Application of corn gene ZmGG2 in control of corn yield

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses an application of a corn gene ZmGG2 in control of corn yield, a protein encoded by the ZmGG2 is shown in SEQ ID NO.2, and the gene is located in the seventh chromosome of corn and used for controlling the row number and the ear weight of corn ears. The gene is knocked out by using a CRISPR / Cas9 technology, gene expression is inhibited, and the ear row number and the ear weight of corn can be increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of corn gene ZmGG2 in controlling corn yield. The gene of the present invention is located on the seventh chromosome of corn, and controls important yield traits such as the number of female ears and / or ear weight of corn. Background Art

[0002] Corn yield is a complex quantitative trait controlled by multiple genes. Ear length, number of kernels per row, number of rows per ear, ear weight and cob weight are important components of corn yield. Dissecting corn yield traits into different yield factors for study is conducive to analyzing the genetic basis of yield trait formation, helping breeders to more effectively use genetic resources to design breeding strategies and achieve the goal of efficient breeding. Under a specific planting density, the yield per unit area of ​​corn is determined by the yield of kernels per ear and the number of ears; the yield of kernels per ear is determined by the number of kernels per ear and the weight of 100 kernels, and the number of kernels per ear is determined by the number of rows per ear and the number of kernels per row; the length and thickness of corn ears are significantly correlated with the number of kernels per row and the number of rows per ear, respectively. Referring to the yield and related trait data of 32 different corn varieties published by Argentina between 1965 and 2016, the maximum possible planting density was maintained in the experimental design and three replicates were planted in random blocks. The results showed that in the past 50 years of breeding, corn yield increased at an average rate of 113kg / ha / year, and the increase in yield was positively correlated with the increase in the number of grains per ear and had nothing to do with the change in the weight of a single grain. The biomass accumulation of a single ear increased year by year, while the interval between tasseling and silking shortened, and the flowering period tended to be coordinated; but the efficiency of grain formation remained unchanged, and the gradual trend of all traits was in line with expectations, indicating that the increase in the number of grains per ear was an important reason for the annual increase in yield. Analyzing the genetic basis of ear length and row kernel number is of great significance for understanding the mechanism of corn yield formation, and also provides a theoretical basis for breeding practice.

[0003] In view of this, this study used genetic methods to isolate a gene ZmGG2 located on chromosome 7 of maize that controls the number of rows and weight of maize ears. This gene encodes a G protein γ subunit protein that participates in the sugar signal transduction pathway of plants. Based on the genetic phenotype of transgenic materials and related molecular biological analysis, the biological function of this gene in controlling traits such as the number of rows and weight of ears was confirmed. The genetic transformation research of ZmGG2 can provide genetic resources and theoretical support for maize breeding. Summary of the invention

[0004] The purpose of the present invention is to provide an application of corn gene ZmGG2 in controlling corn yield. The protein encoded by the gene is shown in SEQ ID NO.2.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] Application of maize gene ZmGG2 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO.2 (NP_001152197.2);

[0007] The above-mentioned applications are as follows:

[0008] Application of reducing the expression of maize gene ZmGG2 in increasing maize yield;

[0009] Application of knocking out, inhibiting or silencing the expression of maize gene ZmGG2 in improving maize yield;

[0010] In the above-mentioned applications, preferably, the knockout is carried out using the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein, thereby achieving the effect of increasing corn yield.

[0011] Preferably, the target sites of gRNA in the CRISPR / Cas9 system are GCTTCTCTAGTCCCGAACAC and GAGATCGAATTCCTCA.

[0012] In the above-mentioned application, preferably, the edited corn mutant with improved yield contains the sequence shown in SEQ ID NO.5 or SEQ ID NO.6.

[0013] Application of increasing the expression of maize gene ZmGG2 in reducing maize yield;

[0014] The application described above comprises the process of introducing a substance that increases the expression level of the corn ZmGG2 gene into corn;

[0015] In the above application, preferably, the substance is a nucleic acid molecule containing the ZmGG2 gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0016] The ZmGG2 gene is shown as SEQ ID NO.1.

[0017] In the above application, the control of corn yield is achieved by controlling the number of ear rows and / or ear weight.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The present invention cloned and confirmed the gene ZmGG2 that controls the number of ear rows and ear weight in corn, confirmed the relationship between the number of ear rows and ear weight and the expression level of ZmGG2, and the number of ear rows and ear weight of corn can be increased by reducing its expression level. The difference in the number of grains per ear between transgenic materials and wild-type materials is due to the editing of the gene coding region, which causes the protein level encoded by the gene to decrease. In terms of mechanism of action, it is believed that the gene participates in the signal response of sugar in the plant body, increases the response of sugar signals, and then regulates the expression of downstream genes, and finally regulates the differentiation activity of corn inflorescence meristems, affecting the yield traits of corn such as the number of ear rows and ear weight. Therefore, the present invention provides a new gene resource for corn yield improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a schematic diagram of maize ZmGG2 gene knockout material;

[0021] Among them: A is a schematic diagram of the editing of the corn ZmGG2 gene, in which zmgg2-1 lacks the A base and zmgg2-2 lacks the AT base. The insertion and deletion of these bases lead to premature termination of protein translation.

[0022] B is a schematic diagram of the protein structure of maize ZmGG2 gene knockout materials, from top to bottom: the wild-type family (WT) isolated from transgenic heterozygous plants, and two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0023] C is a schematic diagram of the female ear of the maize ZmGG2 gene knockout material, from top to bottom, they are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0024] D is a schematic diagram of the number of ear rows of maize ZmGG2 gene knockout materials, and the bar graphs from left to right are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0025] E is a schematic diagram of the ear width of the maize ZmGG2 gene knockout material, and the bar graphs from left to right are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2;

[0026] F is a schematic diagram of ear weight of maize ZmGG2 gene knockout materials. The bar graphs from left to right are the wild-type family (WT), two ZmGG2 gene-edited families zmgg2-1 and zmgg2-2.

[0027] Figure 2 Schematic diagram of the expression pattern of the maize ZmGG2 gene;

[0028] Among them: A: ZmGG2 is highly expressed in maize meristem; BC: In situ hybridization results showed that ZmGG2 is specifically expressed in IM (inflorescence meristem), SPM (spikelet pair meristem) and SM (spikelet meristem) of 2mm young ears. DETAILED DESCRIPTION

[0029] The following embodiments further define the present invention. According to the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for various uses and conditions. The technical solutions described in the present invention, unless otherwise specified, are conventional solutions in the art; the reagents or materials, unless otherwise specified, are all from commercial channels or published materials.

[0030] Example 1: ZmGG2 cloning

[0031] Total DNA was extracted from the leaves of the inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesis stream line trait gene identification in maize. The Plant Cell, 2020, 32: 1397–1413). Primers G2-F and G2-R were designed based on the genome reference sequence of maize B73 (National Crop Germplasm Center). The ZmGG2 gene was PCR amplified and resequenced in the KN5585 material to obtain the complete CDS nucleotide sequence of the ZmGG2 gene (SEQ ID NO.1). The protein encoded by this gene is shown in SEQ ID NO.2.

[0032] The total DNA of plant leaves was extracted using the CTAB method, and the PCR amplification program was as follows: pre-denaturation at 94°C for 5 min, followed by denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 60 s for 34 cycles, and finally extension at 72°C for 5 min.

[0033] Table 1. Primers used in the present invention and their sequences

[0034]

[0035] Example 2: Genetic transformation of ZmGG2 in maize

[0036] The genetic transformation of ZmGG2 gene knockout uses ZmGG2 in the transgenic receptor material KN5585 as the applied gene, and the sequence is shown in SEQ ID NO.1. Using CRISPR-P website ( http: / / cbi.hzau.edu.cn / crispr / ) was used to design the gene target, and finally the Guide RNA (Target: GCTTCTCTAGTCCCGAACAC and GAGATCGAATTC CTCA) was obtained. According to the Guide RNA, two ZmU6-Target-sgRNA fragments (shown in SEQ ID NO.3 and SEQ ID NO.4) were synthesized by gene synthesis and constructed into the pEASY-T1 commercial vector.

[0037] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, primer ID 2), the CPB-ZmUbi-hspCas9 vector was linearized by HindIII single enzyme digestion, gel electrophoresis was recovered and detected, and the Guide RNA was connected to the target vector CPB-ZmUbi-hspCas9 (CN113004383A) by homologous recombination. Finally, the obtained clone was sequenced using CRISPR vector detection primers (primer sequences are shown in Table 1, primer ID is 3) to confirm that the target fragment was connected to the vector.

[0038] The correctly cloned plasmid was transformed into the maize inbred line KN5585 by Agrobacterium-mediated transformation (the genetic transformation was completed by the Life Science Technology Center of China National Seed Group Co., Ltd.). Using specific ZmGG2 gene detection primers (primer sequences are shown in Table 1, primer ID4), two maize transformation events with KN5585 as the background were screened and obtained ( Figure 1 A), zmgg2-1 and zm gg2-2, among which zmgg2-1 lacks the G base (zmgg2-1 contains the sequence shown in SEQ ID NO.5), and zmgg2-2 lacks the CG base (zmgg2-2 contains the sequence shown in SEQ ID NO.6). The insertion and deletion of these bases lead to the premature termination of protein translation ( Figure 1 Furthermore, the phenotypic values ​​of maize ear length and kernel number per row in the ZmGG2 knockout family were investigated in Gansu in 2023 ( Figure 1 The results showed that compared with WT, the number of ear rows of zmgg22-1 and zmgg2-2 maize increased by 12.4% and 11.7%, respectively, after the loss of ZmGG2 gene function. Figure 1 D), the ear width increased by 19.9% ​​and 14.9% ( Figure 1 Middle E), the average ear weight increased by about 10.9% ( Figure 1Based on the above results, it was proved that reducing the expression of ZmGG2 gene can increase the ear length and the number of kernels per row of corn.

[0039] Embodiment 3:

[0040] Expression analysis of ZmGG2

[0041] Based on the maize B73 expression database, the expression pattern of the ZmGG2 gene was analyzed and the expression level of the ZmGG2 gene in maize meristem was very high (FPKM) ( Figure 2 At the same time, we used RNA in situ hybridization to verify the specific expression pattern of ZmGG2 in ~2mm panicles ( Figure 2 BC, primer sequences are shown in Table 1, primer ID 5), the gene is mainly highly expressed in the early IM, SPM and SM of maize young ears; therefore, ZmGG2 affects maize traits such as ear length and number of kernels per row.

Claims

1. Corn Genes ZGar In the application of controlling corn yield, the protein encoded by the gene is shown as SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The application process is to reduce the corn gene ZGar expression increased corn yield.

3. The use according to claim 1, characterized in that: The application process is to knock out, inhibit or silence corn genes ZGar expression increased corn yield.

4. The use according to claim 3, characterized in that: The knockout uses the CRISPR / Cas9 system, and the protein translated from the knocked-out gene has no original function or cannot be translated into protein.

5. The use according to claim 4, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are GCTTCTCTAGTCCGAACA and CCTTGAGGAAGTCGATCTCGG.

6. The use according to claim 1, characterized in that: The application process is to improve the corn gene ZGar The expression level of α-glucose reduced corn yield.

7. The use according to claim 6, characterized in that: The application process includes increasing the corn ZGar Gene expression levels of substances introduced into corn.

8. The use according to claim 7, characterized in that: The substance is ZGar A nucleic acid molecule of a gene, or an expression frame thereof, a recombinant vector, or a recombinant microorganism.

9. The use according to claim 1, characterized in that: The ZGar The gene is shown as SEQ ID NO.

1.

10. The use according to claim 1, characterized in that: The corn yield is controlled by controlling the number of ear rows and / or ear weight.

Images