A mutant of acylase and its application in synthesizing octanoyl amino acid compounds

Abstract

The invention discloses a mutant of an acylase and its application in synthesizing octanoyl amino acid compounds. The amino acid sequence of the acylase mutant is obtained by subjecting the sequence shown in SEQ ID NO:1 to at least one mutation of Y50F, E151P and T216A, and its catalytic activity is significantly improved relative to that of the wild-type acylase. The wet bacterial cells obtained by fermentation and culturing the recombinant bacteria containing the mutant coding gene of the acylase are used as biocatalysts, and octanoic acid and amino acids are used as substrates to synthesize octanoyl alanine surfactants, which has high production application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a mutant of acylase and application thereof in octanoyl amino acid compounds. Background Art

[0002] As people pay more and more attention to the safety and mildness of various products and the increasing requirements for environmental protection, the research and development of multifunctional, high-quality, environmentally friendly surfactants has become the main direction of the surfactant industry. Biosurfactants and surfactants synthesized from raw materials obtained by biotechnology are environmentally friendly surfactants. Amino acid surfactants are surfactants based on biological materials. Amino acid surfactants are increasingly valued because of their excellent surface properties and their application fields are becoming more and more extensive.

[0003] Sodium octanoyl alanine is a typical green surfactant with the advantages of natural source, good surface performance, low irritation, good compatibility and good biodegradability. In recent years, it has been increasingly used in various production and life fields such as daily chemicals, textile auxiliaries, agricultural auxiliaries and biomedicine. Compared with traditional surfactants, amino acid surfactants have lower irritation and toxicity, are mild to the skin, have no allergic and toxicity, and have shown high safety through cytotoxicity tests. However, sodium octanoyl alanine can be obtained by saponification of octanoyl alanine.

[0004] The synthesis methods of N-acylamino acid salts mainly include chemical method, enzyme method, chemical-enzyme method and fermentation method. Enzyme method and fermentation method rely on the development of biotechnology, and chemical method is still the main research direction. In addition to the traditional Schotten-Baumann condensation process, the chemical method is currently more concerned with ester compounds such as oils or methyl ester amide synthesis. The low conversion rate and the removal of unreacted products have prevented the promotion of this method.

[0005] The high cost of enzymes and the low yield of biological methods are the major obstacles to the industrial production of enzymatic synthesis of octanoyl alanine. Acylase has the activity of synthesizing octanoyl alanine. Therefore, improving the synthetic activity of acylase is the best way to achieve industrial production of octanoyl alanine. Summary of the invention

[0006] The invention provides an acylase mutant with significantly improved catalytic activity and provides application of the acylase in synthesizing octanoylalanine.

[0007] The present invention first provides a mutant of a plant-derived acylase, which has Y50F, E151P, T216A, Y50F / E151P, Y50F / T216A, E151P / T216A or Y50F / E151P / T216A mutations based on the amino acid sequence shown in SEQ ID NO.1.

[0008] The present invention further provides a nucleic acid encoding a mutant of the acylase.

[0009] The present invention further provides a recombinant expression vector containing the nucleic acid, specifically using a pET vector as a framework.

[0010] The present invention also provides a genetically engineered bacterium containing the nucleic acid or the recombinant expression vector. Preferably, the genetically engineered bacterium is Escherichia coli.

[0011] The present invention also provides the mutant of the acylase, or the use of the encoding nucleic acid thereof in the preparation of octanoyl amino acid compounds, and the use is specifically the use in catalyzing the conversion of octanoic acid into octanoylalanine.

[0012] The present invention also provides a method for preparing an octanoyl amino acid compound, which comprises using the genetically engineered bacteria as a whole-cell catalyst, octanoic acid and amino acids as substrates, and catalytically synthesizing the octanoyl amino acid compound.

[0013] Specifically, the method comprises the following steps: centrifuging the fermented bacterial liquid, discarding the supernatant, and collecting the precipitate to obtain wet bacterial cells;

[0014] The amino acid is selected from glycine, arginine, glutamic acid, lysine, and alanine;

[0015] Preferably, in the catalytic reaction, the reaction system is composed of 5-30 g / L of wet bacteria, 1.44-72 g / L of octanoic acid concentration, 60%-100% saturated amino acid solution, and pH 5.5-8.5 phosphate buffer as the reaction medium;

[0016] The reaction conditions are: temperature 35-65°C, rotation speed 100-1000 rpm.

[0017] More preferably, the reaction system is formed with a pH 6.0-8.0 phosphate buffer as the reaction medium, and the biocatalytic reaction is carried out at a temperature of 45-65° C. and a rotation speed of 300-800 rpm for 20-28 hours.

[0018] The invention provides a mutant of a plant-derived acylase, whose catalytic activity is significantly improved compared with that of a wild-type acylase. The wet bacterial cells obtained by fermentation culture of a recombinant bacterium containing a mutant coding gene of the acylase are used as a biocatalyst, and octanoic acid and amino acids are used as substrates to catalyze the synthesis of a surfactant of an octanoyl propyl amino acid compound, and the reaction temperature and pH conditions are easy to achieve, and the surfactant has high production application value. DETAILED DESCRIPTION

[0019] The features and exemplary embodiments of various aspects of the present invention will be described in detail below. The specific embodiments listed in the present invention are only examples of the present invention, and the present invention is not limited to the specific embodiments described below.

[0020] In the present invention, the standard single letter codes for amino acids are used. Standard substitution notation is also used, i.e., Y50F means that the tyrosine (Y) at position 50 at the N-terminus is replaced by phenylalanine (F). Y50F / E151P means that the tyrosine (Y) at position 50 at the N-terminus is replaced by phenylalanine (F), and the glutamic acid (E) at position 151 at the N-terminus is replaced by proline (P).

[0021] Example 1: Construction and induced expression of wild-type E. coli BL21 (DE3) / pET28a-VuGH strain

[0022] 1. Construction of wild-type E. coli BL21 (DE3) / pET28a-VuGH strain

[0023] According to the enzymes with certain N-acylation activity recorded in NCBI (GenBank: NP_200262.1), the enzymes with 73% homology were determined by BLAST, and the wild-type plant-derived acylase VuGH (GenBank: XP_047162094) recorded in NCBI was excavated, and its amino acid sequence is shown in SEQ ID NO.1. The wild-type plant-derived acylase gene was artificially synthesized, and the gene was used as a template to extend the fragment by PCR amplification (NdeI and XhoI endonuclease fragments were added on both sides of the fragment). Its nucleotide sequence is shown in SEQ ID NO.2. Among them, the upstream primer 1 for PCR amplification of VuGH is: 5'-cggcagccatatgtttggtgccacactccgaaa-3'(SEQ ID NO:3), and the downstream primer 2 is: 5'-gtggtggtggtggtggtgctcgagattttctgtgaaccaa-3'(SEQ ID NO:4).

[0024] The amount of each component added to the PCR system (total volume 50 μL): PrimerStar 25 μL, ddH2O 20 μL, upstream and downstream primers 1.5 μL each, template 2 uL. The PCR amplification program is: 98℃ pre-denaturation for 2 min; enter the cycle (98℃ denaturation for 10 s; 56℃ annealing for 15 s; 72℃ extension for 20 s), a total of 25 cycles, 72℃ final extension for 5 min. The amplified target gene fragment size is about 1.9 kb.

[0025] The PCR product was purified and recovered by a purification and recovery kit, and the PCR product and the E. coli expression vector pET-28a(+) were double-digested with NdeI and XhoI, respectively, and the digestion product was purified and recovered again. Under the action of T4 DNA ligase, the target gene was connected to the E. coli expression vector pET-28a(+) to obtain the recombinant plasmid VuGH-pET-28a(+). The connected vector was transferred into E. coli BL21(DE3) to establish the VuGH genetic engineering bacteria, named pET28a-VuGH-WT.

[0026] 2. Inducible expression of pET28a-VuGH-WT

[0027] The recombinant Escherichia coli BL21 (DE3) / pET28a-VuGH-WT obtained in Example 1 was inoculated into LB liquid medium containing 50 μg / ml kanamycin resistance, and cultured at 37 ° C, 200 rpm for 12 h. Then, it was inoculated into fresh LB liquid medium containing 50 μg / ml kanamycin resistance at a 1% (v / v) inoculation amount, and cultured at 37 ° C, 200 rpm until the bacterial OD 600 When the pH value reaches 0.6-0.8, add IPTG with a final concentration of 0.1 mM, and culture at 20°C, 200 rpm for 15 hours. Centrifuge at 4°C, 8000 rpm for 20 minutes, discard the supernatant, and collect the precipitate to obtain the wet bacteria of recombinant Escherichia coli BL21 (DE3) / pET28a-VuGH-WT containing the recombinant plasmid.

[0028] Example 2: Construction and induction of expression of mutant recombinant strains of plant-derived acylase

[0029] 1. Construction of plant-derived acylase mutant strains

[0030] The wild-type acylase (WT) amino acid sequence (SEQ ID NO: 1) was subjected to conservation analysis by VESPA software, and specific sites with low conservation were selected for mutation, and multiple mutants with significantly improved enzyme activity were obtained. Any one mutation or random combination of Y50F, E151P, and T216A was selected, and the constructed mutants were Y50F, E151P, T216A, Y50F / E151P, Y50F / T216A, E151P / T216A, and Y50F / E151P / T216A.

[0031] The gene mutation was carried out by whole plasmid PCR method to obtain the target mutant gene. Y50F was used as an example to design the required primers. Other mutants were designed using this principle and single-point iterative mutation was performed.

[0032] Y50F upstream primer: aagagagccctggaattcattgaagaggtcacc (SEQ ID NO: 5)

[0033] Y50F downstream primer: ggtgacctcttcaatgaattccagggctctctt (SEQ ID NO: 6).

[0034] The amount of each component added to the PCR system (total volume 25 μL): KOD-PLUS-NEO 0.5 μL, 10x buffer 2.5 μL, 2 mM dNTP 2.5 μL, 25 mM MgSO4 1.5 μL, upstream and downstream primers 1 μL each, template 1 uL, add ddH2O to 25 μL. The PCR amplification program is: 98℃ pre-denaturation for 2 min; enter the cycle (98℃ denaturation for 10 s; 68℃ annealing for 30 s; 68℃ extension for 3 min), a total of 25 cycles, and 68℃ final extension for 5 min.

[0035] After the PCR amplification was completed, the amplified product was detected by 1.0% agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of about 6000 bp.

[0036] The samples containing the PCR amplification products were digested with DPNI enzyme. 1 μL DPNI and 2.5 μL 10xcutsmart were added to the samples of 25 ul PCR amplification products and digested at 37°C for 30 min. 10 μL of the digested product was transferred into BL21 (DE3) competent cells, spread on the surface of LB solid culture medium containing 50 μg / mL kanamycin sulfate, cultured at 37°C for 16 h, and single colonies were picked to LB liquid culture. The positive transformants constructed successfully were identified by PCR, and the correctness of the mutation site was verified by sequencing. The recombinant mutant expression strain BL21 (DE3) / pET28a-VuGH was obtained.

[0037] 2. Inducible expression of plant-derived acylase mutants

[0038] The recombinant mutant expression strain BL21(DE3) / pET28a-VuGH obtained above was inoculated into LB liquid medium containing 50μg / ml kanamycin resistance, cultured at 37°C, 200rpm for 12h, and then inoculated into fresh LB liquid medium containing 50μg / ml kanamycin resistance at a 1% (v / v) inoculation amount, cultured at 37°C, 200rpm until the bacterial OD600 reached 0.6-0.8, and IPTG with a final concentration of 0.1mM was added, induced at 20°C, 200rpm for 15h. Centrifuged at 4°C, 8000rpm for 20min, the supernatant was discarded, and the precipitate was collected to obtain the wet bacterial cells of the recombinant Escherichia coli BL21(DE3) / pET28a-VuGH containing the recombinant mutant plasmid.

[0039] In a similar manner to the above, recombinant strains containing mutants of E151P, T216A, Y50F / E151P, Y50F / T216A, E151P / T216A, and Y50F / E151P / T216A were prepared and induced to express to obtain the corresponding wet cells.

[0040] Example 3: Synthesis of octanoylalanine catalyzed by wild-type acylase and its mutants

[0041] According to Example 1-2, the corresponding engineered bacteria expressing acylase and its mutants were constructed and cultured, and the obtained wet bacteria were used as catalysts.

[0042] Synthesis reaction system (1mL): 14.4mg octanoic acid, 1ml saturated alanine solution, 100mM PBS pH7.0, 0.01g wet bacteria, set the shaker reaction temperature to 55℃, 800rpm, and the reaction time to 24h. After the reaction, add 2mL methanol, shake and mix evenly, and take samples for HPLC detection (chromatographic column: C18, 4.6mm×250mm, 5μm; detection wavelength: ultraviolet (UV) = 200nm; mobile phase: 50% acetonitrile and 50% 0.05% trifluoroacetic acid aqueous solution; column temperature: 30℃; flow rate: 1mL / min; detection time: 15min) to detect the content of octanoyl alanine. The results are shown in Table 1.

[0043] Relative enzyme activity = octanoylalanine content of acylase mutant / octanoylalanine content of wild-type acylase.

[0044] Table 1 Enzyme activity of wild-type acylase and its mutants in synthesizing octanoylalanine

[0045]

[0046] It can be seen from the data in Table 1 that any one, two or three acylase mutants consisting of Y50F, E151P and T216A can improve the octanoylalanine synthase activity.

[0047] Example 4: Temperature stability of enzymes

[0048] The corresponding engineered bacteria expressing acylase and its mutants were cultured according to the construction of Example 1-2 and the wet cells were obtained. The mutants with better activity were selected for different temperature tolerance tests. The enzymes were treated at different temperatures for 1 hour and then the enzyme reaction was carried out.

[0049] Synthesis reaction system (1mL): 14.4mg octanoic acid, 1ml saturated alanine solution, 100mM PBS pH7.0, 0.01g wet bacteria, set the shaker reaction temperature to 55℃, 800rpm, and the reaction time to 24h. After the reaction, add 2mL methanol, shake and mix evenly, and take samples for HPLC detection (chromatographic column: C18, 4.6mm×250mm, 5μm; detection wavelength: ultraviolet (UV) = 200nm; mobile phase: 50% acetonitrile and 50% 0.05% trifluoroacetic acid aqueous solution; column temperature: 30℃; flow rate: 1mL / min; detection time: 15min) to detect the content of octanoyl alanine. The results are shown in Table 2.

[0050] Table 2

[0051]

[0052] In the table, residual enzyme activity = enzyme activity after high temperature treatment / initial enzyme activity without high temperature treatment. + Residual activity 0~30%, ++ Residual enzyme activity 30~60%, +++ Residual enzyme activity 60~80%, ++++ Residual enzyme activity 80~100%. From the results in the table, it can be seen that the three mutants have good stability at 60℃ and 65℃, among which the triple mutant has the best effect.

Claims

1. A mutant of an acylase, characterized in that The following mutants are constructed based on the amino acid sequence shown in SEQ ID NO.1: Y50F, E151P, T216A, Y50F / E151P, Y50F / T216A, E151P / T216A or Y50F / E151P / T216A.

2. A nucleic acid encoding the acylase mutant according to claim 1.

3. A recombinant expression vector containing the encoding nucleic acid as claimed in claim 2.

4. The recombinant expression vector according to claim 3, characterized in that It uses the pET vector as a framework.

5. A genetically engineered bacterium containing the encoding nucleic acid according to claim 2, or the recombinant expression vector according to claim 3 or 4.

6. The genetically engineered bacterium according to claim 5, characterized in that The genetically engineered bacteria is Escherichia coli.

7. The acylase mutant according to claim 1, or use of the encoding nucleic acid thereof in preparing octanoyl amino acid compounds, characterized in that: The application is to catalyze the conversion of octanoic acid into octanoylalanine.

8. A method for preparing octanoyl alanine, characterized in that: The method comprises using the genetically engineered bacteria as claimed in claim 5 or 6 as a whole-cell catalyst and octanoic acid and alanine as substrates to catalyze the synthesis of octanoylalanine.

9. The preparation method according to claim 8, characterized in that: The method comprises the following steps: centrifuging the fermented bacterial liquid, discarding the supernatant, and collecting the precipitate to obtain wet bacterial cells.

10. The preparation method according to claim 8, characterized in that: The catalytic reaction system is as follows: the wet bacterial dosage is 5-30 g / L, the caprylic acid concentration is 1.44-72 g / L, 60%-100% saturated alanine solution, and pH 6.0-8.0 phosphate buffer is used as the reaction medium; the reaction conditions are: the biocatalytic reaction is carried out at a temperature of 35-65° C. and a rotation speed of 100-1000 rpm for 20-28 hours.

Images