Sour fish combined lactobacillus SAAS-B-MRS-2020810-9, sour fish combined lactobacillus microbial inoculum as well as preparation method and application of sour fish combined lactobacillus microbial inoculum

Abstract

The invention provides a sour fish combined lactobacillus strain SAAS-B-MRS-2020810-9, a sour fish combined lactobacillus microbial inoculum as well as a preparation method and application of the sour fish combined lactobacillus microbial inoculum, and belongs to the technical field of microorganisms. According to the invention, a strain is separated from the fermentation process of pickled Chinese cabbages, and is identified as lactobacillus acidophilus, the strain is a safe strain capable of being used for food, and a large amount of nonanal can be directly synthesized through microbial metabolism; the bacterial strain has good growth characteristics in salt brine and vegetable juice, and the nonanal yield is 41.81 mu g / kg when the bacterial strain is used for fermenting vegetable products. When the strain is applied to the fermented product, the flavor formation in the maturing process of the fermented vegetable product can be improved, the product is endowed with rose and orange fragrance, the fermentation rate of the fermented product is effectively increased, the flavor of the product is increased, the quality of the product is improved, and the strain has wide application prospects in the field of the fermented vegetable product.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a sour fish combined lactobacillus SAAS-B-MRS-2020810-9 and a sour fish combined lactobacillus bacterial agent, and a preparation method and application thereof. Background Art

[0002] Nonanal (C9H 18 O), is one of the important flavor compounds in fermented foods, usually giving cheese, white wine, red wine, pickles, bean curd and other fermented foods the aroma of roses and citrus. When its concentration reaches 1μg / kg, it can contribute to the unique aroma of fermented vegetables in terms of flavor sensory quality, making the aroma of fermented vegetables more mellow and coordinated. Usually, the yield of nonanal in the vegetable fermentation process is low. In production, in order to achieve the purpose of flavor enhancement, exogenous addition is often used to improve the flavor of fermented vegetable products. However, due to the risk of impurities in exogenous additives, the increase in nonanal content through exogenous addition often results in poor product safety and instability in product quality, which limits the large-scale production application of exogenous addition of nonanal in improving the flavor of fermented foods. In addition, in the process of vegetable fermentation, there are relatively few types of lactic acid bacteria that can produce nonanal, and there is still a lack of exploration of lactic acid bacteria resources with ideal yield effects and aroma production effects. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a strain of acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 and an acid fish combined with Lactobacillus bacterial agent and a preparation method and application thereof. The present invention increases the nonanal content in fermented vegetables by fermenting food using acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9, thereby improving the flavor of the fermented food.

[0004] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0005] The invention provides a strain of Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9, wherein the strain of Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9 was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 22, 2024, with a deposit number of GDMCC NO: 64904.

[0006] Preferably, the 16SrRNA sequence of the acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 strain is as shown in SEQID NO.1.

[0007] The invention provides a sour fish combined with lactobacillus bacterial agent, wherein the sour fish combined with lactobacillus SAAS-B-MRS-2020810-9 strain is contained in the bacterial agent.

[0008] Preferably, the live bacteria concentration of the acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 strain in the bacterial agent is 1.0×10 8 ~1.0×10 9 CFU / mL.

[0009] The invention provides a method for preparing a sour fish combined with lactobacillus bacterial agent. The sour fish combined with lactobacillus SAAS-B-MRS-2020810-9 strain is activated and cultured, the bacterial bodies are collected, the bacterial bodies are mixed with a lyophilization protective agent, and freeze-dried to obtain the sour fish combined with lactobacillus bacterial agent.

[0010] Preferably, the lyophilization protectant is sterile skim milk.

[0011] The invention provides application of the strain and the acid fish combined lactobacillus agent in preparing fermented food.

[0012] Preferably, the application is to increase the nonanal content in fermented food.

[0013] The present invention also provides application of the strain and the acid fish combined with lactobacillus bacterial agent in producing nonanal.

[0014] The present invention also provides a fermented vegetable, and the preparation steps of the fermented vegetable are as follows:

[0015] (1) mixing the processed vegetables with brine to obtain a vegetable brine mixture;

[0016] (2) inoculating the strain or the acid fish combined lactobacillus agent into a vegetable brine mixture at an inoculation rate of 0.5% to 2% (m / v), and fermenting to obtain fermented vegetables.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The present invention obtains a strain by isolating from the sauerkraut fermentation process, which is identified as acid fish combined with Lactobacillus acidipiscis, named SAAS-B-MRS-2020810-9, which is a safe strain that can be used for food, and can directly synthesize nonanal in large quantities through microbial metabolism; the strain has good growth characteristics in brine and vegetable juice, and the nonanal production is 41.81 μg / kg when using acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 to ferment vegetable products. The strain is applied to fermented products, which can improve the flavor formation of fermented vegetable products during the maturation process, give the product the aroma of rose and citrus, can effectively increase the fermentation rate in fermented products, increase the product flavor, and is conducive to the improvement of product quality characteristics, and has broad application prospects in the field of fermented vegetable products.

[0019] (2) The acid fish combined lactobacillus SAAS-B-MRS-2020810-9 of the present invention has a wide growth temperature range, can grow in the range of 15 to 38 ° C, and has an optimal growth temperature of 30 to 37 ° C; the strain grows rapidly in MRS medium, and the bacterial count can reach 3.8×10 8 CFU / mL, reaching a maximum bacterial count of 7.3×10 9 CFU / mL. The lag phase of the strain is relatively short, entering the logarithmic growth phase at 4h and reaching the stable phase at 30h. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the GC-MS total ion current diagram of the fermented vegetables in Example 1;

[0021] Figure 2 This is the colony morphology of acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9;

[0022] Figure 3 This is the cell morphology of acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 (×1600);

[0023] Figure 4 It is a growth curve of acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9;

[0024] Figure 5 This is the OD value diagram of acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 at different temperatures;

[0025] Figure 6 This is the OD value graph of acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 at different pH values.

[0026] Biological Deposit Description

[0027] Sour fish combined with Lactobacillus SAAS-B-MRS-2020810-9, Latin name is Ligilactobacillusacidipiscis, the strain is preserved in Guangdong Microbial Culture Collection Center, address: Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, preservation date: July 22, 2024, preservation number: GDMCC NO: 64904. DETAILED DESCRIPTION

[0028] The invention provides a strain of Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9, wherein the strain of Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9 was deposited in Guangdong Provincial Microbiological Culture Collection Center on July 22, 2024, with a deposit number of GDMCC NO: 64904.

[0029] In the present invention, the 16SrRNA sequence of the acid fish combined lactobacillus SAAS-B-MRS-2020810-9 strain is shown in SEQ ID NO.1, which is as follows:

[0030]

[0031] The invention provides a sour fish combined with lactobacillus bacterial agent, wherein the sour fish combined with lactobacillus SAAS-B-MRS-2020810-9 strain is contained in the bacterial agent.

[0032] In the present invention, the bacterial agent is a direct-injection fermentation agent; the live bacteria concentration of the acid fish combined lactobacillus SAAS-B-MRS-2020810-9 strain in the bacterial agent is 1.0×10 8 ~1.0×10 9 CFU / mL.

[0033] The invention provides a method for preparing a sour fish combined with lactobacillus bacterial agent. The sour fish combined with lactobacillus SAAS-B-MRS-2020810-9 strain is activated and cultured, the bacterial bodies are collected, the bacterial bodies are mixed with a lyophilization protective agent, and freeze-dried to obtain the sour fish combined with lactobacillus bacterial agent.

[0034] In the present invention, the acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 strain is activated and cultured, and the activation culture method is: streak the acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 strain on an MRS agar medium plate, place it in an incubator at 33-40°C, preferably at 35-38°C, more preferably at 37°C, and culture for 45-50h, preferably at 47-49h, more preferably at 48h, until a single colony grows, thereby obtaining an activated strain.

[0035] In the present invention, the method for collecting bacteria is: inoculating the activated bacteria into 25-75 mL of MRS broth liquid culture medium, preferably 35-65 mL, and more preferably 50 mL, placing it in an incubator at 33-40°C, preferably 35-38°C, and more preferably 37°C, culturing for 45-50 hours, preferably 46-49 hours, and more preferably 48 hours to obtain a culture solution, centrifuging the culture solution at a speed of 8000-12000 rpm, preferably 9000-11000 rpm, and more preferably 10000 rpm for 10-30 minutes, preferably 15-25 minutes, and more preferably 20 minutes, and washing the precipitate obtained by centrifugation with a sterile phosphate buffer solution for 1-5 times, preferably 2-4 times, and more preferably 3 times, and then collecting the bacteria. The concentration of the sterile phosphate buffer solution is 40-60 mM, preferably 45-55 mM, and more preferably 50 mM. The pH of the sterile phosphate buffer solution is 6.0-7.2, preferably 6.5-7.0, and more preferably 6.8.

[0036] In the present invention, the freeze-dried protective agent is sterile skim milk, and the preparation method of the sterile skim milk is as follows: add skim milk powder of 15% to 25% of the mass of pure water, preferably 17% to 22%, and more preferably 20%, 1% to 3% of glucose, preferably 1.5% to 2.5%, and more preferably 2%, 20% to 40% of glycerol, preferably 25% to 35%, and more preferably 30% to pure water; after fully dissolving, sterilize at 115°C for 15 to 30 minutes, preferably 17 to 25 minutes, and more preferably 20 minutes; cool to 35 to 40°C, preferably 36 to 38°C, and more preferably 37°C to obtain sterile skim milk.

[0037] The invention provides application of the strain and the acid fish combined lactobacillus agent in preparing fermented food.

[0038] In the present invention, the application is to increase the nonanal content in fermented food; the fermented food is any one of dairy products, bean products and fruit and vegetable products.

[0039] The present invention also provides application of the strain and the acid fish combined with lactobacillus bacterial agent in producing nonanal.

[0040] The present invention also provides a fermented vegetable, and the preparation steps of the fermented vegetable are as follows:

[0041] (1) mixing the processed vegetables with brine to obtain a vegetable brine mixture;

[0042] (2) inoculating the strain or the acid fish combined lactobacillus agent into a vegetable brine mixture at an inoculation rate of 0.5% to 2% (m / v), and fermenting to obtain fermented vegetables.

[0043] In the present invention, the treated vegetables are mixed with brine to obtain a vegetable brine mixture. The vegetables include: one or more of red erjintiao, red radish, red chili, cowpea, mustard, and cabbage. The method for processing the vegetables is: the vegetables are sorted to remove impurities and inedible parts, the vegetables are processed and cut into blocks or strips, the vegetables are disinfected with a disinfectant for 3 to 5 minutes, the number of microorganisms in the vegetables is controlled to be ≤300 CFU / g, and then rinsed with clean water for 3 to 5 minutes, drained and set aside, and the treated vegetables are obtained. The disinfectant is a sodium hypochlorite solution, and the concentration of the sodium hypochlorite solution is 4 to 10 g / L, preferably 5 to 8 g / L, and more preferably 6 g / L. The preparation method of the brine is as follows: adding 0.5% to 1.5% of old ginger, preferably 0.7% to 1.2%, more preferably 1% by weight of the pure water; 1% to 3% of wild pepper, preferably 1.5% to 2.5%, more preferably 2%; 0.1% to 0.4% of cinnamon, preferably 0.15% to 0.3%, more preferably 0.2%; 1% to 7% of salt, preferably 3% to 5%, more preferably 4%; 1% to 5% of glucose, preferably 1.5 % to 3%, more preferably 2%; after heating and boiling for 30 to 60 minutes, preferably 40 to 50 minutes, more preferably 45 minutes; cooled to 15 to 30°C, filtered through filter cloth to obtain kimchi brine, that is, salt brine, the filter cloth is 100 to 400 mesh, preferably 200 to 350 mesh, more preferably 300 mesh; the mass volume ratio of the processed vegetables to the salt brine is 1g:8 to 12mL, preferably 1g:9 to 11mL; more preferably 1g:10mL.

[0044] In the present invention, the strain or the acid fish combined lactobacillus agent is inoculated into a vegetable brine mixture at an inoculation rate of 0.5% to 2% (m / v), and fermented to obtain fermented vegetables. The fermentation temperature is 20 to 30° C., preferably 23 to 27° C., preferably 25° C., and the fermentation time is 7 to 14 days, preferably 8 to 12 days, and more preferably 10 days; the total acid content in the fermented vegetables reaches 0.6% of the vegetable mass, and the total acid is calculated as lactic acid; the fermented vegetables are rich in the aroma of roses and citrus.

[0045] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0046] The conventional leavening agent used in the present invention is a commercially available leavening agent (purchased from Beijing Chuanxiu Technology Co., Ltd., lactic acid bacteria fermentation powder-Lactobacillus plantarum).

[0047] In the embodiment of the present invention, the total acid is 0.6% (calculated as lactic acid), which means that the lactic acid content reaches 0.6% of the mass of the vegetables.

[0048] Example 1 Acid fish combined with Lactobacillus (Ligilactobacillus acidipiscis) SAAS-B-MRS-2020810-9 strain isolation method

[0049] 1. Obtain a suitable dilution gradient and culture

[0050] Samples were taken from the fermentation process of sauerkraut in Guanghan City, Sichuan Province. 5 g was weighed and added to 45 mL of sterile water. After gradient dilution, 4 dilutions were taken, namely 10 -1 , 10 -2 , 10 -3 , 10 -4 100 μL of each bacterial suspension was spread on MRS solid culture medium and cultured at 37°C for 48 h.

[0051] 2. Separation and purification

[0052] Use the plate streak method to select typical single colonies, and repeat the culture and selection operation to obtain strains with excellent traits.

[0053] 3. Initial screening of strains

[0054] Single colonies were picked for Gram staining and catalase tests. Gram-positive and hydrogen peroxide-negative bacteria were purified by plate purification, and stored in 30% (v / v) glycerol tubes at -80°C after centrifugation at 10,000 rpm for 5 min.

[0055] 4. Rescreening

[0056] Determination of the ability to produce nonanal

[0057] (1) Preparation of sterile skim milk

[0058] Weigh 20% skim milk powder, 2% glucose and 2% glycerol by mass of pure water, add pure water to fully dissolve them, sterilize at 115°C for 20 minutes, and then cool to 37°C to obtain sterile skim milk.

[0059] (2) Bacterial Activation

[0060] The lactic acid bacteria obtained in the initial screening were streaked on MRS agar plates and cultured in a 37°C incubator for 48 h until a single colony grew out to obtain plate-activated strains.

[0061] (3) Preparation of working starter

[0062] Use an inoculation loop to take a loop of the activated bacterial strain obtained in step (2) and inoculate it into a 250 mL Erlenmeyer flask containing 50 mL of MRS broth liquid culture medium, and place it in an incubator at 37° C. and culture it for 48 hours to obtain a culture solution.

[0063] The culture solution obtained above was centrifuged at a speed of 10000 rpm for 20 min. The precipitate obtained by centrifugation was washed three times with sterile phosphate buffer solution (50 mM, pH 6.8), and then 2 mL of sterile skim milk was added to the washed precipitate and vortexed to resuspend the bacteria to obtain a resuspended bacterial culture solution.

[0064] The resuspended bacterial culture solution was introduced into a glass ampoule under sterile conditions, with the liquid level at 0.9±0.1 cm. The ampoule was capped and quickly frozen at -80°C. The glass ampoule was then placed on a tray and placed in a freeze dryer for freeze drying to obtain a working starter culture with a viable count of 10 8 CFU / mL.

[0065] (4) Vegetable pretreatment

[0066] After removing impurities and inedible parts from the red radish, cut the red radish into blocks or strips, disinfect it with a disinfectant containing sodium hypochlorite for 5 minutes, and control the number of microorganisms in the vegetables to be ≤300 CFU / g; then rinse it with clean water for 5 minutes, drain it for later use, and obtain pretreated vegetables.

[0067] (5) Preparation of brine

[0068] Weigh 1% of old ginger, 2% of wild pepper, 0.2% of cinnamon, 4% of salt and 2% of glucose by mass of pure water, add pure water and heat to boil for 45 minutes, cool the boiled brine to room temperature (15-30° C.), filter through a 300-mesh filter cloth to obtain kimchi brine, that is, salt brine.

[0069] (6) Preparation of vegetable brine mixture

[0070] The pretreated vegetables obtained in step (4) are mixed with the brine obtained in step (5) in a ratio of 1 g:10 mL to obtain a vegetable brine mixture.

[0071] (7) Fermentation culture

[0072] The working starter and the conventional starter were inoculated into the vegetable brine mixture at an inoculation rate of 1.5% (m / v), and the temperature was controlled at 25°C. The fermentation was carried out for 14 days until the total acidity reached 0.6%, thereby obtaining fermented vegetables. Fermented vegetables obtained by fermenting with the conventional starter alone were used as a control group.

[0073] (8) GC-MS measurement of nonanal content in vegetable fermentation

[0074] The samples were sent to Sichuan Min'en Testing Technology Co., Ltd. for nonanal content testing.

[0075] The chromatographic conditions are as follows: 5 g of the fermented vegetables obtained above were weighed, 1.3 g of NaCl was added, and methyl octanoate was used as the internal standard (73 μg / mL, sample volume 20 μL) for quantitative analysis and placed in a headspace solid phase microextraction vial. The detection of aroma compounds in fermented vegetables was completed, and the content of nonanal in the fermented vegetables was determined. The mass spectrum of nonanal in the fermented vegetable sample is shown in Figure 1 .

[0076] DB-WAX-UI capillary column; column specifications: 30m×0.25μm×0.25μm, inlet temperature of 240℃, column flow rate of 35cm / s, carrier gas is helium; programmed temperature: initial temperature 40℃, hold for 10min; increase the temperature to 90℃ at 10℃ / min, hold for 15min; increase the temperature to 130℃ at 20℃ / min, hold for 5min; increase the temperature to 250℃ at 20℃ / min, hold for 5min.

[0077] The mass spectrometry conditions were as follows: ionization mode EI, emission energy 74 eV, ion source temperature 230 °C, interface temperature 280 °C, quadrupole temperature: 150 °C, mass-to-charge ratio 15 to 500. The substances were qualitatively identified by searching the NIST 2017 standard spectral library and comparing with standards, and the peak area normalization method was used to calculate the peak area of ​​each component, expressed as μg / kg of vegetable products.

[0078] (9) Changes in nonanal content during fermentation

[0079] By measuring the content of nonanal in fermented vegetables, the strain Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9, which produces the largest amount of nonanal, was screened out.

[0080] When fermented for 14 days using the working starter containing acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9, the nonanal content in the fermented vegetables obtained by fermentation with the working starter was 41.81 μg / kg; the nonanal content in the fermented vegetables fermented with the conventional starter was 0 μg / kg.

[0081] Example 2 Identification of acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9

[0082] 1. PCR amplification of 16S rRNA sequence

[0083] Pick a single colony on the MRS agar medium, add it to 10 μL of sterile water, mix well, and use it as a template for colony PCR.

[0084] 1) The PCR system is based on 25 μL, of which Mix is ​​12.5 μL, 27F is 0.5 μL, 1492R is 0.5 μL, and ddH2O is 11.5 μL.

[0085] The primers used were 27F: AGAGTTTGATCCTGGCCTCA (SEQ ID NO. 2) and 1492R: GGTTACCTTGTTACGACTT (SEQ ID NO. 3). The length of the amplified fragment was 1500 bp.

[0086] 2) PCR conditions:

[0087] The DNA double-strand was pre-denatured at 94°C for 10 min; denatured at 94°C for 30 s; annealed at 50°C for 30 s; extended at 72°C for 80 s, and cycled 29 times, and finally kept at 72°C for 7 min.

[0088] 2. Agar gel electrophoresis

[0089] Weigh 0.5g agarose and dissolve it in 50mL TBE buffer. After heating to dissolve, add 5μL of EB dye. After the gel is solidified, add 4±1μL of sample to each spot well. Run at 120V for 20min. Observe the image of the gel plate under UV, select the PCR products with clear bands and send them to Beijing Liuhe BGI Genomics Co., Ltd. for sequencing.

[0090] 3. 16S rRNA sequence analysis and identification

[0091] After sequencing by Beijing Liuhe BGI Technology Co., Ltd., the 16S rRNA of the acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 is shown in SEQ ID NO.1:

[0092]

[0093] The isolated SAAS-B-MRS-2020810-916S rRNA sequence was compared with the GenBank / EMBL / DDBJ database using the BLAST analysis tool (http: / / www.ncbi.nlm.nih.gov / blast) and was identified as Ligilactobacillus acidipiscis.

[0094] The bacterial colony is shown in Figure 2 As shown, the colony characteristics are: 0.2mm~0.5mm, slightly raised, smooth, moist, opaque milky white colonies.

[0095] The cell morphology of the bacteria (×1600) is as follows Figure 3 As shown, the bacterial characteristics are: the bacteria are rod-shaped, scattered individually or arranged in twos, and occasionally arranged in chains of varying lengths.

[0096] Based on the microbiological characteristics such as morphological characteristics, physiological and biochemical characteristics and its genetic characteristics 16S rRNA, SAAS-B-MRS-2020810-9 was identified as Ligilactobacillus acidipiscis.

[0097] The acid fish combined Lactobacillus (Ligilactobacillus acidipiscis) has been deposited in the China Type Culture Collection Center (GDMCC for short), the preservation address is: Guangdong Institute of Microbiology, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Postal Code: 510075, the preservation number is GDMCCNO: 64904, the preservation date is July 22, 2024, and it is named SAAS-B-MRS-2020810-9.

[0098] Example 3 Growth and fermentation characteristics of acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9

[0099] (1) Growth curve of the acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 strain

[0100] The acid fish combined Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 obtained in Example 1 and stored at -80°C was inoculated into MRS liquid culture medium and cultured at 37°C for 48 hours to obtain an activated strain.

[0101] The activated strain was inoculated into MRS liquid culture medium at a 2% (v / v) inoculation rate and cultured at 37°C for 36 h. The OD value of the culture solution was measured at 600 nm every 4 h. The growth curve of the strain was obtained by plotting the OD value against time. The results are shown in Figure 4 .

[0102] The results showed that the acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 grew rapidly in MRS medium, and the bacterial count could reach 1.5×10 8 The maximum bacterial count reached 7.3×10 CFU / mL after 28 hours. 9 CFU / mL. The lag phase of the strain is relatively short, entering the logarithmic growth phase at 4h and reaching the stable phase at 28h.

[0103] (2) Determination of the optimal growth temperature of the acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 strain

[0104] The activated strains were inoculated at 2% (V / V) in 10 mL of MRS liquid culture medium and cultured at 5°C, 10°C, 15°C, 25°C, 30°C, 35°C, 37°C and 40°C for 48 h. Uninoculated MRS liquid culture medium was used as a control. The OD values ​​of the culture solutions at different temperatures were measured at 600 nm to determine the optimal growth temperature. The results are shown in Table 1. Figure 5 .

[0105] The results showed that Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9 had a wide growth temperature range, from 10°C to 40°C, and grew well at 25°C to 37°C, with the optimal growth temperature being 37°C.

[0106] (3) Determination of the optimal growth pH of the acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 strain

[0107] The activated bacteria were inoculated into MRS liquid culture medium with pH values ​​of 9.0, 8.0, 7.0, 6.0, 5.0, 4.0, and 3.0 at a 2% (v / v) inoculation rate, and cultured at 37°C for 72 h. The OD value of the culture medium was measured. The results are shown in Table 1. Figure 6 .

[0108] The results showed that Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9 grew well at pH 5.0-9.0, and the optimal growth pH was 7.0-8.0.

[0109] Example 4 Starter containing acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9

[0110] (1) Preparation of sterile skim milk

[0111] Weigh 20% skim milk powder, 2% glucose and 2% glycerol by mass of pure water, add them into pure water to fully dissolve them, sterilize them at 115°C for 20 minutes, and then cool them to 37°C to obtain sterile skim milk.

[0112] (2) Bacterial Activation

[0113] Use an inoculating loop to take a loop of the acid fish combined lactobacillus (Ligilactobacillus acidipiscis) SAAS-B-MRS-2020810-9 of Example 1 dissolved in sterile water and stored in a freeze-dried tube, streak it on an MRS agar medium plate, and culture it in a 37°C incubator for 48 hours until a single colony grows, thereby obtaining a plate-activated strain.

[0114] (3) Preparation of starter culture

[0115] The mixture was cultured in a 37°C constant temperature incubator for 24 h to obtain culture fluid;

[0116] The culture solution was centrifuged at a speed of 10,000 rpm for 20 min, and the precipitate obtained by centrifugation was washed three times with a sterile phosphate buffer solution (50 mM, pH 6.8), and then 2 mL of sterile skim milk solution was added to the washed precipitate and vortexed to resuspend the bacteria;

[0117] The resuspended bacterial culture solution was introduced into a glass ampoule under sterile conditions, with a liquid level of 0.9±0.1 cm, and the bottle stopper was placed in a -80°C quick freezer, and then the glass ampoule was placed in a tray and placed in a freeze dryer for freeze drying to obtain a starter containing acid fish combined lactobacillus (Ligilactobacillus acidipiscis) SAAS-B-MRS-2020810-9, and the number of viable bacteria in the starter was 10 8 CFU / mL.

[0118] Example 5 Fermented vegetables containing acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9

[0119] (1) Vegetable pretreatment

[0120] After removing impurities and inedible parts from the red radish, cut the red radish into blocks or strips, disinfect it with a disinfectant containing sodium hypochlorite for 5 minutes, and control the number of microorganisms in the vegetables to be ≤300 CFU / g; then rinse it with clean water for 5 minutes, drain it for later use, and obtain pretreated vegetables.

[0121] (2) Preparation of brine

[0122] Weigh 1% of old ginger, 2% of wild pepper, 0.2% of cinnamon, 4% of salt and 2% of glucose by mass of pure water, add pure water and heat to boil for 60 minutes, cool the boiled brine to room temperature (15-30° C.), filter with 200-mesh filter cloth to obtain kimchi brine, that is, salt brine.

[0123] (3) Preparation of vegetable brine mixture

[0124] The pretreated vegetables obtained in step (1) are mixed with the brine obtained in step (2) at a ratio of 1 g:10 mL to obtain a vegetable brine mixture.

[0125] (4) Fermentation culture

[0126] The starter of Example 4 was inoculated into the vegetable brine mixture at an inoculation rate of 2% (m / v), the temperature was controlled at 25°C, and fermented for 10 days until the total acid content reached 0.6%, thereby obtaining fermented vegetables containing acid-containing Lactobacillus acidipiscis SAAS-B-MRS-2020810-9.

[0127] The content of nonanal in the product was determined, and the content of nonanal in the fermented vegetables containing Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9 was 41.81 μg / kg.

[0128] Comparative Example 1

[0129] The difference between this comparative example and Example 5 is that conventional fermentation agent is used to replace the fermentation agent in Example 5 for fermentation culture.

[0130] The content of nonanal in the products was determined, and the results showed that the fermented vegetables obtained using conventional fermentation agents did not contain nonanal.

[0131] Compared with Comparative Example 1, Example 5 shows that acid fish combined with Lactobacillus acidipiscis SAAS-B-MRS-2020810-9 has a higher nonanal production ability in fermented vegetables, and can greatly increase the endogenous aroma production of fermented vegetables during the fermentation process, and has broad application prospects in fermented vegetables.

[0132] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A strain of Ligilactobacillus acidipiscis SAAS-B-MRS-2020810-9, characterized in that: The acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 was deposited in the Guangdong Provincial Microbiological Culture Collection Center on July 22, 2024, with the preservation number GDMCC NO: 64904.

2. The strain according to claim 1, characterized in that The 16S rRNA sequence of the acid fish combined with lactobacillus SAAS-B-MRS-2020810-9 strain is shown in SEQ ID NO.

1.

3. A sour fish combined with lactobacillus agent, characterized in that: The bacterial agent contains the acid fish combined lactobacillus SAAS-B-MRS-2020810-9 strain described in claim 1 or 2.

4. The acid fish combined lactobacillus agent according to claim 3, characterized in that The live bacteria concentration of the acid fish combined with Lactobacillus SAAS-B-MRS-2020810-9 strain in the bacterial agent is 1.0×10 8 ~1.0×10 9 CFU / mL.

5. The method for preparing the acid fish combined with lactobacillus agent according to claim 3 or 4, characterized in that: The strain described in claim 1 is activated and cultured, the bacterial bodies are collected, the bacterial bodies are mixed with a freeze-drying protective agent, and freeze-dried to obtain an acid fish combined with lactobacillus bacterial agent.

6. The preparation method according to claim 5, characterized in that: The freeze-drying protective agent is sterile skim milk.

7. Use of the strain according to any one of claims 1 to 2, the bacterial agent according to any one of claims 3 to 4, or the acid fish combined lactobacillus bacterial agent obtained according to the preparation method according to any one of claims 5 to 6 in the preparation of fermented food.

8. The use according to claim 7, characterized in that: The application is to increase the nonanal content in fermented food.

9. Use of the strain according to any one of claims 1 to 2, the bacterial agent according to any one of claims 3 to 4, or the acid fish combined lactobacillus bacterial agent obtained according to the preparation method according to any one of claims 5 to 6 in the production of nonanal.

10. A fermented vegetable, characterized in that: The preparation steps of the fermented vegetables are as follows: (1) mixing the processed vegetables with brine to obtain a vegetable brine mixture; (2) The strain described in claim 1 or the acid fish combined lactobacillus agent described in claim 3 is inoculated into a vegetable brine mixture at an inoculation rate of 0.5% to 2% (m / v), and fermented to obtain fermented vegetables.

Images