Geobacillus thermoglucosidase CRISPR type I-B gene editing and application thereof

Abstract

The invention discloses a geobacillus thermoglucosidase CRISPR type I-B gene editing method and application thereof, and effectively solves the problems that a homologous recombination gene editing method based on reverse screening is low in editing efficiency and wastes time and labor, and a heterologous CRISPR-Cas9 system faces potential proteotoxicity and a PAM sequence is too long by establishing a gene editing method of an endogenous CRISPR type I-B system. The PAM sequence of the endogenous system is 5 '-TTA-3', and the gene knockout efficiency and the knockin efficiency both exceed 95%. According to the method disclosed by the invention, function switching of a CRISPR type I-B system from cutting to transcription inhibition is realized by truncating the length of a spacer, so that the problem of no gene regulation tool of geobacillus thermoglucosidase is solved, and nuclease Cas3 does not need to be inactivated. According to the invention, basic research and industrial research on gene functions and hereditary characteristics of the strain can be promoted.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to CRISPR type IB gene editing of thermoglucosidase Geobacillus sp. and its application. Background Art

[0002] As the next generation of industrial biotechnology chassis cells, the thermoglucosidase Geobacillus 11955 has significant advantages in energy saving and consumption reduction. For example, using this strain for high temperature fermentation can avoid contamination by mesophilic bacteria; there is no need for a large amount of cold water to cool the fermenter; fermentation under high temperature conditions can also speed up the reaction rate, thereby reducing the fermentation cycle; high temperature conditions can also increase the diffusion, ionization and solubility of the substrate. This strain has been used to develop and produce a variety of chemicals, such as ethanol, isopropanol, riboflavin, etc. However, the lack of efficient genetic tools seriously restricts the development of the thermoglucosidase Geobacillus 11955 engineering strain. Although researchers have developed editing methods based on homologous recombination or CRISPR / Cas9, they still face problems such as low editing efficiency or potential toxicity of heterologous proteins and too long PAM sequences.

[0003] At present, the gene editing tools for thermoglucosidase Geobacillus 11955 include homologous recombination methods based on fluorescent protein markers or reverse screening of pyrF nutritional deficiency. However, since this method does not damage the genome, the probability of homologous recombination is low, and it takes time and effort to obtain the edited strain. Some researchers have also developed a CRISPR-Cas9 system based on heterologous high-temperature Cas9 (including stCas91 and stCas93 proteins), and the PAM sequences of the two Cas9 proteins are 5'-NNAGAAW-3' and 5'-NGGNG-3', respectively. They all face the problem that some gene targets have no PAM sites and cannot be edited due to the long PAM sequence, and the heterologous Cas9 protein also has potential toxicity. More importantly, there is currently no report on the development of gene regulation tools for thermoglucosidase Geobacillus 11955. Summary of the invention

[0004] The purpose of the present invention is to provide CRISPR type IB gene editing of thermoglucosidase Geobacillus and its application.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides a thermoglucosidase Geobacillus CRISPRtype IB gene editing vector, wherein the DNA sequence of the sgRNA action site of the gene editing vector is 5'-TTA-Nx-3'; wherein TTA is a PAM sequence; N represents a base A, T, G or C, and x is an integer between 27 and 40.

[0006] The thermoglucosidase Geobacillus described in the present invention is NCIMB 11955.

[0007] Furthermore, the gene editing vector comprises an inducible promoter. For example, the inducible promoter is P xyla . A cellobiose-inducible promoter (Pβglu) can also be used, as shown in the reference (Modular system for assessment of glycosyl hydrolase secretion in Geobacillus thermoglucosidasius). The sequence of the cellobiose-inducible promoter is as follows:

[0008]

[0009] In a second aspect, the present invention provides a thermoglucosidase Geobacillus CRISPR type IB gene editing system, which comprises the gene editing vector and an expression system (on the chromosome of thermoglucosidase Geobacillus) or an expression vector containing thermoglucosidase Geobacillus Cas1 to Cas8 proteins (NCBI numbers are Cas8: BCV53_05155, Cas7: BCV53_05160, Cas5: BCV53_05165, Cas3: BCV53_05170, Cas4: BCV53_05175, Cas1: BCV53_05180, Cas2: BCV53_05185, Cas6: BCV53_05190); optionally including a donor vector.

[0010] In a specific embodiment of the present invention, the method for constructing the gene editing vector is as follows:

[0011] A. Construction of plasmid pZH01

[0012] A1. Use primers repB-F (CCCTTTCGTCCACAGCTTGTCTGTAAGCGG) and repB-R (AAGGAACTTGCGAATTCACTGGCCGTCGTTTTAC) and primers amp-F (CAGGTGTCCTAAGCTTGGCGTAATCATGG) and amp-R (ACAAGCTGTGGACGAAAGGGCCTCGTGATAC) to PCR amplify repB fragment and amp fragment respectively using pUB-sfGFP plasmid as template;

[0013] A2, using primers xylR-F (AGTGAATTCGCAAGTTCCTTTCGCCGCAAAAATG) and xylR-R (CGCCAAGCTTAGGACACCTGATTAGACTGC), PCR amplification was performed using the genome of Geobacillus thermoglucosidase NCIMB 11955 as a template to obtain the xylR fragment;

[0014] A3, the three fragments were assembled by Gibson to obtain the intermediate plasmid pxylR;

[0015] A4. Use primers dbt-F (TCTCGTTTGTATCTTACCTATGAGGAATTGAAACCAGGCATCAAATAAAACGAAAG) and dbt-R (GCATGCGAGTCACTAAGGGCTAACTAAC) to amplify the terminator fragment using the pUB-sfGFP plasmid as a template; use primers lacZ-F and lacZ-R to amplify the lacZ fragment using the pCas plasmid as a template; use primers pxyla-F (GAGCTCCATAAACTTTGTTTGTACACTAGACAAACAAATTTAACCGCATTATAATTTAG) and pxyla-R (CGTCTCGTTTCAATTCCTCATAGGTAAGATACAAACCAACTAAATTATAATGCGGTTAA) was directly annealed to obtain the pxyla fragment; primers pZH01V-F (GCCCTTAGTGACTCGCATGCCACAGCTTGTCTGTAAGCGG) and pZH01V-R (AAACAAAGTTTATGGAGCTCGACGAAAGGGCCTCGTGATAC) were used to amplify the vector fragment using the intermediate plasmid pxylR as a template; then the terminator fragment, lacZ fragment, pxyla fragment and vector fragment were assembled using the Gibson method to obtain the plasmid pZH01;

[0016] B. Design and synthesize a forward monomer 5'-Nx-3' and a reverse monomer 5'--N'x-3' targeting the sgRNA action site; wherein N'x is the reverse complementary sequence of Nx, and N and N' represent bases A, T, G or C;

[0017] The two monomers are annealed to form a double-stranded DNA with sticky ends;

[0018] C. Use Esp3I to digest the plasmid pZH01 to obtain the backbone vector, and then use T4 ligase to connect the backbone vector with the double-stranded DNA with sticky ends to obtain the gene editing vector;

[0019] The construction method of the expression vector containing the thermoglucosidase Geobacillus Cas1~Cas8 proteins is as follows: using primers IB-F (TACGGGGTCTGACGCAACCCCAACTAAGGGCAGTC) and IB-R (CCTTTGGGAAGTTTGTGCGCTATTAGGGATCGACG), using the genome of thermoglucosidase Geobacillus NCIMB 11955 as a template, PCR amplification to obtain an insert fragment; using primers pNW33-F (ATCCCTAATAGCGCACAAACTTCCCAAAGGCGAGC) and pNW33-R (CCCTTAGTTGGGGTTGCGTCAGACCCCGTAGAAAA), using pThermoCas9_ctrl plasmid as a template, PCR amplification to obtain a backbone plasmid, and then connecting the insert fragment to the backbone plasmid to obtain (plasmid pCasIB).

[0020] In a third aspect, the present invention provides a thermoglucosidase Geobacillus CRISPR type IB gene silencing vector, wherein the DNA sequence of the sgRNA action site of the gene silencing vector is 5'-TTA-Nx-3'; wherein TTA is a PAM sequence; N represents the base A, T, G or C, and x is an integer between 11 and 26.

[0021] Furthermore, the gene silencing vector comprises a constitutive promoter. For example, the constitutive promoter is P ldh or P RplsWT .

[0022] In a fourth aspect, the present invention provides a thermoglucosidase Geobacillus CRISPR type IB gene silencing system, wherein the gene silencing system comprises the gene silencing vector and an expression vector containing thermoglucosidase Geobacillus Cas1 to Cas8 proteins.

[0023] In a specific embodiment of the present invention, the construction method of the gene silencing vector is as follows:

[0024] a. Construction of plasmid pZH04

[0025] a1. Use primers repeat1F (AAGCATTGTCGTTTGTATCTTACCTATGAGGAATTGAAACGAGA) and repeat1R (GGCGATGCGGCCGCCGATGGTCTCGTTTCAATTCCTCATA) and primers repeat2F (CCATCGGCGGCCGCATCGCCATGGACTGGGTCTCCGTTTGTATCTTACCT) and repeat 2R (GATGCCTGGCGTTTCAATTCCTCATAGGTAAGATACAAACGGAGA) to directly anneal and obtain fragments repat 1 and repeat 2;

[0026] a2. Use primers pRplsWT-F (CAGTGAATTCAACAATCGTTAAAGCGGACG) and pRplsWT-R (AGATACAAACGACAATGCTTTTTCATCATTG) to amplify the promoter fragment P using the genome of Geobacillus thermoglucosidase NCIMB 11955 as a template. Rpls ;

[0027] a3. Use primers TF (GAATTGAAACGCCAGGCATCAAATAAAACG) and TR (TAGAGGATCCGAGTCACTAAGGGCTAACTAAC) to amplify the terminator fragment using pUB-sfGFP plasmid as a template;

[0028] a4. Use primers pZH04V-F (TTAGTGACTCGGATCCTCTAGAGTCGACCTG) and pZH04V-R (AACGATTGTTGAATTCACTGGCCGTCGTTTTAC) to amplify the vector fragment using the pUCG3.8 plasmid as a template;

[0029] a5, repeat fragment 1, repeat fragment 2, promoter fragment P RplsWT , the terminator fragment and the vector fragment were assembled using Gibson to obtain plasmid pZH04;

[0030] b. Design and synthesize the forward monomer 5'-Nx-3' and the reverse monomer 5'--N'x-3' targeting the sgRNA action site; wherein N'x is the reverse complementary sequence of Nx, and N and N' represent the base A, T, G or C;

[0031] The two monomers are annealed to form a double-stranded DNA with sticky ends;

[0032] c. Use BsaI to digest the plasmid pZH04 to obtain the backbone vector, and then use T4 ligase to connect the backbone vector with the double-stranded DNA with sticky ends to obtain the gene silencing vector.

[0033] In a fifth aspect, the present invention provides the use of the gene editing vector or the gene editing system in host gene editing.

[0034] In a sixth aspect, the present invention provides application of the gene silencing vector or the gene silencing system in host gene silencing.

[0035] The host includes, but is not limited to, thermophilic bacteria, eukaryotic host cells, and prokaryotic host cells (such as Escherichia coli).

[0036] The gene editing system or gene silencing system provided by the present invention is active at 37°C-70°C.

[0037] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0038] (i) The present invention is the first to discover tools that can be used to regulate gene expression in the thermoglucosidase Geobacillus 11955. The present invention focuses on the non-toxic endogenous CRISPR type IB system and develops gene editing and gene regulation tools based on the endogenous CRISPR type I-B system.

[0039] (II) The present invention effectively solves the problems of low editing efficiency, time-consuming and labor-intensive faced by the homologous recombination gene editing method based on reverse screening by establishing a gene editing method of the endogenous CRISPR type IB system, and solves the problems of potential protein toxicity and excessively long PAM sequences faced by the heterologous CRISPR-Cas9 system. The use of the endogenous type IB system only requires a PAM sequence length of 3 bases (5'-TTA-3'), and the gene knockout and gene knock-in efficiencies of this system are both over 95%, which is much higher than the theoretical maximum editing efficiency of 50% for homologous recombination of genes.

[0040] (III) The present invention is the first to develop a gene regulation tool based on the endogenous CRISPR type IB system in strain 11955. Compared with the endogenous type IB system developed in other strains, which requires the knockout of Cas3 nuclease to perform gene regulation, this regulation tool only needs to change the length of the spacer in the guide RNA to achieve gene regulation instead of cutting, which greatly simplifies the operation of the endogenous Type I system for gene regulation.

[0041] (IV) The development of gene editing and gene regulation tools based on the endogenous CRISPR type IB system will greatly promote basic research on the gene function and genetic characteristics of this strain and industrial research on the development of this strain as an engineered strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 The CRISPR type IB system of strain 11955Y1 in the preferred embodiment of the present invention is active at 37°C-70°C.

[0043] Figure 2 In a preferred embodiment of the present invention, the Type III-B system is knocked out using homologous recombination.

[0044] Figure 3 Schematic diagram of the structure of the pIB-C2S19 plasmid in a preferred embodiment of the present invention.

[0045] Figure 4 This is a CRISPRi activity test in a preferred embodiment of the present invention.

[0046] Figure 5 This is a characterization of the PAM site of CRISPR in a preferred embodiment of the present invention.

[0047] Figure 6 This is the gene editing of the CRISPR type IB system in 11955 bacteria in a preferred embodiment of the present invention.

[0048] Figure 7 This is the gene editing of the CRISPR type IB system in Escherichia coli in a preferred embodiment of the present invention. DETAILED DESCRIPTION

[0049] The present invention provides a gene editing method based on the endogenous CRISPR type IB system. Since this editing system is an endogenous immune system of strain NCIMB 11955 that defends against the invasion of exogenous genetic material, it avoids the protein toxicity problem that may exist in editing methods based on exogenous nucleases (such as Cas9). Moreover, the PAM sequence of this editing system is 5'-TTA-3', which is only 3 bases in length, avoiding the dilemma of some gene editing tools being unavailable because the PAM site cannot be found in the genome. The present invention is the first to develop a gene regulation tool based on the endogenous CRISPR type IB system in strain NCIMB 11955. The main features of the system are as follows:

[0050] 1. The endogenous CRISPR type IB system is active at 37℃-70℃.

[0051] 2. By shortening the length of the spacer and the degree of matching between the spacer and the target DNA, it was proved that the endogenous CRISPRtype IB can inhibit the transcription of the target gene.

[0052] 3. It was determined that a spacer length of ≤26bp can form an effector complex with the cascade to inhibit the transcription of the target gene, and a spacer length of ≥27bp can form an effector complex with the cascade to cut the target gene.

[0053] 4. The PAM site of this CRISPR type IB system was determined through bioinformatics prediction and plasmid interference experiments.

[0054] 5. Construction of plug-and-play modular plasmids enables gene editing of strains, including gene knockout and gene knockin.

[0055] 6. Gene editing and gene regulation of this CRISPRtype IB system in Escherichia coli were achieved through modular plasmids, proving that this system can be used in heterologous hosts.

[0056] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001, or the conditions recommended by the manufacturer's instructions. Example 1 Endogenous CRISPR type IB system is active at 37°C-70°C

[0057] 1. Bioinformatic analysis of the endogenous CRISPR system of Geobacillus thermoglucosidase 11955

[0058] The genome of Geobacillus thermoglucosidase 11955 was analyzed. Figure 1 A shows that strain 11955 contains type IB system (Cas1-Cas8) and type III-B system (Cmr1-Cmr6). It also contains 7 CRISPR sequences, corresponding to repeat1-repeat7 as shown in Figure 1C. Bioinformatics software was used to find the protospacer on the pGEOTH01 plasmid corresponding to the 18th spacer (C1S18) of CRISPR1, the protospacer of the Virus E2 virus corresponding to the 19th spacer (C2S19) of CRISPR2, and the protospacer of the phage GBSV1 E2 corresponding to the 32nd spacer (C3S32) of CRISPR3. The 5 bases upstream of the protospacer corresponding to the three spacers C1S18, C2S19 and C3S32 are possible PAM sites, which are 5'-TTTTA-3', 5'-TGTTA-3' and 5'-GATTA-3' ( Figure 1 B).

[0059] 2. Test the activity and thermal stability of the endogenous CRISPR type IB system at different temperatures

[0060] In order to prevent the type III-B system from interfering with the type IB system, the type III-B system was first knocked out using homologous recombination to obtain strain 11955Y1 ( Figure 2 ). The fourth base A of the protospacer corresponding to the above three protospacers and C1S18 is mutated to G, so that the mutated protospacer can completely match the corresponding spacer ( Figure 1 B) These four protospacers and the five upstream bases were constructed onto the backbone plasmid pUCG3.8 to obtain the test plasmids pGeoth, pGeoth*, pVirus and pPhage.

[0061] The specific construction process is as follows:

[0062] Primer C1S18-F (AATTTTTTA TCCAAACGATAGCTTTCCGACACTTTGCCGATGGCAC ) and primer C1S18-R(AGCT GTGCCATCGGCAAAGTGTCGGAAAGCTATCGTTTGGA TAAAA) directly annealed to obtain the insert fragment F containing sticky ends C1S18 Similarly, using primer C1S18*-F(AATTTTTTA TCCGAACGATAGCTTTCCGACACTTT GCCGATGGCAC ) / C1S18*-R(AGCT GTGCCATCGGCAAAGTGTCGGAAAGCTATCGTTCGGA TAAAA) to obtain fragment F C1S18* , using primer C2S19-F (AATTTGTTA ATCGGTCTAACCGATAAACTAGTACAATATCGATA ) / C2S19-R(AGCT TATCGATATTGTACTAGTTTATCGGTTAGACCGAT TAACA) to obtain fragment F C2S19, using primer C3S32-F (AATTGATTA AGATCAACCCTCGCGATAGTGATGCGGTCAATCTG ) / C3S32-R(AGCT CAGATTGACCGCATCACTA TCGCGAGGGTTGATCT TAATC) to obtain fragment F C3S32 After double digestion of pUCG3.8 plasmid with EcoRI and HindIII, the large sticky end fragment was recovered and separated from fragment F C1S18 ,F C1S18* ,F C2S19 and F C3S32 The test plasmids pGeoth, pGeoth*, pVirus and pPhage were obtained by T4 ligation. The four constructed plasmids were electroporated into strain 11955Y1. If the type IB system of strain 11955Y1 is active, the system will cut the plasmid containing the correct PAM site. The number of clones grown on the resistance plate by the strain containing the corresponding plasmid will be significantly reduced compared with the control strain (11955Y1 strain containing the control plasmid pUCG3.8). It can be seen from the experimental results that ( Figure 1 D), the number of clones grown on the resistant plate by the strains containing the four plasmids was significantly reduced compared with the control strain, indicating that the predicted PAM sites (TTTTA, TGTTA, GATTA) on the four plasmids are all correct PAM sites, but it is unclear whether the length of the PAM site sequence can be shortened. At the same time, the pVirus plasmid and the control plasmid pUCG3.8 were electroporated into the 11955Y1 strain again, and the electroporated plates were placed in incubators at 45°C, 60°C, and 70°C, respectively. The number of clones grown on the plate by the strains containing the pVirus plasmid was significantly less than that of the control strain, indicating that the type IB system is active at these three temperatures ( Figure 1 E). Considering that the 11955Y1 strain cannot grow at 37°C, we constructed a plasmid containing the two key elements of the minimal CRISPR system, type IB system and C2S19 spacer ( Figure 3 ). The pIB-C2S19 and pVirus double plasmids were electroporated into E. coli W3110 as the experimental group, and the pIB-C2S19 and pUCG3.8 double plasmids were electroporated into E. coli W3110 as the control group. From the experimental results, it can be seen that the pVirus plasmid conversion rate is several orders of magnitude lower than the control, so the type IB system is also active at 37°C ( Figure 1 F).

[0063] Example 2 Study on spacer length

[0064] The study found that shortening the spacer length or reducing the degree of match between the spacer and the target gene can cause CRISPRi (silencing) of the gene, and that the type IB system with a spacer length of 26bp and 27bp has a node where cutting turns into transcriptional inhibition.

[0065] 1. Shortening the length of the spacer or reducing the degree of match between the spacer and the target gene can perform CRISPRi on the gene

[0066] In order to explore the effect of changing the length of the spacer or the degree of matching with the target gene on the function of type IB, the sfgfp gene (NCBI No. MT912094.1) as a fluorescent marker was first knocked into the genome of the 11955Y1 strain to obtain the 11955Y2 strain ( Figure 4 A). The specific knock-in process is as follows:

[0067] First, an editing plasmid for gene knock-in based on homologous heavy chain was constructed. The upstream homology arm was amplified using the 11955Y1 strain genome as a template using primers GFPKI UF (TTGTAAAACGACGGCCAGTGCGTTAAAGCTCCTGCGAACC) / GFPKI UR (GAGGCAGTTAACTCCTTCAACTTTTGTTCTACTTGTGCCA), the downstream homology arm was amplified using the thermoglucosidase Geobacillus NCIMB 11955 genome as a template using primers GFPKIDF (CGTTTATACAATTGTTCCGGTTGCTTCCGTATCAG) / GFPKIDR (CTATGACCATGATTACGCCACTCGATGGAAAGGTCGTCGT), and the ldh promoter (SEQ ID NO: 1) was amplified using plasmid pUB-sfGFP as a template using GFP-F (AGAACAAAAGTTGAAGGAGTTAACTGCCTCGTCCATTTTTTTGC) / GFP-R (ACGGAAGCAACCGGAACAATTGTATAAACGCAGAAAGGCCC). NO:1) and the insertion fragment of gfp gene (NCBI No. MT912094.1), the backbone plasmid was double-digested with EcoRI and HindIII, and the backbone plasmid and the above three fragments were assembled into 4 fragments using the Gibson assembly method to obtain the editing plasmid pUB-GFPKI. The sfgfp expression frame was knocked into the 11955Y1 strain using the homologous recombination method to obtain the 119555Y2 strain ( Figure 4 A).

[0068] Design a plasmid that shortens the spacer length or reduces the matching degree between the spacer and the target gene. The specific spacer design is as follows: Figure 4 B. The specific plasmid construction process is as follows:

[0069] First, the test backbone plasmid pZH04 was constructed. The fragments repat 1 and repeat 2 were obtained by direct annealing using primers repeat1F (AAGCATTGTCGTTTGTATCTTACCTATGAGGAATTGAAACGAGA) / repeat1R (GGCGATGCGGCCGCCGATGGTCTCGTTTCAATTCCTCATA) and primers repeat2F (CCATCGGCGGCCGCATCGCCATGGACTGGGTCTCCGTTTGTATCTTACCT) / repeat 2R (GATGCCTGGCGTTTCAATTCCTCATAGGTAAGATACAAACGGAGA). The promoter fragment P was amplified using the genome of Geobacillus thermoglucosidase NCIMB 11955 as a template. RplsWT (SEQ ID NO: 2). Primers TF (GAATTGAAACGCCAGGCATCAAATAAAACG) / TR (TAGAGGATCCGAGTCACTAAGGGCTAACTAAC) were used to amplify the terminator fragment using the pUB-sfGFP plasmid as a template. Primers pZH04V-F (TTAGTGACTCGGATCCTCTAGAGTCGACCTG) / pZH04V-R (AACGATTGTTGAATTCACTGGCCGTCGTTTTAC) were used to amplify the vector fragment using the pUCG3.8 plasmid as a template, and then repeat 1, repeat 2, promoter, terminator and vector fragments were assembled using Gibson to obtain the suppression plasmid pZH04 ( Figure 4 A). Then a series of test plasmids were constructed. Including spacer-matched plasmids pP30, pP25, pP20, pP15 and pP11, and spacer-truncation-matched plasmids pT30, pT29, pT28, pT27, pT26, pT25, pT20, pT15 and pT11. The specific construction process was as follows: primer P30-F (GAAAC AAAT TAGCCACAATGCAGATGGTGTCATCGTGCAGCTG ) / P30-R(AAAC CAGCTGCACGATGACACCATCTGCATTGTGGCTAATTT G),P25-F(GAAAC AAATTAGCCACCGTGCAGATGGCATCGTCGTGCAGCTG ) / P25-R(AAAC CAGC TGCACGACGATGCCATCTGCACGGTGGCTAATTTG ),P20-F(GAAAC AAATTAGCCACCGTGCAGATGGCATCGT CACACAATTG ) / P20-R(AAAC CAATTGTGTGACGATGCCATCTGCACGGTGGCTAATTT G),P15-F(GAAAC AA ATTAGCCACCGTGCAGATGGCATCGTAACATCATCA ) / P15-R(AAAC TGATGATGTTACGATGCCATCTGCACGG TGGCTAATTT G) and P11-F (GAAAC AAATTAGCCACCGTGCAACTAGCATAGTAACATCATCA ) / P11-R(AAAC T GATGATGTTACTATGCTAGTTGCACGGTGGCTAATTT G), directly annealed to obtain fragments P30, P25, P20, P15 and P11. Then, the plasmid backbone obtained by digesting the pZH04 plasmid with BsaI was ligated with the above fragments by T4 to obtain plasmids pP30, pP25, pP20, pP15 and pP11.

[0070] Using primer T30-F (GAAAC AAATTCGCCACAACGTGGAGGATGGCAGCG ) / T30-R(AAAC CGCTGCC ATCCTCCACGTTGTGGCGAATTT G), T29-F(GAAAC AAATTCGCCACAACGTGGAGGATGGCAGC ) / T29-R(AAAC GCTGCCATCCTCCACGTTGTGGCGAATTT G), T28-F(GAAAC AAATTCGCCACAACGTGGAGGATGGCAG ) / T28-R(AAAC CTGCCATCCTCCACGTTGTGGCGAATTT G), T27-F(GAAAC AAATTCGCCACAACGTGGAGGATG GCA ) / T27-R(AAAC TGCCATCCTCCACGTTGTGGCGAATTT G), T26-F(GAAAC AAATTCGCCACAACGTGGAGGATGGC ) / T26-R(AAAC GCCATCCTCCACGTTGTGGCGAATTT G), T25-F(GAAAC AAATTCGCCACAACGTGGAGGATGG ) / T25-R(AAAC CCATCCTCCACGTTGTGGCGAATTT G), T20-F(GAAAC AAATTCGCCACAACGTGGAG ) / T20-R(AAAC CTCCACGTTGTGGCGAATTT G), T15-F(GAAAC AAATTCGCCACAACG ) / T15-R(AAAC CGTTGTGGCGAATTT G) and T11-F (GAAAC AAATTCGCCAC ) / T11-R(AAAC GTGGCGAATTTG), directly annealed to obtain fragments T30, T29, T28, T27, T26, T25, T20, T15 and T11. Then, the plasmid backbone obtained by digesting the pZH04 plasmid with BsaI was ligated with the above fragments by T4 to obtain plasmids pT30, pT29, pT28, pT27, pT26, pT25, pT20, pT15 and pT11. The spacer-partially matched plasmids pP30, pP25, pP20, pP15 and pP11, as well as the spacer-truncated matched plasmids pT30, pT25, pT20, pT15 and pT11 were electroporated into strain 11955Y2 to test the plasmid's cutting effect on the genome. The results are shown in Figure 4 As shown in C, the transformation efficiency of the spacer truncated to 30bp (T-30) is significantly reduced compared to the control, indicating that it still has a lethal effect on the strain. However, truncation to 25bp or less or partial matching of the spacer and the target gene will not reduce the electroporation efficiency, indicating that the complex composed of the spacer recruiting cascade will not cut the target gene. At the same time, the 11955Y2 strain was used to measure the transcriptional inhibition of the sfgfp gene based on the level of sfGFP protein expression using an ELISA reader. Transcriptional inhibition of the gene can be achieved by shortening the spacer length to 11bp–25bp. Transcriptional inhibition can also be achieved when the spacer partially matches the target, but transcriptional inhibition of the gene cannot be achieved if only 11 bases match ( Figure 4 D), and the RT-qPCR method was used to measure the transcriptional inhibition of the sfgfp gene at the RNA level, which had a similar inhibitory effect as that measured at the protein level ( Figure 4 E).

[0071] 2. The spacer length of 26 bp and 27 bp type IB system has a node that switches from cutting to transcription inhibition

[0072] Since truncating the spacer to 30bp will have a lethal effect on the strain, while truncating it to 25bp will not have a lethal effect on the strain, there will be a conversion node from cutting to inhibition between 25bp and 30bp. In order to explore this conversion node, plasmids pT29, pT28, pT27 and pT26 were electroporated into the 11955Y2 strain to test the transformation efficiency. Figure 4The electroporation efficiency of plasmids with different spacer lengths in F shows that when the spacer is truncated to 26bp, it will not have a cutting effect on the sfgfp gene. However, when the spacer is truncated to 27bp, it still has a cutting effect on the target gene, which indicates that the type IB system with a spacer length of 26bp and 27bp has a node where the cutting changes to transcription inhibition. The inhibitory effect of the 26bp spacer length on the expression of the sfGFP protein was also measured using an ELISA instrument. Figure 4 As can be seen from G, when the spacer is truncated to a length of 26 bp, significant inhibition of the target gene can also be achieved.

[0073] Example 3 Determination of PAM sequence

[0074] In order to explore the shortest PAM site length, the bioinformatics analysis in Example 1 first showed that the three bases at the -1, -2 and -3 positions of the 5-base PAM site are conserved, and the bases at the -4 and -5 positions are variable ( Figure 5 A). Then it is possible that the bases at positions -4 and -5 are not necessary for PAM. Therefore, the bases at positions -4 and -5 were saturated mutated, and the C2S19 spacer was downstream of the 5-base PAM site. The mutated 5-base PAM and the downstream C2S19 spacer were inserted into the backbone plasmid pUCG3.8 to construct a saturated plasmid mutation library with a total of 16 plasmids, named pAATTA, pACTTA, pAGTTA, pATTTA, pCATTA, pCCTTA, pCGTTA, pCTTTA, pGATTA, pGCTTA, pGGTTA, pGTTTA, pTATTA, pTCTTA, pTGTTA and pTTTTA. If the base mutations at positions -4 and -5 are still the correct PAM sites, the corresponding plasmid will significantly reduce the transformation efficiency of the plasmid when it is electroporated because the corresponding protospacer on the genome will be cut. The transformation efficiency of the mutant plasmid library can be used to determine whether the bases at positions -4 and -5 are necessary for PAM. The construction process of these 16 plasmids is as follows: Use the upstream and downstream primers containing the sequences of the respective 5 PAM sites and the C2S19 spacer sequence to directly anneal to obtain the insert fragments containing sticky ends. The corresponding primers are as follows:

[0075]

[0076]

[0077] The 16 insert fragments containing sticky ends obtained by direct annealing of primers and the pUCG3.8 plasmid backbone digested with EcoRI and HindIII were connected by T4 to obtain 16 target plasmids. The 16 plasmids were electroporated into the 11955Y2 strain respectively to observe the electroporation efficiency of the corresponding plasmids. The results are shown in Figure 5 As shown in B, it can be seen that compared with the electroporation efficiency of the control plasmid pUCG3.8, the plasmids that saturated the PAM sites at positions -4 and -5 will significantly reduce the electroporation efficiency of the plasmid, which means that the base sequences of -4 and -5 are not necessary for PAM, that is, the PAM sequence is TTA. In order to further explore whether the PAM sequence is indeed TTA, the bases at positions -1, -2 and -3 were saturated mutated to obtain a total of 9 plasmids including pATA, pCTA, pGTA; pTAA, pTCA, pTGA; pTTC, pTTG, pTTT. At the same time, pUCG3.8 was used as a negative control plasmid and pAATTA was used as a positive control plasmid. The specific construction process is: Use the upstream and downstream primers containing the sequences of the respective 3 PAM site lengths and the C2S19spacer sequence to directly anneal to obtain an insert fragment containing a sticky end. The corresponding primers are as follows:

[0078]

[0079]

[0080] The nine insert fragments containing sticky ends obtained by direct annealing of primers and the pUCG3.8 plasmid backbone digested with EcoRI and HindIII were connected by T4 to obtain nine target plasmids. The nine plasmids were electroporated into the 11955Y2 strain respectively to observe the electroporation efficiency of the corresponding plasmids. The results are shown in Figure 5 As shown in C, it can be seen that compared with the electroporation efficiency of the control plasmid pAATTA, the plasmids with mutations in the PAM sites at positions -1, -2 and -3 will increase the electroporation efficiency and the electroporation efficiency is roughly the same as that of the negative plasmid pUCG3.8, indicating that 5'-TTA-3' is indeed the PAM sequence.

[0081] Example 4 Gene Editing by CRISPR System in 11955Y1 Strain

[0082] Now that the specific PAM site has been determined, the thermophilic editing plasmid pZH01 can be constructed. The specific construction process is as follows: using primers repB-F (CCCTTTCGTCCACAGCTTGTCTGTAAGCGG) / repB-R (AAGGAACTTGCGAATTCACTGGCCGTCGTTTTAC) and amp-F (CAGGTGTCCTAAGCTTGGCGTAATCATGG) / amp-R (ACAAGCTGTGGACGAAAGGGCCTCGTGATAC), both using pUB-sfGFP plasmid as template, PCR amplification of repB fragment and amp fragment was obtained. Using primers xylR-F (AGTGAATTCGCAAGTTCCTTTCGCCGCAAAAATG) / xylR-R (CGCCAAGCTTAGGACACCTGATTAGACTGC), using the genome of Geobacillus thermoglucosidase NCIMB 11955 as template, PCR amplification of xylR fragment was obtained. The three fragments were assembled by Gibson to obtain the intermediate plasmid pxylR. The terminator fragment was amplified using primers dbt-F (TCTCGTTTGTATCTTACCTATGAGGAATTGAAACCAGGCATCAAATAAAACGAAAG) / dbt-R (GCATGCGAGTCACTAAGGGCTAACTAAC) with pUB-sfGFP plasmid as a template, and the lacZ fragment (SEQ ID NO: 3) was amplified using primers lacZ-F (TGAGGAATTGAAACGAGACGTCAGCCGCTACAGGGCGCGTCCC) / lacZ-R (TAGGTAAGATACAAACGAGACGGGCAGTGAGCGCAACGCAATTAATGTG) with the gene-synthesized reverse screening marker lacZ gene as a template. The pxyla fragment was obtained by direct annealing using primers pxyla-F (GAGCTCCATAAACTTTGTTTGTACACTAGACAAACAAATTTAACCGCATTATAATTTAG) / pxyla-R (CGTCTCGTTTCAATTCCTCATAGGTAAGATACAAACCAACTAAATTATAATGCGGTTAA), and the vector fragment was amplified using primers pZH01V-F (GCCCTTAGTGACTCGCATGCCACAGCTTGTCTGTAAGCGG) / pZH01V-R (AAACAAAGTTTATGGAGCTCGACGAAAGGGCCTCGTGATAC) with the intermediate plasmid pxylR as a template.Then the terminator fragment, lacZ fragment, pxyla fragment and vector fragment are assembled using the Gibson method to obtain the thermophilic editing plasmid pZH01, such as. Figure 6 As shown in A.

[0083] The original editing plasmid used the constitutive promoter P RplsWT constitutive promoter, but the constructed editing plasmid of the edited amylase gene (BCV53_04180) was difficult to be electroporated into strain 11955Y1 ( Figure 6 B) We speculate that the constitutive guide RNA has too strong a cleavage ability on the genome, so we changed the promoter of the guide RNA on the editing plasmid to an inducible promoter P xyla (SEQ ID NO: 4), the transformation efficiency of the editing plasmid of the amylase gene edited using an inducible promoter was significantly improved compared to the constitutive promoter ( Figure 6 B).

[0084] The specific process of constructing the plasmid pZH01-amylKO for editing the amylase gene using an inducible promoter is as follows:

[0085] First, primer amyl 38bp-F (GAAAC CAAAACGGTGGGAAAGTGTCCTATAAAACGAACACGG A G) / amyl 38bp-R(CAAAC TCCGTGTTCGTTTTATAGGACACTTTCCCACCGTTTTGG), directly annealed to obtain the insert fragment containing sticky ends. The plasmid pZH01 was digested with Esp3I to obtain the backbone plasmid, and then the backbone plasmid digested with Esp3I and the insert fragment containing sticky ends were connected with T4 ligase to obtain the intermediate plasmid pZH01-amylguide. The upstream and downstream homology arm fragments were obtained by PCR amplification using the genome as a template using primers amyl UF (GTCACGACGTTGTAAAACGACGGCCAGTGACGTTAAAGCTCCTGCGAACC) / amyl UR (ACGGAAGCAACCGGATTCAACTTTTGTTCTACTTGTGCCA) and amyl DF (AGAACAAAAGTTGAATCCGGTTGCTTCCGTATCAG) / amyl DR (TACATTTTTGCGGCGAAAGGAACTTGCGAACTCGATGGAAAGGTCGTCGT). The vector fragment was obtained by PCR amplification using primers CrV-F (TTCGCAAGTTCCTTTCGCCG) / CrV-R (TCACTGGCCGTCGTTTTACA) and plasmid pZH01-amyl guide as a template, and then the upstream and downstream homology arms and the backbone obtained by PCR amplification were assembled by Gibson to obtain plasmid pZH01-amylKO. The specific gene editing process is shown in Figure 6 C. The successfully constructed editing plasmid pZH01-amylKO for knocking out the amylase gene (BCV53_04180) was electroporated into the strain 11995Y1. After the electroporation, the recovery medium was added and cultured in a shaker at 52°C and 250 rpm for 2-4 hours. The bacterial liquid was then spread on a TSA solid plate containing 12.5 μg / ml kanamycin and placed in an incubator at 52°C for inversion culture. Then, the single clone grown on the plate was inoculated into a liquid culture containing 12.5 μg / ml kanamycin and 2.5 mM xylose inducer and placed in a shaker at 52°C and 250 rpm for overnight culture. The overnight cultured bacterial liquid was spread on a TSA solid plate containing 12.5 μg / ml kanamycin and 2.5 mM xylose, and placed in an incubator at 52°C for inverted culture. The single clone grown on the plate was selected for colony PCR verification. The single clone that was correctly verified by colony PCR, that is, the edited single clone was inoculated into a liquid culture medium without resistance and placed in a shaker at 68°C and 250 rpm for overnight culture to complete the loss of the editing plasmid, thereby obtaining a gene-edited strain that does not contain an editing plasmid and completes the knockout of the amylase gene. Through colony PCR verification, using the endogenous CRISPR type IB system, a 100% knockout efficiency of the amylase gene can be achieved ( Figure 6D). In order to test the efficiency of gene knock-in of the endogenous CRISPR type IB system, a riboflavin synthesis gene cluster derived from a heterologous source was selected as the insertion sequence. For the convenience of plasmid construction, the riboflavin gene cluster was inserted into the amylase gene position of strain 11955Y1 to construct the insertion plasmid pZH01-RFKI. The specific construction process was as follows: using the pZH01-amylKO plasmid as a template, using primers RFV-F (CAAACATGCAGCTGATCCGGTTGCTTCCGTATCAG) / RFV-R (GAGGCAGTTAACTCCTTCAACTTTTGTTCTACTTGTGCCA), the vector fragment was obtained by PCR amplification. Gene synthesis Geobacillus thermodenitrificans NG80-2 (see the literature Genome and proteome of long-chain alkanedegrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir) on the genome and the promoter P that activates this cluster ldh and the synthesized sequence (P ldh The riboflavin fragment was obtained by PCR amplification using primers RF-F (AGAACAAAAGTTGAAGGAGTTAACTGCCTCGTCC) / RF-R (ACGGAAGCAACCGGATCAGCTGCATGTTTGACATTTATCG). The vector fragment and the riboflavin fragment were then assembled by Gibson method to obtain the plasmid pZH01-RFKI. Figure 6 C editing process, the efficiency of gene knock-in was verified by colony PCR to reach 92% ( Figure 6 E). The strain with knocked-in riboflavin was fermented, and HPLC detected that riboflavin was indeed produced in the fermentation broth ( Figure 6 F).

[0086] Example 5 Gene Editing by CRISPR System in Escherichia coli

[0087] Considering that the CRISPR type IB system is also active at 37°C, the present invention attempts to use the editing system of thermophilic bacteria to edit the model bacterium Escherichia coli. First, the type IB system of thermophilic bacteria NCIMB 11955 was cloned into a plasmid containing chl (chloramphenicol) resistance to obtain the plasmid pCasIB. The specific steps are as follows:

[0088] The insert fragment was obtained by PCR cloning using the genome of strain 11955 as a template using PCR primers IB-F (TACGGGGTCTGACGCAACCCCAACTAAGGGCAGTC) / IB-R (CCTTTGGGAAGTTTGTGCGCTATTAGGGATCGACG), and the backbone plasmid was amplified using primers pNW33-F (ATCCCTAATAGCGCACAAACTTCCCAAAGGCGAGC) / pNW33-R (CCCTTAGTTGGGGTTGCGTCAGACCCCGTAGAAAA) and pThermoCas9_ctrl plasmid (see literature: Characterizing a thermostableCas9 for bacterial genome editing and silencing. pThermoCas9_ctrl plasmid was purchased from Addgene) as a template, and then the two fragments were connected to obtain plasmid pCasIB. At the same time, the editing plasmid pZH01 of thermophilic bacteria or the suppression plasmid pZH04 was used to form the editing system in Escherichia coli ( Figure 7 A). The pyrF gene (Gene ID: 12931138) of Escherichia coli W3110 was selected as the test knockout gene and transcription inhibitor gene. First, the knockout plasmid pZH01-pyrFKO of the pyrF gene was constructed. The specific construction process is as follows: primers pyrF 38bp-F (GAAAC TGCAG AACGTCTGGCGGCACTGACGCAAAAATGTGGCC G) / pyrF 38bp-R(CAAAC GGCCACATTTTTGCGTCAGTGCC GCCAGACGTTCTGCAG) Directly anneal to obtain an insert fragment containing sticky ends, and perform T4 ligation between the insert fragment and the pHZ01 plasmid digested with Esp3I to obtain the pZH01-amyl guide plasmid. Use primers pyrF UF (TGTAAAACGACGGCCAGTGATGCTGATATCATCGAAGCGC) / pyrF UR (AATCACTCATGACCAGACCTTCTTGATGAT) and pyrF DF (AGGTCTGGTCATGAGTGATTCCAACAGCCG) / pyrFDR (CGGCGAAAGGAACTTGCGAAGGTGGTGCAGCTGTCGGAGG) to obtain the upstream and downstream homology arms of the pyrF gene by PCR amplification using the W3110 genome as a template. Use primers CrV-F / CrV-R to amplify the pZH01-amyl guide plasmid as a template to obtain the backbone plasmid. The upstream and downstream homologous arms and backbone plasmids of the pyrF gene were Gibson assembled to obtain the knockout plasmid pZH01-pyrFKO of the pyrF gene. Then the pZH01-pyrFKO plasmid and the pCasIB plasmid were simultaneously electroporated into Escherichia coli W3110 as the experimental group. The pZH01 plasmid and the pCasIB plasmid were simultaneously electroporated into Escherichia coli W3110 as the control group. Compared with the control group, there was a single clone on the plate of the experimental group without uracil. This shows that the pZH01-pyrFKO and pCasIB plasmids completed the break of the pyrF gene. When uracil was added to the plates of the experimental group, 0.004% of single clones would grow on the plates of the experimental group with uracil added ( Figure 7 B). Single clones grown on the plate containing uracil were selected for colony PCR verification. All selected single clones completed gene knockout ( Figure 7 C). Then, the suppression plasmids pZH04-pyrF25, pZH04-pyrF20, and pZH04-pyrF15 targeting the pyrF gene with different spacer lengths (truncated to 15nt, 20nt, and 25nt spacer lengths) were constructed. The specific plasmid construction process was as follows: primers pyrF25-F (GAAACTGCAGAACGTCTGGCGGCACTGACG) / pyrF25-R (AAACCGTCAGTGCCGCCAGACGTTCTGCAG),

[0089] pyrF20-F(GAAACTGCAGAACGTCTGGCGGCAC) / pyrF20-R(AAACGTGCCGCCAGACGTTCTGCAG),

[0090] pyrF15-F (GAAACTGCAGAACGTCTGGC) / pyrF15-R (AAACGCCAGACGTTCTGCA G), directly annealed to obtain three fragments with sticky ends of different spacer lengths. Then the three fragments were connected with the pZH04 plasmid digested with BsaI by T4 to obtain pZH04-pyrF25, pZH04-pyrF20, and pZH04-pyrF15 plasmids. The control plasmid pZH04 and the above three experimental plasmids were respectively combined with the pCasIB plasmid to form a double plasmid for a total of 4 groups and transferred into Escherichia coli W3110, and the growth rate of the strains was tested in a liquid culture medium without uracil. Compared with the control group, the growth rate of the strains in the three experimental groups slowed down, and the longer the spacer, the stronger the inhibition on the growth rate of the strain ( Figure 7 D), which shows that gene transcription inhibition can also be achieved in the large intestine by changing the length of crRNA.

[0091] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Thermoglucosidase Geobacillus CRISPR type IB gene editing vector, characterized in that: The DNA sequence of the sgRNA action site of the gene editing vector is 5'-TTA-Nx-3'; wherein TTA is a PAM sequence; N represents a base A, T, G or C, and x is an integer greater than or equal to 27, preferably an integer between 27 and 40; The thermoglucosidase Geobacillus is NCIMB 11955.

2. The gene editing vector according to claim 1, characterized in that The gene editing vector comprises an inducible promoter; Preferably, the inducible promoter is P xyla .

3. Thermoglucosidase Geobacillus CRISPR type IB gene editing system, characterized in that: The gene editing system comprises the gene editing vector according to claim 1 or 2 and an expression system or expression vector containing the thermoglucosidase Geobacillus Cas1-Cas8 proteins, wherein the expression system containing the thermoglucosidase Geobacillus Cas1-Cas8 proteins is located on the chromosome of the thermoglucosidase Geobacillus; optionally comprising a donor vector; The thermoglucosidase Geobacillus is NCIMB 11955.

4. The gene editing system according to claim 3, characterized in that The construction method of the gene editing vector is as follows: A. Construction of plasmid pZH01 A1. Use primers repB-F and repB-R and primers amp-F and amp-R to PCR amplify the repB fragment and amp fragment respectively using pUB-sfGFP plasmid as template; The sequences of the primers repB-F and repB-R are 5′-CCCTTTCGTCCACAGCTTGTCTGTAAGCGG-3′ and 5′-AAGGAACTTGCGAATTCACTGGCCGTCGTTTTAC-3′, respectively; The sequences of the primers amp-F and amp-R are 5′-CAGGTGTCCTAAGCTTGGCGTAATCATGG-3′ and 5′-ACAAGCTGTGGACGAAAGGGCCTCGTGATAC-3′, respectively; A2, using primers xylR-F and xylR-R to PCR amplify the genome of Geobacillus thermoglucosidase NCIMB 11955 as a template to obtain the xylR fragment; The sequences of the primers xylR-F and xylR-R are 5′-AGTGAATTCGCAAGTTCCTTTCGCCGCAAAAATG-3′ and 5′-CGCCAAGCTTAGGACACCTGATTAGACTGC-3′, respectively; A3, the three fragments were assembled by Gibson to obtain the intermediate plasmid pxylR; A4, using primers dbt-F and dbt-R, pUB-sfGFP plasmid was used as a template to amplify the downstream repeat fragment and terminator fragment; using primers lacZ-F and lacZ-R, pCas plasmid was used as a template to amplify the lacZ fragment by PCR; Primers pxyla-F and pxyla-R were used for direct annealing to obtain the pxyla fragment and the upstream repeat fragment; primers pZH01V-F) and pZH01V-R were used to amplify the vector fragment using the intermediate plasmid pxylR as a template; then the terminator fragment, lacZ fragment, pxyla fragment and vector fragment were assembled using the Gibson method to obtain the plasmid pZH01; The sequences of the primers dbt-F and dbt-R are 5′-TCTCGTTTGTATCTTACCTATGAGGAATTGAAACCAGGCATCAAATAAAACGAA AG-3′ and 5′-GCATGCGAGTCACTAAGGGCTAACTAAC-3′, respectively; The sequences of the primers pxyla-F and pxyla-R are 5′-GAGCTCCATAAACTTTGTTTGTACACTAGACAAACAAATTTAACCGCATTATA ATTTAG-3′ and 5′-CGTCTCGTTTCAATTCCTCATAGGTAAGATACAAACCAACTAAATTATAATGC GGTTAA-3′, respectively; The sequences of the primers pZH01V-F and pZH01V-R were 5′-GCCCTTAGTGACTCGCATGCCACAGCTTGTCTGTAAGCGG-3′ and 5′-AAACAAAGTTTATGGAGCTCGACGAAAGGGCCTCGTGATAC-3′, respectively; B. Design and synthesize a forward monomer 5'-Nx-3' and a reverse monomer 5'--N'x-3' targeting the sgRNA action site; wherein N'x is the reverse complementary sequence of Nx, and N and N' represent bases A, T, G or C; The two monomers are annealed to form a double-stranded DNA with sticky ends; C. Use Esp3I to digest the plasmid pZH01 to obtain the backbone vector, and then use T4 ligase to connect the backbone vector with the double-stranded DNA with sticky ends to obtain the gene editing vector; The construction method of the expression vector containing the thermoglucosidase Geobacillus Cas1 to Cas8 proteins is as follows: using primers IB-F and IB-R, taking the genome of thermoglucosidase Geobacillus NCIMB 11955 as a template, PCR amplification to obtain an insert fragment; using primers pNW33-F and pNW33-R, taking the pThermoCas9_ctrl plasmid as a template, PCR amplification to obtain a backbone plasmid, and then connecting the insert fragment with the backbone plasmid to obtain; The sequences of the primers IB-F and IB-R are 5′-TACGGGGTCTGACGCAACCCCAACTAAGGGCAGTC-3′ and 5′-CCTTTGGGAAGTTTGTGCGCTATTAGGGATCGACG-3′, respectively; The sequences of the primers pNW33-F and pNW33-R are 5′-ATCCCTAATAGCGCACAAACTTCCCAAAGGCGAGC-3′ and 5′-CCCTTAGTTGGGGTTGCGTCAGACCCCGTAGAAAA-3′, respectively.

5. Thermoglucosidase Geobacillus CRISPR type IB gene silencing vector, characterized in that: The DNA sequence of the sgRNA action site of the gene silencing vector is 5'-TTA-Nx-3'; wherein TTA is the PAM sequence; N represents the base A, T, G or C, and x is an integer between 11 and 26; The thermoglucosidase Geobacillus is NCIMB 11955.

6. The gene silencing vector according to claim 5, characterized in that: The gene silencing vector comprises a constitutive promoter; Preferably, the constitutive promoter is P ldh or P RplsWT .

7. Thermoglucosidase Geobacillus CRISPR type IB gene silencing system, characterized in that: The gene silencing system comprises the gene silencing vector according to claim 5 or 6 and an expression vector containing the thermoglucosidase Geobacillus Cas1 to Cas8 proteins; The thermoglucosidase Geobacillus is NCIMB 11955.

8. The gene silencing system according to claim 7, characterized in that: The construction method of the gene silencing vector is as follows: a. Construction of plasmid pZH04 a1. Use primers repeat 1F and repeat 1R and primers repeat 2F and repeat 2R to directly anneal to obtain fragments repat 1 and fragment repeat 2; The sequences of the primers repeat 1F and repeat 1R are 5′-AAGCATTGTCGTTTGTATCTTACCTATGAGGAATTGAAACGAGA-3′ and 5′-GGCGATGCGGCCGCCGATGGTCTCGTTTCAATTCCTCATA-3′, respectively; The sequences of the primers repeat 2F and repeat 2R are 5′-CCATCGGCGGCCGCATCGCCATGGACTGGGTCTCCGTTTGTATCTTACCT-3′ and 5′-GATGCCTGGCGTTTCAATTCCTCATAGGTAAGATACAAACGGAGA-3′, respectively; a2. Use primers pRplsWT-F and pRplsWT-R to amplify the promoter fragment P using the genome of Geobacillus thermoglucosidase NCIMB 11955 as a template. RplsWT ; The sequences of the pRplsWT-F and pRplsWT-R are 5′-CAGTGAATTCAACAATCGTTAAAGCGGACG-3′ and 5′-AGATACAAACGACAATGCTTTTTCATCATTG-3′, respectively; a3. Use primers TF and TR to amplify the terminator fragment using pUB-sfGFP plasmid as a template; The sequences of the primers TF and TR are 5′-GAATTGAAACGCCAGGCATCAAATAAAACG-3′ and 5′-TAGAGGATCCGAGTCACTAAGGGCTAACTAAC-3′, respectively; a4. Use primers pZH04V-F and pZH04V-R to amplify the vector fragment using the pUCG3.8 plasmid as a template; The sequences of the primers pZH04V-F and pZH04V-R were 5′-TTAGTGACTCGGATCCTCTAGAGTCGACCTG-3′ and 5′-AACGATTGTTGAATTCACTGGCCGTCGTTTTAC-3′, respectively; a5, repeat fragment 1, repeat fragment 2, promoter fragment P RplsWT , the terminator fragment and the vector fragment were assembled using Gibson to obtain plasmid pZH04; b. Design and synthesize the forward monomer 5'-Nx-3' and the reverse monomer 5'--N'x-3' targeting the sgRNA action site; wherein N'x is the reverse complementary sequence of Nx, and N and N' represent the base A, T, G or C; The two monomers are annealed to form a double-stranded DNA with sticky ends; c. Use BsaI to digest the plasmid pZH04 to obtain a backbone vector, and then use T4 ligase to connect the backbone vector with the double-stranded DNA with sticky ends to obtain a gene silencing vector; The method for constructing the expression vector containing the thermoglucosidase Geobacillus Cas1-Cas8 proteins is the same as that described in claim 4.

9. Use of the gene editing vector according to claim 1 or 2, the gene editing system according to claim 3 or 4, or the gene silencing vector according to claim 5 or 6, or the gene silencing system according to claim 7 or 8 in host gene editing or gene silencing; The host includes thermophilic bacteria, eukaryotic host cells, and prokaryotic host cells.

10. The use according to claim 9, characterized in that: The gene editing system or gene silencing system is active at 37°C-70°C.

Images