Method for displaying and interpreting gene editing target site result based on Sanger method sequencing

Abstract

The invention belongs to the field of biological detection, and particularly relates to a method for displaying and interpreting a gene editing target site result based on Sanger method sequencing. The invention provides a method for displaying and interpreting a gene editing target site result based on Sanger sequencing in a web form, and a method for judging whether a wild-type allele exists or not according to a wild-type genome reference sequence, an sgRNA sequence and sequencing result base peak map data of a sample. By summarizing the characteristics of a Sanger method for detecting a gene editing site result, a reference sample refers to a genome sequence and an sgRNA sequence, a possible result of the editing site sequence is judged based on base peak map data in a Sanger sequencing result, various possible conditions of the sample at a gene editing position are determined, and visual display is performed by using a drawing technology, so that the detection accuracy of the gene editing site is improved. A good effect is achieved, and the effect is excellent through verification of a large amount of experimental data.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and specifically relates to a method for displaying and interpreting the results of gene editing target sites. Background Art

[0002] Gene editing technology is a technology that can precisely modify the genetic information of an organism by specifically changing the target gene sequence. Its basic principle is to use an exogenous cutting complex to recognize and cut a specific DNA sequence in the cell, thereby triggering the DNA repair mechanism in the cell, leading to gene knockout, insertion or replacement.

[0003] CRISPR-Cas9 is one of the most widely used gene editing technologies. It consists of a Cas9 protein with nuclease function and a single-stranded guide RNA (sgRNA). After binding to the Cas9 protein, the sgRNA can target a specific site in the genome and guide the Cas9 protein to cut the DNA double strand at that location, forming a double-strand break (DSB). Subsequently, the cell repairs these breaks through repair pathways such as non-homologous end joining (NHEJ) or homologous recombination (HDR), thereby achieving gene knockout, insertion or replacement.

[0004] Gene editing technology has shown broad application prospects in many fields. In the medical field, gene editing technology is used to study and treat diseases such as genetic diseases, infectious diseases and cancer. For example, CRISPR technology can be used to generate gene knockout mouse models for cancer research and drug development. In the agricultural field, gene editing technology is used to improve crop varieties, increase crop yields and disease resistance.

[0005] Sanger sequencing has important applications in detecting gene editing results. Its main advantages are high accuracy, long read length and simple workflow, making it an ideal choice for verifying the efficiency of CRISPR-Cas9 gene editing. Sanger sequencing can determine the type of gene editing by accurately interpreting the mutated base combination, and can be combined with manual review to improve accuracy.

[0006] After gene editing, the detection of target site results is a very important step. In the application of gene editing technology (such as CRISPR-Cas9), Sanger sequencing is widely used to verify editing efficiency and screen clones in a targeted manner. Researchers can use Sanger sequencing to quickly and accurately analyze CRISPR-Cas9 gene editing products with the assistance of SeqScreener software. In addition, Sanger sequencing can also be used to detect the loss of large chromosome fragments after gene editing.

[0007] Sanger sequencing is currently mainly completed using the ABi3730xl sequencer, but general software (such as DNAMAN, etc.) cannot effectively reflect the editing status of the target position, especially when the allele is heterozygous, which causes the peak graphs of each base sequence to be mixed together, which is not conducive to judging whether there is a wild type in the gene. Summary of the invention

[0008] In response to the above problems, the present invention proposes a method for displaying and interpreting the results of gene editing target sites based on Sanger sequencing in a web format, and a method for judging whether there are wild-type alleles based on the wild-type genome reference sequence of the sample, the sgRNA sequence and the base peak diagram data of the sequencing results. The method has been proven to be feasible and effective through a large amount of real experimental data, and thus the present invention is proposed.

[0009] The present invention provides a method for interpreting the results of gene editing target sites, which comprises the following steps: firstly, comparing the default base sequence of the Sanger sequencing result with the wild-type genome reference sequence of the sample to obtain the position of the sequence identical region;

[0010] The second step is to align the sgRNA sequence with the sample wild-type genome reference sequence to obtain the location of the sequence-identical region;

[0011] The third step is to filter and reduce noise of each base signal of the Sanger sequencing result by using the Savitzky-Golay method; according to the position obtained in the second step, the findpeaks method of the Python open source tool scipy is used to find the peaks within 2 points on the left and right sides of the position to obtain the possible base sequence of each position;

[0012] The fourth step is to display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form;

[0013] Step 5: Display the position of the sgRNA sequence in the Canvas in step 4 in a highlighted form;

[0014] In the sixth step, all possible bases obtained in the first step are sequentially compared with the wild-type genome reference sequence to determine whether the wild-type allele exists.

[0015] Preferably, the first to third steps use open source software, such as open source software Biopython, to achieve comparison.

[0016] Specifically, in the fourth step, the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence are displayed in a sequential form using HTML5 Canvas drawing technology.

[0017] More specifically, the first row in the diagram shows the reference genome sequence, the second row shows the default sequence of the sequencing result, and the peak graph shows four base signals.

[0018] In a preferred embodiment, according to different alleles, the specific situation is as follows:

[0019] 1) For the homozygous wild type, the default sequence of Sanger sequencing is consistent with the sgRNA and the reference sequence, and the possible base sequences found according to the peak values ​​of each base signal in the first step are also consistent, that is, there is only one base sequence and it is consistent with the reference sequence;

[0020] 2) For homozygous non-wild type, the default sequence of Sanger sequencing is inconsistent with the sgRNA and reference sequence, and the possible base sequences found according to the peak values ​​of each base signal in the first step are also inconsistent, but consistent with the default result, that is, there is only one base sequence and it is inconsistent with the reference sequence;

[0021] 3) For samples with heterozygous or wild-type test results, the first step is to find all the base possibilities at several positions after the heterozygous position, and it can be known that there is a possibility that a part of the alleles at that position of the sample is consistent with the reference sequence;

[0022] 4) For samples with heterozygous results excluding wild-type, the first step is to find all base possibilities at several positions after the heterozygous position, and it can be known that there is no possibility that the alleles of the sample at this position are consistent with the reference sequence.

[0023] The present invention thus provides a system for interpreting the results of gene editing target sites, which is used to execute the described method, and specifically can be a system constructed by a computer program.

[0024] Specifically, the system includes the following modules:

[0025] Information entry module: Processes data related to detection, including the Sanger sequencing data file of the sample, such as the .ab1 file generated by the ABI3730xl sequencer; the sgRNA sequence of the sample; and the wild-type reference genome sequence of the sample editing region;

[0026] Sequence alignment processing module: used to align the sgDNA sequence with the default sequence of the sequencer file to the reference genome, so as to obtain the correct data interpretation position; the base peak signal in the sequencing file will be processed to determine the possible base sequence at the sgRNA position to interpret the editing result;

[0027] Result output module: This module mainly displays the information of completed comparison.

[0028] In a specific implementation manner, the display is a visual display method, and more specifically, the system is arranged in a Web form, and the information input and result output are both in a Web form.

[0029] The present invention thus provides a bioinformatics tool based on the system for interpreting the results of gene editing target sites, comprising:

[0030] a. User interface, which allows the user to input test-related data, including the Sanger sequencing data file of the sample, such as the .ab1 file generated by the ABI3730xl sequencer; the sgRNA sequence of the sample; and the wild-type reference genome sequence of the edited region of the sample;

[0031] b. the system;

[0032] c. Result display module, used to display the interpretation results to the user;

[0033] Optionally, it also includes d. a report generator for creating and displaying interpretation results.

[0034] The present invention also provides the method or the application of the system in determining whether gene editing is successful.

[0035] The application is used to assist in the identification of new varieties of organisms such as animals or plants cultivated through gene editing technology.

[0036] The present invention summarizes the characteristics of the results of gene editing site detection by the Sanger method, refers to the sample reference genome sequence and sgRNA sequence, and adopts a method for judging the possible results of the editing site sequence based on the peak graph data of each base in the Sanger sequencing results. It determines a variety of possible situations of the sample at the gene editing position, and visualizes them in the form of a web through the Canvas drawing technology of HTML5, achieving good results, and the excellent results have been verified by a large amount of experimental data. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the overall display effect of the four samples.

[0038] Figure 2 This is a homozygous wild-type sample.

[0039] Figure 3 This is a homozygous non-wild-type sample.

[0040] Figure 4 are heterozygous and include wild-type samples.

[0041] Figure 5 are heterozygous and do not include wild-type samples. DETAILED DESCRIPTION

[0042] The present invention is described below by means of specific embodiments in order to better understand the present invention, but it does not constitute a limitation of the present invention.

[0043] Example

[0044] A method for interpreting the results of gene editing target sites comprises the following steps:

[0045] In the first step, the open source software Biopython was used to align the default base sequence of the Sanger sequencing results with the reference sequence of the wild-type genome of the sample to obtain the location of the identical sequence regions.

[0046] In the second step, the open source software Biopython was used to align the sgRNA sequence with a partial reference sequence of the sample wild-type genome to obtain the location of the identical sequence region.

[0047] In the third step, the open source software was used to filter and reduce noise on the base signals of the Sanger sequencing results using the Savitzky-Golay method. The base signals of the ABI sequencing results were independent channels (the four base signals of DNA are stored separately and independently in the data file. It can be understood that each base has an independent peak graph. Therefore, the possibility of the base at a certain position can be inferred by whether there is a peak at that position. That is, if there are peaks of two bases AG at the same position, it means that AG may exist at the same time). According to the position obtained in the second step, the findpeaks method of the python open source tool scipy was used to search for peaks within 2 points on the left and right of the position to obtain the possible base sequence of each position.

[0048] The fourth step is to display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form through HTML5 Canvas drawing technology; specifically, the first line is the reference genome sequence, the second line is the default sequence of the sequencing result, and the peak graph is 4 base signals.

[0049] Step 5: The position of the sgRNA sequence is highlighted in the Canvas of step 4. The final effect is as follows: Figure 1 shown.

[0050] In the sixth step, all possible bases obtained in the first step are compared in order with the wild-type genome reference sequence to determine whether there are wild-type alleles. Due to gene editing technology, the sequence of the part where sgRNA is located is mainly considered here, and the judgment area can also be appropriately extended to improve accuracy. According to the difference in alleles, four possible allele results are obtained, namely "homozygous wild type", "homozygous non-wild type", "heterozygous and including wild type", and "heterozygous and excluding wild type".

[0051] The following provides the judgment process in four different situations in the form of specific examples. Among them, it is impossible to give a very accurate definition of whether gene editing is successful, which is related to the design and needs of the experimenter. Generally speaking, the homozygous wild type certainly does not meet the requirements, so the conclusion drawn through the judgment cannot give a judgment on whether it is successful, but only gives the specific situation of the result. Among them, the core is the processing in step 4 "according to the position obtained in the second step, the findpeaks method of the python open source tool scipy is used to find the peaks within 2 points on the left and right near the position, and obtain the possible base sequence of each position". In this way, all possible sequences can be obtained, which are the 4 cases of Examples 1 to 4 below: "homozygous wild type", "homozygous non-wild type", "heterozygous and including wild type", "heterozygous and excluding wild type".

[0052] Embodiment 1

[0053] The following is the process of interpretation and display of homozygous wild-type samples ( Figure 2 ).

[0054] (1) In this sample, it is bases 255 to 628 of the input reference genome sequence.

[0055] (2) Using the open source software Biopython, the sgRNA sequence (the yellow part in the figure, GTTCCACGAGACCCGCCACCCGG) was aligned with the wild-type sample genome reference sequence to obtain the position of the sequence identical region, which in this sample is 437 to 459 of the reference genome. Combined with the alignment position information of the ABI sequencing results in the first step (ABI sequencing result PLOC field data), the peak positions of bases 437 to 459 can be determined as 2150, 2162, 2174, 2187, 2199, 2211, 2222, 2232, 2243, 2256, 2269, 2280, 2294, 2304, 2316, 2328, 2340, 2353, 2365, 2375, 2386, 2398, 2410, and 2423;

[0056] (3) Use open source software to filter and reduce noise on each base signal of the Sanger sequencing results using the Savitzky-Golay method. Based on the position obtained in the second step, the findpeaks method of the python open source tool scipy is used to find the peaks within 2 points on the left and right of the position to obtain the possible base sequence of each position. There is only one possibility for the sequence of this sample at the sgRNA position, which is GTTCCACGAGACCCGCCACCCGG, which is completely consistent with the reference genome;

[0057] (4) Display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form using HTML5 Canvas drawing technology ( Figure 2 );

[0058] (5) The location of the sgRNA sequence is highlighted in the genome and the resulting default sequence;

[0059] (6) According to the possible base information based on the peak signal in step 3, it can be seen that there is only one possible sequence at the sgRNA position, and it is consistent with the reference genome. It can be judged that this sample is a homozygous wild type.

[0060] Embodiment 2

[0061] The following is the process of interpretation and display of homozygous non-wild-type samples ( Figure 3 ).

[0062] (1) Bases 1 to 234 of the reference genome sequence entered for this sample.

[0063] (2) Using the open source software Biopython, the sgRNA sequence (the yellow part in the figure, GAAGATGTGCGGGATCAAGCAGG) was aligned with the wild-type sample genome reference sequence to obtain the position of the identical sequence region, which in this sample was 76 to 98 of the reference genome, because base insertion was detected at the sgRNA position in this sample, and the actual base position was 76 to 99. Combined with the alignment position information of the ABI sequencing result in the first step (ABI sequencing result PLOC field data), the peak positions of bases 76 to 99 can be determined as 925, 937, 949, 960, 971, 981, 992, 1003, 1015, 1026, 1037, 1051, 1062, 1075, 1087, 1099, 1111, 1123, 1135, 1146, 1157, 1168, 1177, 1189;

[0064] (3) Use open source software to filter and reduce noise on each base signal of the Sanger sequencing results using the Savitzky-Golay method. Each base signal of the ABI sequencing results is an independent channel. According to the position obtained in the second step, the findpeaks method of the python open source tool scipy is used to find the peaks within 2 points on the left and right of the position to obtain the possible base sequence of each position. There is only one possibility for the sequence of this sample at the sgRNA position, which is GAAGATGTGCGGGATCAAAGCAGG. An A base is inserted at position 92 relative to the reference genome;

[0065] (4) Display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form using HTML5 Canvas drawing technology ( Figure 3 );

[0066] (5) The location of the sgRNA sequence is highlighted in the genome and the resulting default sequence;

[0067] (6) According to the possible base information based on the peak signal in step 3, it can be seen that there is only one possible sequence at the sgRNA position. An A base is inserted at position 92 relative to the reference genome. It can be judged that this sample is homozygous non-wild type, and the inserted A base is highlighted in red.

[0068] Embodiment 3

[0069] The following is the process of interpretation and display of heterozygous and wild-type allele samples ( Figure 4 ).

[0070] (1) Bases 36 to 309 of the reference genome sequence input for this sample.

[0071] (2) Using the open source software Biopython, the sgRNA sequence (the yellow part in the figure, GCAGTACAAGAAGCGGCCCGCGG) was aligned with the wild-type sample genome reference sequence to obtain the position of the sequence identical region, which in this sample is 146 to 168 of the reference genome. Combined with the alignment position information of the ABI sequencing results in the first step (ABI sequencing result PLOC field data), the peak positions of bases 146 to 168 can be determined as 1766, 1778, 1790, 1801, 1813, 1825, 1837, 1849, 1863, 1873, 1886, 1897, 1909, 1920, 1934, 1946, 1957, 1968, 1980, 1993, 2006, 2019, 2030;

[0072] (3) Use open source software to filter and reduce noise on each base signal of the Sanger sequencing results using the Savitzky-Golay method. Each base signal of the ABI sequencing results is an independent channel. According to the position obtained in the second step, the findpeaks method of the python open source tool scipy is used to find the peaks within 2 points on the left and right of the position, and the possible base sequence of each position can be obtained. The sequence of this sample at the sgRNA position is GCAGTACAAGAAGCGGC[CG]CG[CG]GG ([] indicates the possible base at this position). It can be seen that the allele may exist in two situations: GCAGTACAAGAAGCGGCCCGCGG (wild type) and GCAGTACAAGAAGCGGCGCGGGG;

[0073] (4) Display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form using HTML5 Canvas drawing technology ( Figure 4 );

[0074] (5) The location of the sgRNA sequence is highlighted in the genome and the resulting default sequence;

[0075] (6) According to the possible base information based on the peak signal in step 3, it can be known that there are two possible alleles at the sgRNA position.

[0076] Embodiment 4

[0077] The following describes the process of interpretation and display of heterozygous samples excluding wild-type alleles ( Figure 5 ).

[0078] (1) Bases 1 to 231 of the reference genome sequence input for this sample.

[0079] (2) Using the open source software Biopython, the sgRNA sequence (the yellow part in the figure, GAAGATGTGCGGGATCAAGCAGG) was aligned with the wild-type sample genome reference sequence to obtain the position of the sequence identical region, which in this sample is 76 to 98 of the reference genome. Combined with the alignment position information of the ABI sequencing results in the first step (ABI sequencing result PLOC field data), the peak positions of bases 76 to 98 can be determined as 951, 963, 974, 984, 995, 1006, 1018, 1029, 1040, 1054, 1066, 1078, 1091, 1103, 1115, 1127, 1138, 1150, 1161, 1172, 1181, 1193, 1205;

[0080] (3) Use open source software to filter and reduce noise on each base signal of the Sanger sequencing results using the Savitzky-Golay method. Each base signal of the ABI sequencing results is an independent channel. According to the position obtained in the second step, the findpeaks method of the python open source tool scipy is used to find the peaks within 2 points on the left and right of the position, and the possible base sequence of each position can be obtained. The sequence of this sample at the sgRNA position is GAAGATGTGCGGGA[AG][GC][CG][AG]G[AG][AG][AG] ([] indicates the possible base at this position), which shows that there is no wild-type allele;

[0081] (4) Display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form using HTML5 Canvas drawing technology ( Figure 5 );

[0082] (5) The location of the sgRNA sequence is highlighted in the genome and the resulting default sequence;

[0083] (6) Based on the possible base information based on the peak signal in step 3, it can be seen that there is no wild-type allele at the sgRNA position.

Claims

1. A method for interpreting the results of a gene editing target site, characterized in that: The steps include: In the first step, the default base sequence of the Sanger sequencing result is compared with the wild-type genome reference sequence of the sample to obtain the location of the sequence-identical region; The second step is to align the sgRNA sequence with the sample wild-type genome reference sequence to obtain the location of the sequence-identical region; The third step is to filter and reduce noise of each base signal of the Sanger sequencing result by using the Savitzky-Golay method; according to the position obtained in the second step, the findpeaks method of the Python open source tool scipy is used to find the peaks within 2 points on the left and right sides of the position to obtain the possible base sequence of each position; The fourth step is to display the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence in a sequential form; Step 5: Display the position of the sgRNA sequence in the Canvas in step 4 in a highlighted form; In the sixth step, all possible bases obtained in the first step are sequentially compared with the wild-type genome reference sequence to determine whether the wild-type allele exists.

2. The method according to claim 1, characterized in that The first to third steps use open source software, such as the open source software Biopython, to achieve comparison.

3. The method according to claim 1, characterized in that In the fourth step, the Sanger sequencing result peak graph, base sequence and wild-type genome reference sequence are displayed in a sequential form using HTML5 Canvas drawing technology.

4. The method according to claim 3, characterized in that The first row in the display diagram is the reference genome sequence, the second row is the default sequence of the sequencing result, and the peak diagram shows four base signals.

5. The method according to any one of claims 1 to 4, characterized in that: Depending on the allele, the specific situation is as follows: 1) For the homozygous wild type, the default sequence of Sanger sequencing is consistent with the sgRNA and the reference sequence, and the possible base sequences found according to the peak values ​​of each base signal in the first step are also consistent, that is, there is only one base sequence and it is consistent with the reference sequence; 2) For homozygous non-wild type, the default sequence of Sanger sequencing is inconsistent with the sgRNA and reference sequence, and the possible base sequences found according to the peak of each base signal in the first step are also inconsistent, but consistent with the default result, that is, there is only one base sequence and it is inconsistent with the reference sequence; 3) For samples with heterozygous and wild-type test results, the first step is to find all the base possibilities at several positions after the heterozygous position, and it can be known that there is a possibility that a part of the alleles at this position of the sample are consistent with the reference sequence; 4) For samples with heterozygous results that do not include wild-type, the first step is to find all the base possibilities at several positions after the heterozygous position. It can be seen that there is no possibility that the alleles of the sample at this position are consistent with the reference sequence.

6. A system for interpreting the results of gene editing target sites, characterized in that: It is used to perform the method according to any one of claims 1 to 5.

7. The system according to claim 6, characterized in that Includes the following modules: Information entry module: Processes data related to detection, including the Sanger sequencing data file of the sample, such as the .ab1 file generated by the ABI3730xl sequencer; the sgRNA sequence of the sample; and the wild-type reference genome sequence of the sample editing region; Sequence alignment processing module: used to align the sgDNA sequence with the default sequence of the sequencer file to the reference genome, so as to obtain the correct data interpretation position; the base peak signal in the sequencing file will be processed to determine the possible base sequence at the sgRNA position to interpret the editing result; Result output module: This module mainly displays the information of completed comparison.

8. The system according to claim 7, characterized in that The display is a visual display method. More specifically, the system is arranged in a Web form, and the information input and result output are both in a Web form.

9. A bioinformatics tool based on the system according to any one of claims 6 to 8, for interpreting the results of gene editing target sites, comprising: a. User interface, which allows the user to input test-related data, including the Sanger sequencing data file of the sample, such as the .ab1 file generated by the ABI3730xl sequencer; the sgRNA sequence of the sample; and the wild-type reference genome sequence of the edited region of the sample; b. A system as claimed in any one of claims 6 to 8; c. Result display module, used to display the interpretation results to the user; Optionally, it also includes d. a report generator for creating and displaying interpretation results.

10. The method according to any one of claims 1 to 5, and the use of the system according to any one of claims 6 to 8 in determining whether gene editing is successful, for example, its use in assisting the identification of new varieties of organisms such as animals or plants cultivated through gene editing technology.

Images