] 3.0 μL, 4.0 μL, 5.0 μL and 6.0 μL of 5 μM Betaine were added to 25 μL of reaction mixture, respectively, and the reaction was carried out at 56r for 30 min, and the FAM channel fluorescence signal was collected every 1 min. The results are shown in Figure 4 As shown, 1 to 4 are the LAMP reaction results of adding 3.0 μL, 4.0 μL, 5.0 μL and 6.0 μL Betaine respectively; 5 is the negative control reaction result. The negative control is the addition of ddH O. Figure 4 It can be seen that when 3.0 μL of 5 μM Betaine is added, the fluorescence signal intensity is the highest, so it is preferred to add 3.0 μL of 5 μM Betaine to the 25 μL system.

[0102] 3. Optimization of different forward and reverse external primer concentrations for bovine viral diarrhea virus LAMP

[0103] 0.25 μL, 0.5 μL, 0.75 μL, 1.0 μL, 1.25 μL, 1.5 μL and 2.0 μL of 10 μM forward and reverse primers (external primers F3 and B3) were added to 25 μL of reaction mixture, respectively, and reacted at 56°C for 30 min, collecting FAM channel fluorescence signals every 1 min. The results are shown in Figure 5 As shown, 1 to 7: LAMP reaction results of adding 0.25μL, 0.5μL, 0.75μL, 1.0μL, 1.25μL, 1.5μL and 2.0μL of forward and reverse outer primers respectively; 8: negative control reaction result. Figure 5 It can be seen that when 1.0 μL of 10 μM forward and reverse outer primers are added, the fluorescence signal intensity is the highest, so it is preferred to add 1.0 μL of 10 μM forward and reverse outer primers in the 25 μL system.

[0104] 4. Optimization of different forward and reverse inner primer concentrations for bovine viral diarrhea virus LAMP

[0105] 0.5 μL, 1.0 μL, 1.5 μL, 2.0 μL, 2.5 μL, 3.0 μL and 3.5 μL of 10 μM forward and reverse inner primers (inner primer FIP and inner primer BIP) were added to 25 μL of reaction mixture, respectively, and the reaction was carried out at 56°C for 30 min, and the fluorescence signal of the FAM channel was collected every 1 min. The results are shown in Figure 6 As shown, 1 to 7: 0.5μL, 1.0μL, 1.5μL, 2.0μL, 2.5μL, 3.0μL and 3.5μL forward and reverse outer primer LAMP reaction results; 8: negative control reaction result. Figure 6 It can be seen that when 3 μL of 10 μM forward and reverse inner primers are added, the fluorescence signal intensity is the highest. Therefore, it is preferred to add 3 μL of 10 μM forward and reverse inner primers in the 25 μL system.

[0106] 5. Optimization of different forward and reverse loop primer concentrations for bovine viral diarrhea virus LAMP

[0107] 0 μL, 0.25 μL, 0.5 μL, 0.75 μL, 1.0 μL, 1.25 μL and 1.5 μL of 10 μM forward and reverse loop primers (loop primer LF and loop primer LB) were added to 25 μL of reaction mixture, respectively, and reacted at 56°C for 30 min, collecting FAM channel fluorescence signals every 1 min. The results are shown in Figure 7 As shown, 1 to 7: 0μL, 0.25μL, 0.5μL, 0.75μL, 1.0μL, 1.25μL and 1.5μL forward and reverse outer primer LAMP reaction results; 8: negative control reaction result. Figure 7It can be seen that when 1 μL of 10 μM forward and reverse loop primers is added, the fluorescence signal intensity is the highest, so it is preferred to add 1 μL of 10 μM forward and reverse loop primers in the 25 μL system.

[0108] 6. Concentration Optimization of Different Mg2+ Concentrations for Bovine Viral Diarrhea Virus LAMP

[0109] 0.5 μL, 1.5 μL, 2.5 μL and 3.5 μL of 25 mM MgClr were added to 25 μL of reaction mixture, respectively, and the reaction was carried out at 56°C for 30 min. The fluorescence signal of the FAM channel was collected every 1 min. The results are shown in Figure 8 As shown, 1 to 4: 0.5μL, 1.5μL, 2.5μL, 3.5μL MgCl LAMP reaction results with a concentration of 25mM; 5: negative control reaction result. Figure 8 It can be seen that when 2.5 μL of 25 mM MgCl was added, the fluorescence signal intensity was the highest. Therefore, it is preferred to add 2.5 μL of 25 mM MgCl in the 25 μL system.

[0110] 7. Optimization of different dNTP concentrations for bovine viral diarrhea virus LAMP

[0111] 2.5 μL, 3.0 μL, 3.5 μL, 4.0 μL, 4.5 μL, 5.0 μL and 5.5 μL of 10 mM dNTP were added to 25 μL of reaction mixture, respectively, and the reaction was carried out at 56°C for 30 min. The fluorescence signal of the FAM channel was collected every 1 min. The results are shown in Fig. 9 As shown, 1 to 7: LAMP reaction results of 2.5 μL, 3.0 μL, 3.5 μL, 4.0 μL, 4.5 μL, 5.0 μL and 5.5 μL with a concentration of 10 mM dNTP; 8: negative control reaction result. Fig. 9 It can be seen that when 3 μL of 10 mM dNTP is added, the fluorescence signal intensity is the highest, so it is preferred to add 3 μL of 10 mM dNTP to the 25 μL system.

[0112] 8. Optimization of concentration of different DNA polymerases in LAMP of bovine viral diarrhea virus

[0113] 0.25 μL, 0.5 μL, 0.75 μL, 0.85 μL, 0.95 μL, 1.0 μL and 1.2 μL of 8 U / μL Bst DNA Polymerase were added to the 25 μL reaction mixture, respectively, and the reaction was carried out at 56°C for 30 min, and the FAM channel fluorescence signal was collected every 1 min. The results are shown in Fig.10As shown, 1 to 7: LAMP reaction results of Bst DNA Polymerase enzyme (8U / μL) at 0.25μL, 0.5μL, 0.75μL, 0.85μL, 0.95μL, 1.0μL, and 1.2μL respectively; 8: Negative control reaction results. Fig.10 It can be seen that when 1 μL of 8U / μL Bst DNA Polymerase is added, the fluorescence signal intensity is the highest. Therefore, it is preferred to add 1 μL of 8U / μL Bst DNA Polymerase to the 25 μL system.

[0114] Example 4 Application of LAMP in differential diagnosis of bovine viral diarrhea virus

[0115] In this example, the kit provided in Example 2 was used to perform bovine viral diarrhea virus LAMP according to the reaction conditions optimized in Example 3 to identify bovine viral diarrhea virus from different samples.

[0116] 1. Materials and reagents

[0117] 1.1 Bacterial strains

[0118] The BVDV isolates and the BVDV clone strain pMD18-BVDV-2 containing the target gene were maintained in our laboratory.

[0119] 1.2 Control group

[0120] Bacterial sample control group: Pasteurella, Clostridium perfringens type C, and Clostridium perfringens type D nucleic acid templates.

[0121] Virus sample control group: foot-and-mouth disease type O (FMDV-O), bovine leukemia virus (BLV), bovine infectious rhinotracheitis (BoHV-1), and bovine lumpy skin disease virus (LSDV) nucleic acid templates.

[0122] 2. Experimental methods

[0123] 2.1 Sample preparation

[0124] The samples of the bacterial and viral control groups were subjected to viral nucleic acid extraction using the magnetic bead-based viral DNA / RNA extraction kit (Catalog No.: CW2509S (96preps) of Kangwei Century Biotechnology Co., Ltd. and stored at -20 for future use.

[0125] 2.2 Use the optimized BVDV LAMP detection reaction system (25 μL):

[0126]

[0127] The reaction conditions are: react at 56°C for 30 minutes, and collect the FAM channel fluorescence signal every 1 minute. Observe and record the results through the amplification curve results and Tt values, such as Fig.11 As shown, 1: positive control reaction result; 2: negative control reaction result (ddHrO); 3-9: LAMP reaction results of nucleic acid samples of Pasteurella, Clostridium perfringens type C, Clostridium perfringens type D, foot-and-mouth disease type O (FMDV-O), bovine leukemia virus (BLV), bovine infectious rhinotracheitis (BoHV-1), and bovine nodular skin disease virus (LSDV). Fig.11 It can be seen that the bovine viral diarrhea virus loop-mediated isothermal amplification primer set can specifically amplify the bovine viral diarrhea virus template and quickly complete the efficient amplification of the bovine viral diarrhea virus target region, but cannot specifically amplify other viruses.

[0128] Example 5: Application and verification of bovine viral diarrhea virus LAMP in clinical diagnosis

[0129] 1. Materials and Reagents

[0130] 1.1 Viruses and samples BVDV isolate TKKS-1 and its infected tissue specimens and other positive samples were stored and supplied by our laboratory.

[0131] 2. Test methods

[0132] 2.1 Processing of clinical samples

[0133] Processing and template extraction, the sample range is applicable to tissue disease materials, serum, semen, embryonic tissue, cell culture supernatant waiting for inspection samples. Take an appropriate amount of sample and extract viral nucleic acid according to the commercial kit, and use it as a LAMP template.

[0134] 2.2 LAMP reaction of clinical samples

[0135] This example uses samples that are positive for clinical PCR detection, specifically samples from liver, spleen, kidney, serum, semen and embryonic tissue. The LAMP reaction system and conditions are the same as those in Item 2.2 of Example 4, and the reaction is carried out in the form of a kit. The specific contents are as follows:

[0136]

[0137] Place the centrifuged LAMP tube into the detector (either a dedicated instrument or an ordinary fluorescent PCR instrument), set the positions of the sample to be tested (S), positive control (PC), and negative control (NC), where the positive control is the plasmid DNA cloned from the target gene of bovine viral diarrhea virus, and the negative control is ddH O. Set the reaction parameters: use 56 30min, collect the FAM channel fluorescence signal every 1min, for a total of 30 cycles. Observe and record the results through the amplification curve results and Tt values, such as Fig.12 As shown, 1: positive control; 2-7: LAMP reaction results of liver, spleen, kidney, serum, semen and embryonic tissue samples infected with BVDV; 8: negative control reaction result.

[0138] 2.3 Determination of LAMP reaction results

[0139] 2.3.1 Setting of result analysis conditions

[0140] Threshold setting principle: Adjust according to the instrument noise, so that the threshold line just exceeds the highest point of the negative control amplification curve.

[0141] In this embodiment, the threshold is set to 100.

[0142] 2.3.2 Quality Control Standards

[0143] 2.3.2.1 The negative control has no Tt value and no amplification curve, i.e., an S-shaped amplification curve.

[0144] 2.3.2.2 The Tt value of the positive control should be less than or equal to 25, and a typical amplification curve should appear.

[0145] 2.3.2.3 If the negative and positive controls do not meet the above conditions, the experiment will be considered invalid.

[0146] 2.3.3 Result determination

[0147] 2.3.3.1 Negative: No Tt value and no characteristic amplification curve, indicating that the sample is negative.

[0148] 2.3.3.2 Positive: Tt value ≤ 30, and a typical amplification curve appears, indicating that the sample is positive.

[0149] 2.3.3.3 Samples with Tt values ​​but no characteristic amplification curve are judged as negative.

[0150] According to the above quality control standards and results, combined with Fig.12It can be seen that the negative control has no Tt value and no characteristic amplification curve, the positive control (plasmid DNA cloned from the bovine viral diarrhea virus target gene) has a Tt value of 15 and a typical amplification curve, so the experiment is valid. The LAMP reaction results of samples 2 to 7 all show a Tt value of less than 25 and a typical amplification curve, all of which are positive, which is consistent with the clinical PCR test results, and the accuracy rate is 100%.

[0151] Example 6 Sensitivity Detection of Bovine Viral Diarrhea Virus LAMP

[0152] 1. Materials and Reagents

[0153] 1.1 Template

[0154] The plasmid DNA of the bovine viral diarrhea virus target gene clone was stored in our laboratory.

[0155] 2. Test methods

[0156] 2.1 Sample preparation

[0157] The plasmid DNA of the bovine viral diarrhea virus target gene clone was diluted 10 times in series.

[0158] 2.2 Sensitivity test of LAMP reaction

[0159] In this example, plasmid DNA cloned from the target gene of bovine viral diarrhea virus was used to determine its concentration, and its copy number was calculated based on the size of the plasmid genome. The plasmid DNA was diluted 10-fold with ddHO to 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL and 10 2 The concentration of copies / μL was used to perform LAMP test and PCR test respectively with different concentrations of plasmid DNA as samples to compare their sensitivity.

[0160] The LAMP reaction system and conditions are the same as those in Item 2.2 of Example 4, and the reaction is carried out in the form of a kit. The specific contents are as follows:

[0161]

[0162] Place the centrifuged LAMP tube into the detector and set the negative control to ddH 2 O. Set the reaction parameters: 5630 min, collect FAM channel fluorescence signals every 1 min, for a total of 30 cycles. Observe and record the results through the amplification curve results and Tt values, as shown in the figure below. Fig.13 As shown, where 1 to 4 are 10 respectively. 5 copies / μL, 104 copies / μL, 10 3 copies / μL and 10 2 copies / μL; 5: negative control reaction results.

[0163] PCR forward primer: 5′-AAACAAGGAGGGTAGCAACAG-3′ (SEQ ID NO. 20);

[0164] PCR reverse primer: 5′-TCTGCAAGCACCCTATCA-3′ (SEQ ID NO. 21);

[0165] PCR amplification system: 2×Es Taq MasterMix (Dye) 12.5μL, Forward Primer (10μM) 1μL, Reverse Primer (10μM) 1μL, Template DNA 1μL, ddH2O to 25μL;

[0166] The amplification conditions were: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, for a total of 30 cycles; 72°C extension for another 2 min. Fig.14 shown.

[0167] 2.3 Determination of LAMP reaction results

[0168] Same as 2.3 in Example 5, according to the above quality control standards and results, combined with Fig.13 and Fig.14 It can be seen that the negative control has no Tt value and no characteristic amplification curve, and the detection limit of the LAMP test of the present invention is 10 2 The detection limit of conventional PCR is 10 4 The sensitivity of LAMP reaction is 100 times higher than that of ordinary PCR.

Claims

1. A primer set for bovine viral diarrhea virus loop-mediated isothermal amplification, characterized in that: It includes outer primer F3, outer primer B3, inner primer FIP, inner primer BIP, loop primer LF and loop primer LB; The nucleotide sequence of the external primer F3 is shown in SEQ ID NO.1; the nucleotide sequence of the external primer B3 is shown in SEQ ID NO.2; the nucleotide sequence of the internal primer FIP is shown in SEQ ID NO.3; the nucleotide sequence of the internal primer BIP is shown in SEQ ID NO.4; the nucleotide sequence of the loop primer LF is shown in SEQ ID NO.5; the nucleotide sequence of the loop primer LB is shown in SEQ ID NO.

6.

2. The bovine viral diarrhea virus loop-mediated isothermal amplification primer set according to claim 1, characterized in that: The molar ratio of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB is 1:1:3:3:1:

1.

3. Use of the bovine viral diarrhea virus loop-mediated isothermal amplification primer set according to claim 1 or 2 in the preparation of a product for detecting bovine viral diarrhea virus.

4. A reagent for detecting bovine viral diarrhea virus, characterized in that: Comprising the primer set according to claim 1 or 2.

5. The reagent according to claim 4, characterized in that The concentrations of the outer primer F3, the outer primer B3, the inner primer FIP, the inner primer BIP, the loop primer LF and the loop primer LB are independently 5 to 10 μM.

6. A kit for detecting bovine viral diarrhea virus, characterized in that: It comprises the primer set according to claim 1 or 2 or the reagent according to claim 4 or 5.

7. The kit according to claim 6, characterized in that It also includes reaction solution, negative control, positive control and DNA polymerase.

8. The kit according to claim 7, characterized in that The positive control substance is a plasmid DNA carrying a bovine viral diarrhea virus target gene clone; Preferably, the negative control is ddHO.

9. The kit according to claim 7, characterized in that The reaction solution includes MgCl2, betaine, buffer and dNTP; Preferably, the concentration of MgCl2 is 20-25 mM; Preferably, the concentration of betaine is 5 to 10 μM; Preferably, the concentration of the dNTP is 5 to 10 mM; Preferably, the buffer is 10×Buffer.

10. The kit according to claim 7, characterized in that The DNA polymerase includes Bst DNA polymerase or Bst DNA polymerase large fragment.

Images