Melon leaf shape control gene CmSL as well as encoding protein and application thereof

Abstract

The invention relates to a muskmelon leaf shape control gene CmSL as well as an encoded protein and application thereof. The nucleotide sequence of the gene is shown as SEQ ID NO.3, and the sequence of the encoded protein is shown as SEQ ID NO.4. The invention also relates to a preparation method of the muskmelon leaf shape control gene CmSL. A muskmelon material of which the leaf shape is changed, particularly the leaf edge is incised, can be obtained by using a related biological material of the gene through gene editing. The invention has important theoretical and practical significance for revealing a molecular regulation mechanism of the muskmelon leaf shape. The gene editing method provided by the invention can quickly and effectively convert the leaf-shaped material without notching on the leaf edge of the muskmelon into the leaf-shaped variation muskmelon material with notching on the leaf edge, provides an economic, quick and effective way for creating the muskmelon material with various leaf shapes, and has important application value and market prospect in cultivation of new muskmelon varieties.

Description

Technical Field

[0001] The present invention relates to plant genes and their encoded proteins and applications, and in particular to a melon leaf shape control gene CmSL and its encoded protein and applications. Biological materials related to the gene or the encoded protein can be used to create melon materials with leaf shape variation. Background Art

[0002] Muskmelon (Cucumis melo L.) is an important horticultural economic crop. Leaves are important functional organs of melons. Different melon varieties have different leaf shapes, including round, heart-shaped, kidney-shaped, and lobed leaves with different depths of notches on the leaf margin. Leaf morphology is an important component of melon plant type. Different leaf sizes and shapes directly affect the planting density of melons, and affect the quality and yield of melons. Cloning the leaf shape control gene of melons is of great significance for cultivating ideal plant type melons, thereby improving the quality and yield of melons.

[0003] Foreign countries have been conducting research on the mechanism of leaf development since the 1990s, revealing a large number of genes related to leaf morphology in model plants such as Arabidopsis, tomato and rice. In Cucurbitaceae crops, Wei et al. used commercial watermelon hybrids to construct split-leaf and non-split-leaf segregant populations for genetic analysis, and located a watermelon split-leaf gene ClLL1, speculating that an unknown functional protein and a homeobox-leucine zipper protein are the most likely candidate genes (Wei et al., 2017). Jiang et al. used gene editing technology to knock out the homologous gene ClLS of the LATERAL SUPPRESSOR of the GRAS family to obtain a round-leaf watermelon mutant (Jiang et al., 2023). Zhang et al. identified two round-leaf allele mutants C356 and C949 from the EMS mutant library of the cucumber inbred line CCMC, and gene mapping showed that a CsPID gene encoding a serine / threonine protein kinase was the target gene (Zhang et al., 2018). Gao et al. used the palmately lobed leaf natural mutant bm7 as material to finely locate the palmately lobed leaf gene pll in melon, and speculated that a gene annotated as an ANT transcription factor was the best candidate gene (Gao et al., 2014). Based on the above analysis, there are no reports on the functional study of leaf shape-related genes in melon, which restricts the application of leaf shape-related genes in melon.

[0004] The YABBY family is a family of plant-specific transcription factors, whose members play a vital role in plant growth, development and morphogenesis. The YABBY gene family belongs to a subfamily of the zinc finger protein superfamily. The family includes C2H2 zinc finger protein and YABBY domain, which are located at the N-terminus and C-terminus of the C chain respectively, and there is a strong conservation between the two. In plants such as tomatoes and Arabidopsis, the YABBY gene family contains five subfamilies, namely CRC, FIL / YAB3, INO, YAB2 and YAB5. Among them, FIL, YAB2 and YAB3 are expressed in the primordium of the aboveground lateral organs, specifically determining the fate of the cells at the abaxial end of the lateral organs. FIL, YAB2, YAB3 and YAB5 show functional redundancy during the development of Arabidopsis leaves and are mainly specifically expressed in nutritional tissues; while CRC and INO are specifically expressed in floral organs. The CRC gene mainly regulates the development of carpels and nectaries in Arabidopsis, and the INO gene plays an important role in the development of Arabidopsis ovules. However, the functions of YABBY family genes in melon have not been fully elucidated, and there is an urgent need to conduct functional identification of related genes in order to better utilize these genes in breeding. Summary of the invention

[0005] In view of the defects of the prior art, the present invention aims to provide a melon leaf shape control gene CmSL and its encoding protein and application. In a specific example of the present invention, the CRISPR / Cas9 genome editing system is used to edit the gene CmSL in the genome of the melon material, thereby causing the CmSL gene function to be lost, and obtaining a melon material with leaf shape variation. This proves that a new melon variety with leaf shape variation can be produced after the gene CmSL mutates.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The first aspect of the present invention provides a protein CmSL for controlling the leaf shape of muskmelon, having an amino acid sequence as described in any one of (1) to (3):

[0008] (1) the amino acid sequence shown in Sequence 4 in the sequence listing;

[0009] (2) An amino acid sequence derived from the amino acid sequence shown in Sequence 4 in the sequence listing by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating the leaf shape of melon;

[0010] (3) an amino acid sequence derived from melon, having at least 90% (e.g., 91%, 93%, 95%, 97%, 98% or 99%) homology with the amino acid sequence of (1) or (2) and having the function of controlling the leaf shape of melon;

[0011] The control of melon leaf shape includes controlling the leaf margin of the melon to be notched. That is, the protein CmSL regulates the leaf shape of the melon, such as regulating the shape of the leaf margin of the melon. When the melon contains the protein CmSL, the leaf margin of the melon is not notched. The protein is composed of 245 amino acid residues.

[0012] The leaf margin without notches means that the leaf margin of a mature leaf has no uneven concave and convex shapes of varying depths, for example, the leaf margin is entire and / or has uniform fine serrations, and the depth of the serrations is preferably no more than 0.5 cm.

[0013] Furthermore, the control of melon leaf shape may also include controlling the aspect ratio of mature melon leaves, and the aspect ratio of the leaves (the ratio of the maximum length to the maximum width) is preferably 0.79 to 0.83 or expressed as (0.81±0.02).

[0014] The second aspect of the present invention provides a melon leaf shape control gene CmSL, the nucleotide sequence of its cDNA is any one of the following (a1) to (a3):

[0015] (a1) a DNA sequence encoding the amino acid sequence of the first aspect of the present invention;

[0016] (a2) the DNA sequence shown in Sequence 3 in the sequence listing;

[0017] (a3) a DNA sequence that hybridizes with the DNA sequence described in (a1) under stringent conditions and encodes a protein molecule that controls the function of melon leaf shape;

[0018] The controlling of the melon leaf shape comprises controlling the melon leaf shape to have no notches on the leaf margin.

[0019] The leaf margin without notches refers to that the leaf margin of a mature leaf has no uneven concave and convex shapes of varying depths, for example, the leaf margin is entire and / or has only uniform fine serrations, and the depth of the serrations is preferably no more than 0.5 cm.

[0020] Furthermore, the control of melon leaf shape may also include controlling the length-to-width ratio of mature melon leaves, and the length-to-width ratio of the leaves is preferably 0.79 to 0.83 or expressed as (0.81±0.02).

[0021] The third aspect of the present invention provides a biological material related to the protein described in the first aspect of the present invention or the gene described in the second aspect of the present invention, wherein the biological material is selected from the following (a) or (b):

[0022] (a) a substance for silencing, inhibiting or knocking out the gene encoding the protein CmSL described in the first aspect of the present invention or the gene described in the second aspect of the present invention;

[0023] (b) A substance for reducing or inhibiting the activity and / or content of the protein CmSL according to the first aspect of the present invention in melon.

[0024] The biological material of the third aspect of the present invention can be any material that realizes the functions described in (a) or (b). Considering efficiency and operation, the biological material is preferably a melon CRISPR / Cas9 genome editing system, comprising: a recombinant expression vector, the recombinant expression vector comprising a Cas9 expression cassette and an sgRNA expression cassette, the Cas9 expression cassette expresses Cas9, the sgRNA expression cassette expresses sgRNA, and the target gene of the sgRNA is a gene encoding the protein CmSL in melon;

[0025] Furthermore, the target sequence of the sgRNA is the DNA molecule shown in Sequence 5 in the sequence list, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in Sequence 5 in the sequence list.

[0026] The biological material can also be a transgenic cell line containing the above-mentioned recombinant expression vector, a host bacteria containing the above-mentioned recombinant expression vector, and other products that can be used for gene editing. In addition, the primers used to amplify any fragment of the CmSL gene used to screen out the expected gene mutation material from the melon material obtained after transformation by the gene editing system also fall within the scope of protection of the present invention.

[0027] In a specific embodiment of the present invention, the host bacteria containing the above-mentioned recombinant expression vector is Agrobacterium EHA105 containing the recombinant expression vector pBSE401::CmSL.

[0028] The fourth aspect of the present invention provides the use of the biological material described in the third aspect of the present invention in creating melon materials with leaf shape variations or melon breeding, wherein the melon materials with leaf shape variations are melon materials with leaf shape variations having notches on the leaf margins.

[0029] The leaf margin having notches in the present invention means that the leaf margin has concave-convex shapes of varying depths, and the notches are obvious.

[0030] The fifth aspect of the present invention provides a method for changing the leaf shape of melons, the method comprising: using the biological material described in the third aspect of the present invention to cause the CmSL function to be ineffective, thereby obtaining a melon material with a variant leaf shape.

[0031] Preferably, the method comprises using the above-mentioned melon CRISPR / Cas9 genome editing system to edit the gene CmSL in the genome of the melon material whose leaf shape is to be changed, thereby causing the CmSL function to be lost, thereby obtaining a melon material with a leaf shape variation.

[0032] Furthermore, the melon material with changed leaf shape is a melon material with notches on the leaf edges.

[0033] In the method of the fifth aspect of the present invention, as a preferred embodiment, the method specifically comprises:

[0034] S1: introducing the above-mentioned melon CRISPR / Cas9 genome editing system into the melon material whose leaf shape is to be changed, and obtaining successfully transformed plants through screening;

[0035] S2: obtaining a gene CmSL mutant strain from the successfully transformed plants through identification;

[0036] The identification is to use the genome of the successfully transformed plant as a template to perform PCR amplification of the gene CmSL fragment, and then detect it by gel electrophoresis or sequencing to obtain a strain with a gene CmSL mutation.

[0037] Furthermore, the primer pair used in the PCR amplification is Sequence 10 and Sequence 11 in the sequence listing.

[0038] In the fifth aspect of the present invention, the melon material whose leaf shape is to be changed is a melon material containing the gene CmSL in its genome, such as the melon material M6.

[0039] By means of the above technical solution, the present invention has at least the following obvious beneficial effects:

[0040] (1) The present invention provides a melon gene (the nucleotide sequence of the open reading frame is shown in the nucleotide sequence from position 136 to position 873 in SEQ ID NO. 3) and its encoded protein (the amino acid sequence is shown in SEQ ID NO. 4). Through gene editing technology, it is determined that the gene can control or regulate the shape of melon leaves, such as regulating the leaf margin and / or the length-to-width ratio of the melon leaves. In terms of controlling the shape of the leaf margin, the mutation of the gene will cause the entire leaf shape or the leaf margin with uniform fine serrations without notches to change to the leaf margin with obvious notches. In terms of the leaf length-to-width ratio, the mutation of the gene will cause the leaf length-to-width ratio to be significantly reduced.

[0041] (2) By using gene editing technology, editing the CmSL gene in melon can lead to changes in melon leaf shape. Therefore, this gene has the function of controlling leaf shape. Based on the function of this gene, the gene CmSL in the corresponding melon variety can be mutated directly through gene editing technology, and then conventional hybridization with homozygous gene CmSL mutant plants and molecular marker-assisted selection can be used to obtain excellent varieties of melons with leaf shape mutations; or the gene CmSL can be transferred into a specific melon through genetic engineering, and then the gene is edited to cause the gene mutation to obtain melon materials with changed leaf shape, and then the material with gene mutation is used for sexual hybridization to separate melon materials with changed leaf shape from the offspring population. The CmSL gene can be used to improve the leaf shape of melons, which has important theoretical and application value.

[0042] In summary, the gene editing method of the present invention can quickly and effectively transform melon leaf materials with no notches on the leaf margins into melon materials with leaf shape variations with notches on the leaf margins, providing an economical, fast and effective way to create melon materials with diverse leaf shapes, and has important application value and market prospects in the breeding of new melon varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 This is the PCR detection of Cas9 gene in T0 generation gene-edited plants. Among them, CK is the negative untransformed M6 control, pBSE401::CmSL is the plasmid positive control, #1, #2 and #3 are the self-pollinated progenies of 3 positive transformed plants, and GL5000 is the molecular weight marker.

[0044] Figure 2 The genotype and seedling phenotype detection of T1 generation homozygous gene-edited plants. A is the gene editing site and mutation type of the positive plant; B is the seedling phenotype of the homozygous gene editing, and the white vertical line on the right is the scale bar, which is 5 cm.

[0045] Figure 3 The leaf phenotype of the 4-week-old T1 generation homozygous gene-edited plants. A is the leaf phenotype of the gene-edited plants, the white vertical line on the right is the scale, scale: 5 cm; B is the leaf shape index (length / width ratio) statistics, where a and b indicate that there is a significant difference between the two (Student T test, p<0.05). DETAILED DESCRIPTION

[0046] The following examples are only used to further illustrate the present invention and are not intended to limit the present invention. Unless otherwise specified, the experimental methods used in the following examples are generally carried out under conventional conditions, such as those described in Molecular Cloning Laboratory Manual (Second Edition, by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or under conditions recommended by the manufacturer.

[0047] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0048] The experimental material M6 used in the following examples (recorded in: Xin T, Tian H, Ma Y, Wang S, Yang L, Li X, Zhang M, Chen C, Wang H, Li H, Xu J, Huang S, Yang X. Targeted creating new mutants with compact plant architecture using CRISPR / Cas9 genome editing by an optimized genetic transformation procedure in cucurbit plants. Horticulture Research. 2022, 9: uhab086.) is available to the public from the applicant. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0049] The CRISPR / Cas9 vector is a pBSE401 vector, which is derived from the document “Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biology. 2014, 14: 327.” The public can obtain it from the applicant.

[0050] The quantitative tests in the following examples were all repeated at least three times, and the results were averaged.

[0051] Example 1. Acquisition of the CmSL gene sequence of melon

[0052] First, the reference genome sequence of the CmSL gene was obtained from the melon reference genome sequence database (http: / / cucurbitgenomics.org / v2 / ). The specific primers of the gene were designed using the online software Primer-BLAST (http: / / www.ncbi.nlm.nih.gov / ) (CmSL-1F: 5'-AAGGCAGATCCAAGGAAGGTG-3', sequence 1); CmSL-1R: 5'-ATAGTAATAACCCCCACCAACAA-3', sequence 2).

[0053] 2. Take 2-week-old seedlings of melon material M6, grind the samples with liquid nitrogen, and extract total RNA using the method provided by the polysaccharide and polyphenol plant total RNA rapid extraction kit (with gDNA filter) (R318, Beijing Jinbaite Biotechnology Co., Ltd.). Take about 1 μg of RNA and use the reverse transcription kit cDNA was synthesized using One-Step gDNA Removal and cDNASynthesis SuperMix kit (Beijing Quanshijin Biotechnology Co., Ltd.).

[0054] 3. Using the cDNA obtained in step 2 as a template, use primers CmSL-1F and CmSL-1R to amplify the coding region fragment of the CmSL gene.

[0055] The PCR reaction system was as follows: 25 μL of 2×PCR Buffer for KOD FX, 10 μL of dNTPs (2 mmol / L each), 2 μL of primers (10 μmol / L, 1 μL each of CmSL-1F and CmSL-1R), 1 μL of KOD FX enzyme (1 U / μL, TOYOBO), 2 μL of cDNA template, and ddH2O to 50 μL. Amplification reaction conditions: 94°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 59°C annealing for 30 s, 68°C extension for 1 min, 35 cycles; 68°C extension for 5 min, and storage at 16°C.

[0056] 4. The PCR amplification product was detected by 1% agarose gel electrophoresis, and the target DNA fragment was recovered and purified using an agarose gel recovery kit (DH101, Beijing Biomed Gene Technology Co., Ltd.).

[0057] 5. The purified target DNA fragment was sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing, and the obtained sequence was spliced ​​and aligned using DNAMAN software. The obtained nucleotide sequence is shown in Sequence 3 in the sequence table.

[0058] 6. The nucleotide sequence shown in Sequence 3 in the sequence listing includes: 5'-UTR, which is the nucleotide sequence from positions 1 to 135; the coding region sequence (CDS) of the CmSL gene, which is the nucleotide sequence from positions 136 to 873, which encodes the CmSL protein whose amino acid sequence is shown in Sequence 4 in the sequence listing; and 3'-UTR, which is the nucleotide sequence from positions 874 to 901.

[0059] Example 2: Construction of CRIPSR / Cas9 gene editing vector pBSE401::CmSL

[0060] 1. Obtaining the CRIPSR / Cas9 gene editing target sequence of the CmSL gene

[0061] The cDNA sequence of the CmSL gene shown in sequence 3 in the sequence table was submitted to the online target analysis database CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the PAM sequence was set to NGG, and the species data was set to Melon (Cucumis melo, v3.5) for CRIPSR / Cas9 target design. Finally, one sgRNA target was selected based on the targeting efficiency. The specific sequence is as follows:

[0062] sgRNA target: 5′-GCAGTAGTTGTAGTCGAAGT-3′ (sequence 5);

[0063] 2. Construction of CRIPSR / Cas9 gene editing vector for CmSL gene

[0064] (1) Design of sgRNA amplification primers

[0065] Design and construct sgRNA amplification primers according to the target sequence, specifically:

[0066] CmSL-2F:

[0067] 5'-ATATATGGTCTCGATTG GCAGTAGTTGTAGTCGAAGT GTTTAGAGACCAATAAT-3' (sequence 6), the italics are the Bsa I restriction enzyme recognition site, and the underline is the target sequence.

[0068] CmSL-2R:

[0069] 5'-ATTATTGGTCTCTAAAC ACTTCGACTACAACTACTGC CAATC

[0070] GAGACCATATAT-3' (sequence 7), the italicized text is the Bsa I restriction enzyme recognition site, and the underlined text is the target sequence.

[0071] CmSL-2R is the reverse complementary sequence of CmSL-2F. The above single-stranded DNA nucleotide sequences were synthesized and prepared into 10 μmol / L working solutions, 5 μL of CmSL-2F and 5 μL of CmSL-2R primer working solutions were mixed evenly and placed on a PCR instrument for DNA double-strand synthesis. The program was set as follows: denaturation at 94°C for 30s, followed by gradual annealing to 10°C at a rate of 0.1°C / s.

[0072] (2) Take the CRISPR / Cas9 vector, i.e., pBSE401 vector, and digest it with the restriction endonuclease BsaI. The 25 μL digestion system is as follows: 15 μL pBSE401 vector (100 ng / μL), 2 μL Green buffer, 1 μL of BsaI and 7 μL of ddH2O were added, and the digestion was carried out at 37°C for 4 h. The digestion product was subjected to 1% agarose gel electrophoresis, and the linearized plasmid fragment was recovered using an agarose gel recovery kit (DH101, Beijing Biomed Gene Technology Co., Ltd.).

[0073] (3) The double-stranded DNA product obtained in step (1) and the vector digestion product obtained in step (2) are connected using a recombinase. The connection system is as follows: 2 μL of double-stranded DNA product (step (1)), 3 μL of pBSE401 digested vector (step (2)), 5 μL of -Uni Seamless Cloning and Assembly Kit (Beijing Quanshijin Biotechnology Co., Ltd.). The reaction system was placed in a 50°C water bath for 15 minutes and then stored in a -20°C refrigerator for later use.

[0074] The ligation product was transformed into Escherichia coli Trans10 (Beijing Quanshijin Biotechnology Co., Ltd.), and clones were selected and sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing to obtain the clones with correct recombination. The plasmid of the positive clone was extracted to obtain the recombinant plasmid pBSE401::CmSL.

[0075] Example 3. Obtaining gene-edited plants and identifying their phenotypes

[0076] 1. Transformation of Agrobacterium with recombinant plasmid pBSE401::CmSL

[0077] Take 100ng of the gene editing vector pBSE401::CmSL prepared in Example 2, and transfer it into EHA105 Agrobacterium competent cells (BC303-01, Beijing Bomade Gene Technology Co., Ltd.) by heat shock method, and culture in the dark at 28°C for 2-3 days. Pick a single colony and place it in LB liquid medium containing 50μg / mL kanamycin and 50μg / mL rifampicin, shake and culture overnight at 28°C to obtain a transformant. Take 1μL of bacterial solution, use Cas-468F (5'-ACAAGCTGATCCGGGAAGTG-3', sequence 8) and Cas-468R (5'-CTGTCTGCACCTCGGTCTTT-3', sequence 9) as primers, and perform bacterial solution PCR identification by high-fidelity KOD FX enzyme (TOYOBO).

[0078] The PCR reaction system was as follows: 10 μL 2×PCR Buffer for KOD FX enzyme, 4 μL dNTPs (2 mmol / L each), 1 μL primer (10 μmol / L, 0.5 μL each for Cas-468F and Cas-468R), 0.4 μL KOD FX enzyme (1 U / μL, TOYOBO), 1 μL bacterial template, and ddH2O to 20 μL. Amplification reaction conditions: 94°C pre-denaturation for 2 min; 98°C denaturation for 10 s, 59°C annealing for 30 s, 68°C extension for 1 min, 35 cycles of amplification; then 68°C extension for 5 min, and storage at 4°C.

[0079] The PCR product was subjected to gel electrophoresis using 1% agarose gel electrophoresis, and the colony with a specific amplified fragment of about 468 bp was the positive recombinant bacterium ( Figure 1 ), named as pBSE401::CmSL / EHA105, and then the strain was frozen at -80°C for future use.

[0080] 2. Obtaining melon editing plants

[0081] (1) Obtaining T0 generation positive transgenic melon plants

[0082] The recombinant bacteria pBSE401::CmSL / EHA105 was transformed into the recipient wild-type melon material M6 using the Agrobacterium-mediated genetic transformation method (reference Xin T, Tian H, Ma Y, Wang S, Yang L, Li X, Zhang M, Chen C, Wang H, Li H, Xu J, Huang S, Yang X. Targeted creating new mutants with compact plant architecture using CRISPR / Cas9 genome editing by an optimized genetic transformation procedure in cucurbit plants. Horticulture Research. 2022, 9: uhab086.), and finally three T0 generation regenerated plants were obtained, named #1, #2 and #3 respectively. The genomic DNA of the above three T0 generation regenerated plants was extracted respectively by the CTAB method, and the different plants were identified by PCR using primer pairs Cas-468F (sequence 8) and Cas-468R (sequence 9) according to the method in Example 3 (I). The identification results are as follows Figure 1 As shown. It shows that all three T0 generation regenerated plants are positive plants. Then, the three T0 generation positive plants were self-pollinated to obtain T0 generation seeds.

[0083] (2) Genotype identification of T1 positive transgenic melon plants

[0084] The target-specific detection primers of CmSL gene were designed by using the online software Primer-BLAST (http: / / www.ncbi.nlm.nih.gov / ) (CmSL-3F: 5'-ACCACACAAAACCACAAGACAA-3', sequence 10); CmSL-3R: 5'-CGCAAGGACAGTGTCACAAAT-3', sequence 11). Twenty T0 seeds were sown to obtain T1 plants. The genomic DNA of each plant was extracted by the CTAB method. The target of CmSL gene was then identified by using the primers CmSL-3F and CmSL-3R using the high-fidelity KOD FX enzyme (TOYOBO).

[0085] The PCR reaction system was as follows: 2×PCR Buffer for KOD FX 25μL, 10μL dNTPs (2mmol / Leach), 2μL primers (10μmol / L, 1μL each of CmSL-3F and CmSL-3R), 1μL KOD FX enzyme (1U / μL, TOYOBO), 2μL genomic DNA template, add ddH2O to 50μL. Amplification reaction conditions: 94℃ pre-denaturation for 2min; 98℃ denaturation for 10s, 59℃ annealing for 30s, 68℃ extension for 1min, 35 cycles; 68℃ extension for 5min, 16℃ storage.

[0086] The PCR amplification product was directly sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for sequencing. The nucleotide sequence obtained from the control M6 (ie, wild type) is shown as sequence 12 in the sequence table.

[0087] After sequencing and identification, homozygous edited plants of the CmSL gene were identified from the T1 positive plants of #1, #2 and #3, that is, the CmSL genes of the two homologous chromosomes of the plant had the same mutation, and the plants were obtained by keeping the other sequences of the genome unchanged. One plant was selected from each for subsequent analysis, and they were named cmsl-cr#1, cmsl-cr#2 and cmsl-cr#3 respectively. Among them, the mutation site of cmsl-cr#1 is the TC base deletion at the 37th-38th position downstream of the ATG of the CmSL gene (the 172nd-173rd base of sequence 3 in the sequence list), the mutation site of cmsl-cr#2 is the C base deletion at the 38th position downstream of the ATG of the CmSL gene (the 173rd base of sequence 3 in the deletion sequence list), and the mutation site of cmsl-cr#3 is the insertion of four bases T in succession after the 37th base T downstream of the ATG of the CmSL gene (after the 172nd base T of sequence 3 in the sequence list) ( Figure 2 A) All three of the above situations can lead to frameshift of the reading frame, premature termination of the encoded protein and loss of function.

[0088] 3. Obtaining leaf shape variation materials of T1 generation positive transgenic plants

[0089] Phenotypic observations were performed on the three homozygous gene-edited plants 21 days after sowing. Figure 2 B. At this point, it can be seen that the leaf shapes of the three mutants are significantly different from those of the wild-type M6. After another week, mature leaves were collected and photographed. See the photos for details. Figure 3 A. The results showed that compared with the wild-type leaf shape with a heart-shaped leaf and uniform fine serrations on the leaf edge, the leaf edges of the three homozygous gene-edited plants were notched to varying degrees, and the leaf length-width ratio changed, resulting in a change in leaf shape. The T test showed that the leaf length-width ratio of the mutant strain was significantly different from that of the wild-type, see Figure 3 B. The length-to-width ratio of a blade is the ratio of the maximum vertical length to the maximum horizontal width of the blade when the blade is placed horizontally.

[0090] From the above results, it can be seen that using the gene editing method of the present invention to edit the CmSL gene can quickly produce melon materials with changed leaf shape, and this variation can be stably inherited. The mutated CmSL gene can also be directly applied to the creation and breeding of new melon germplasm by sexual hybridization, which has important application value and breeding prospects.

[0091] The above embodiments are merely exemplary descriptions of the present invention, but the implementation methods of the present invention are not limited to the species or materials in the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not violate the spirit and principles of the present invention shall be equivalent replacement methods and fall within the protection scope of the present invention.

Claims

1. A protein CmSL that controls the shape of muskmelon leaves, having an amino acid sequence as described in any one of (1) to (3): (1) the amino acid sequence shown in Sequence 4 in the sequence listing; (2) An amino acid sequence derived from the amino acid sequence shown in Sequence 4 in the sequence listing by adding, substituting or deleting one or more amino acids, and the derived amino acid sequence has the function of regulating the leaf shape of melon; (3) an amino acid sequence derived from musk melon, having at least 90% homology with the amino acid sequence of (1) or (2) and having the function of controlling the leaf shape of musk melon; The controlling of the melon leaf shape comprises controlling the leaf margin of the melon to have no notches.

2. The melon leaf shape controlling gene CmSL, the nucleotide sequence of its cDNA is any one of the following (a1) to (a3): (a1) a DNA sequence encoding the amino acid sequence according to claim 1 of the present invention; (a2) the DNA sequence shown in Sequence 3 in the sequence listing; (a3) a DNA sequence that hybridizes with the DNA sequence described in (a1) under stringent conditions and encodes a protein molecule that controls the function of melon leaf shape; The controlling of the melon leaf shape comprises controlling the melon leaf shape to have no notches on the leaf margin.

3. A biological material related to the protein of claim 1 or the gene of claim 2, wherein the biological material is selected from the following (a) or (b): (a) a substance for silencing, inhibiting or knocking out the gene encoding the protein CmSL according to claim 1 or the gene according to claim 2; (b) A substance for reducing or inhibiting the activity and / or content of the protein CmSL according to claim 1 in melon.

4. The biomaterial according to claim 3, characterized in that The biological material is a melon CRISPR / Cas9 genome editing system, which includes: a recombinant expression vector, wherein the recombinant expression vector includes a Cas9 expression cassette and an sgRNA expression cassette, wherein the Cas9 expression cassette expresses Cas9, and the sgRNA expression cassette expresses sgRNA, and the target gene of the sgRNA is a gene encoding the protein CmSL in melon.

5. The biomaterial according to claim 4, characterized in that The target sequence of the sgRNA is the DNA molecule shown in Sequence 5 in the sequence list, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in Sequence 5 in the sequence list.

6. Use of the biological material according to any one of claims 3 to 5 in creating melon materials with leaf shape variations or in melon breeding, wherein the melon materials with leaf shape variations are melon leaf shape variations with notched leaf margins.

7. A method for changing the leaf shape of a melon, characterized in that: The method comprises: using the melon CRISPR / Cas9 genome editing system described in claim 4 to edit the gene CmSL in the genome of the melon material whose leaf shape is to be changed, thereby causing the CmSL function to be lost, thereby obtaining a melon material with a leaf shape variation.

8. The method according to claim 7, characterized in that The melon material with leaf shape variation is a melon material with notches on the leaf margin.

9. The method according to claim 7, characterized in that: The method specifically comprises: S1: introducing the melon CRISPR / Cas9 genome editing system of claim 4 into the melon material whose leaf shape is to be changed, and obtaining the successfully transformed plants through screening; S2: obtaining a gene CmSL mutant strain from the successfully transformed plants through identification; The identification is to use the genome of the successfully transformed plant as a template to perform PCR amplification of the gene CmSL fragment, and then detect it by gel electrophoresis or sequencing to obtain a strain with a gene CmSL mutation.

10. The method according to claim 9, characterized in that The nucleotide sequences of the primer pairs used in the PCR amplification are shown in Sequence 10 and Sequence 11 in the sequence listing.

Images