Construction method of Alport syndrome animal model, kit and application thereof

Abstract

The invention provides a construction method of an Alport syndrome animal model, a kit and application of the kit, and relates to the technical field of biology. The animal model construction method comprises the following steps: enabling a COL4A5 gene of a tested animal to generate COL4A5-c.1517-1Ggt corresponding to an Alport syndrome patient; t mutation. According to the model construction method, the problem that in the prior art, COL4A5 gene mutation type Alport syndrome animal models are deficient is solved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for constructing an Alport syndrome animal model, a kit and applications thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Alport syndrome (AS) is a hereditary nephropathy caused by mutations in the COL4A3, COL4A4, and COL4A5 genes encoding the α3, α4, and α5 chains of type IV collagen. The main manifestation is progressive renal function impairment, and some patients have extrarenal organ damage, but the factors affecting the prognosis of Alport syndrome and its molecular mechanisms are still unclear. Structural abnormalities of type IV collagen can lead to glomerular basement membrane dysfunction, causing proteinuria and hematuria. Some patients also have extrarenal symptoms such as sensorineural hearing loss and eye abnormalities. The prognosis of Alport syndrome is usually poor, and there is currently no cure. Early use of angiotensin-converting enzyme inhibitors (ACEI) and angiotensin receptor blockers (ARB) can delay the progression of patients to renal failure.

[0004] The number of patients with Alport syndrome with COL4A5 gene mutation accounts for 80% to 85% of the total number of patients, and a small number of patients have Alport syndrome with COL4A3 and COL4A4 gene mutations. The COL4A5 gene is located on the X chromosome, so X-linked Alport syndrome (XLAS) is more common in men, with more severe clinical manifestations, and almost 100% of them will develop end-stage renal disease. Although the pathogenic gene is known, the molecular mechanism that affects the onset and prognosis of Alport syndrome is still unclear at this stage.

[0005] Previous studies have shown that the prognosis of X-linked Alport syndrome is closely related to the type of gene mutation. The mutation type of the COL4A5 gene, such as splice site mutations, exon sequence deletions and insertions, is an important factor affecting the onset of Alport syndrome. Jais et al. found that patients with large deletions and nonsense mutations had a 90% probability of developing end-stage renal disease at the age of 30, while patients with splice site mutations had a risk of 70% and missense mutations had a risk of 50%. Bekheirnia et al. found that mutations close to the 5′ end can cause Alport syndrome to progress to ESRD faster. The average age of ESRD in Alport syndrome patients with missense mutations was 37 years old, those with splice site mutations were 28 years old, and those with truncated mutations were 25 years old10. The above studies found that the type of gene mutation is closely related to the age of onset and prognosis of Alport syndrome. However, due to the wide variety of gene mutations, the genotype-phenotype correlation of Alport syndrome patients and the molecular mechanisms involved still need further study.

[0006] Establishing an effective animal model of Alport syndrome is of great significance for exploring the prognostic differences caused by different mutation types and developing new targeted drugs. There are obvious differences in the disease manifestations of animal models with different mutation types. At present, the construction of Alport syndrome mouse models with various genetic methods provides more platforms for exploring its pathogenesis. However, the existing mouse models are mainly mutant types of the Col4a3 gene. Although Alport syndrome with COL4A5 gene mutation is more common in the population, there are few Col4a5 mutant Alport syndrome mouse models in the field of basic research.

[0007] There are three mouse models with Col4a5 gene mutations reported so far, all of which are mouse models of Alport syndrome caused by exon mutations of Col4a5 gene, namely, nonsense mutations G5X, R471X, and frameshift mutations caused by ATGG deletion. Rheault et al. and Kentarou Hashikami et al. constructed mouse models with exon point mutations of Col4a5 gene (mutation sites are G5X and R471X, respectively), which will lead to the premature appearance of stop codons, thereby affecting the synthesis of Col4a5 collagen. Wei-qing Wu et al. confirmed that the misplacement mutation caused by ATGG deletion will lead to abnormal function of Col4a5 collagen. Providing more types of Alport syndrome animal models with COL4A5 gene mutations will help provide reliable clinical research tools for further exploring the heterogeneity of Alport syndrome.

[0008] In view of this, the present invention is proposed. Summary of the invention

[0009] The object of the present invention is to provide a method for constructing an Alport syndrome animal model to alleviate the problem of lack of a COL4A5 gene mutant Alport syndrome animal model in the prior art.

[0010] In order to solve the above technical problems, the present invention particularly adopts the following technical solutions:

[0011] In a first aspect, a method for constructing an Alport syndrome animal model is provided, the method comprising causing the COL4A5 gene of the test animal to undergo a COL4A5-c.1517-1G>T mutation corresponding to that of an Alport syndrome patient.

[0012] In an optional embodiment, the subject animal includes a mammal.

[0013] In an optional embodiment, the test animal is a mouse, and the Col4a5-c.1517-1G>T mutation is performed using the ENSMUST00000112931.7 transcript as a reference sequence.

[0014] In an optional embodiment, the Alport syndrome animal model has one or more of the following properties (i)-(vi) compared to the non-mutated test animal:

[0015] (i) increased urine protein / creatinine ratio;

[0016] (ii) elevated levels of serum urea nitrogen and creatinine;

[0017] (iii) abnormal glomerular morphology;

[0018] (iv) atrophy and / or disappearance of the tubular brush border;

[0019] (v) Decreased number of podocytes;

[0020] (vi) Immune cell infiltration occurs in the renal interstitium.

[0021] In an optional embodiment, the construction method includes using a gene editing system to mutate the COL4A5 gene of the test animal.

[0022] In an optional embodiment, gene editing is performed using at least one CRISPR / Cas gene editing system.

[0023] In an optional embodiment, the CRISPR / Cas gene editing system includes one or more of (i) to (iii):

[0024] (i) an sgRNA targeting a target fragment, or a polynucleotide encoding the sgRNA;

[0025] (ii) a donor DNA, or a polynucleotide encoding the donor DNA;

[0026] (iii) Cas nuclease, or a polynucleotide encoding a Cas nuclease.

[0027] In an optional embodiment, the test animal is a mouse, the sgRNA includes sgRNA1 with a nucleotide sequence as shown in SEQ ID NO.1 and sgRNA2 with a nucleotide sequence as shown in SEQ ID NO.2, and the nucleotide sequence of the donor DNA is shown in SEQ ID NO.3.

[0028] In a second aspect, a kit for constructing an Alport syndrome animal model is provided, wherein the animal model is a mouse, and the kit comprises one or more of (i) to (iii):

[0029] (i) an sgRNA targeting a target fragment, or a polynucleotide encoding the sgRNA; the sgRNA comprises an sgRNA1 having a nucleotide sequence as shown in SEQ ID NO.1 and an sgRNA2 having a nucleotide sequence as shown in SEQ ID NO.2;

[0030] (ii) donor DNA, or a polynucleotide encoding the donor DNA; the nucleotide sequence of the donor DNA is shown in SEQ ID NO.3;

[0031] (iii) Cas nuclease, or a polynucleotide encoding a Cas nuclease.

[0032] In an optional embodiment, the Cas nuclease includes Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9.

[0033] In a third aspect, a method for constructing an Alport syndrome animal model according to the first aspect, or use of the kit for constructing an Alport syndrome animal model according to the second aspect in preparing a drug for preventing and / or alleviating Alport syndrome is provided.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The present invention provides a new method for constructing an Alport syndrome animal model caused by a COL4A5Col4a5 gene mutation. By causing the test animal to have a COL4A5-c.1517-1G>T mutation corresponding to the Alport syndrome patient, the prepared animal model has at least one of the following properties: (i) an increased urine protein / creatinine ratio; (ii) increased levels of urea nitrogen and creatinine in serum; (iii) abnormal glomerular morphology; (iv) atrophy and / or disappearance of the renal tubular brush border; (v) a decrease in the number of podocytes; and (vi) immune cell infiltration in the renal interstitium. The construction method is the first to prepare an X-linked inherited animal model capable of causing a large number of immune cells to infiltrate the kidney. The construction method of the Alport syndrome animal model provides a reliable clinical research tool for further exploring the heterogeneity of Alport syndrome. It is also the first reported method for constructing an X-linked recessive inherited Alport syndrome animal model caused by a splicing mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0037] Figure 1 The pedigree of the proband in Example 1 (a) and the Sanger sequencing results of the proband, father, mother and sister (b). The black color in the pedigree (a) indicates the patient carrying the COL4A5-c.1517-1G>T mutation, and the red box highlights the gene mutation site (b);

[0038] Figure 2 The histological changes of the renal tissue of the patient in Example 1, (a) PAS staining (×400), (b) PASM staining (×400), (c) MASSON staining (×400);

[0039] Figure 3 This is a schematic diagram of sequencing of wild-type COL4A5 gene transcription products in Example 2;

[0040] Figure 4 The sequencing diagram of the wild-type COL4A5 gene and the COL4A5-c.1517-1G>T gene transcription products in Example 2;

[0041] Figure 5 The targeting strategy for the Col4a5-c.1517-1G>T mutant mice in Example 3;

[0042] Figure 6 The electrophoresis results of the PCR products of the target region of F1 mice in Example 3, No. 126, 127, 128 represent KI mice, and No. 129 and C57L / B6J are used as controls;

[0043] Figure 7 The sequencing results of the F1 mouse target region in Example 3, the red mark indicates the Col4a5-c.1517-1G>T mutation site;

[0044] Figure 8 The biochemical parameters of Col4a5-c.1517-1G>T mice of different ages in Example 4, (A) growth curve of mouse body weight, (B) change of urine protein to creatinine ratio in 24-hour urine, (C) change of creatinine (Cre) in 24-hour urine, (D) change of blood urea nitrogen, P<0.05*P<0.01**, unpaired t test was used for comparison between groups;

[0045] Fig. 9 Representative images of H&E staining of kidney tissues of wild-type and KI mice at 7, 14, 21 and 28 weeks of age in Example 4 (magnification × 100);

[0046] Fig.10 Representative images of PAS staining of kidney tissues of wild-type and KI mice at 7, 14, 21 and 28 weeks of age in Example 4 (magnification × 200);

[0047] Fig.11 Representative images of Masson staining of kidney tissues of wild-type and KI mice at 7, 14, 21, and 28 weeks of age in Example 4 (magnification ×200);

[0048] Fig.12 The results of HE staining of renal podocytes of wild-type and KI group mice from 7 to 28 weeks in Example 4;

[0049] Fig.13 The quantitative analysis results of podocytes in the wild type and KI groups from 7 to 28 weeks in Example 4, P < 0.01**, unpaired t-test was used for comparison between groups;

[0050] Fig.14 Renal pathological images of Alport syndrome model mice (KI group mice) and wild-type mice at 7, 14, 21, and 28 weeks of age, shown using transmission electron microscopy;

[0051] Fig.15The renal pathological images of Alport syndrome model mice (KI group mice) and wild-type mice at 7, 14, 21 and 28 weeks of age were displayed using scanning electron microscopy;

[0052] Fig.16 These are representative images of CD3 and CD68 immunostaining of wild-type control group mice and KI group mice in Example 4. DETAILED DESCRIPTION

[0053] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0054] As used herein, unless otherwise stated, "optionally", "optional", "optional" or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs or does not occur.

[0055] Herein, the terms "comprise" or "comprising" are intended to include stated elements, integers or steps, but not to exclude any other elements, integers or steps.

[0056] In this article, "COL4A5" represents the name of the gene, COL4A5 refers to the gene of collagen, alpha-5 (IV) chain; "c.1517-1G>T" describes a mutation that occurs in this gene, where: "c." indicates that this is a mutation in the coding region of the gene, "1517-1" indicates that the mutation occurs in the base before the 1517th base of the gene, and "G>T" indicates that at this position, the original base G is replaced by the base T.

[0057] “Corresponding to the COL4A5-c.1517-1G>T mutation in patients with Alport syndrome” means that when the gene of the test animal is compared with the COL4A5 gene of patients with Alport syndrome, the site where the mutation occurs in the test animal is equivalent to COL4A5-1517-1, and the original nucleotide is mutated to T at the equivalent position. Unless otherwise specified, "COL4A5" in this article means the human COL4A5 gene or the COL4A5 gene of no particular species. "Col4a5" means the COL4A5 gene of mice. The COL4A5 gene of patients with Alport syndrome is a human COL4A5 gene.

[0058] Herein, "Cas nuclease" refers to a Cas nuclease that can bind to a target sequence, or cut or create an incision in a target sequence, or mutate a target sequence, and the Cas nuclease includes but is not limited to a natural Cas nuclease or a polypeptide or complex containing the main functional domain of the Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused with other functional regions. The Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or a protein, polypeptide or complex formed by mutation of the above Cas nuclease and / or fusion with other functional domains.

[0059] As used herein, "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases. When a polynucleotide encodes a protein or polypeptide, the encoding may optionally encode a sense strand or an antisense strand. A polynucleotide may be naturally occurring, synthetic, recombinant, or any combination thereof. "Nucleic acid molecule," "nucleic acid" and "polynucleotide" may be used interchangeably.

[0060] Alport syndrome is a hereditary kidney disease, and the onset and prognosis of the disease vary significantly among patients with different COL4A5 gene mutation types. Although 80-85% of Alport syndrome patients are caused by pathogenic variants of the COL4A5 gene, there is a lack of animal models of COL4A5 mutations in basic research. Currently, all mouse models of Col4a5 gene mutations cause Alport syndrome through exon mutations of the Col4a5 gene, and it is still unclear how the mutations in the intron region of the COL4A5 gene affect the pathogenicity of Alport syndrome.

[0061] The inventors found a patient with Alport syndrome who had facial edema and abnormal urine at the age of 8. Through next-generation sequencing, it was found that the COL4A5-c.1517-1G>T mutation existed in the intron sequence of the COL4A5 gene of the family members and the patient. The mutation site was located in the intron region, and the genotype and phenotype were co-segregated, but the pathogenicity of the mutation site was still unclear. Minigene experiments confirmed that the mutation of this intron site would affect the splicing of COL4A5. The inventors used the CRISPR / Cas9 system to construct a mouse model of Col4a5-c.1517-1G>T mutation for this genetic pattern. Biochemical urine analysis, histopathology, immunofluorescence and transmission electron microscopy (TEM) tests confirmed that this mouse model can effectively simulate the clinical Alport syndrome phenotype. It was also noted that a large number of immune cell infiltrations in the renal interstitium can be observed in this mouse model.

[0062] Based on the above findings, in a first aspect, a method for constructing an Alport syndrome animal model is provided, the method comprising causing the COL4A5 gene of the test animal to undergo a COL4A5-c.1517-1G>T mutation corresponding to that of an Alport syndrome patient.

[0063] In an optional embodiment, the COL4A5 gene mutation position of the test animal and the Alport syndrome patient is the same, and the construction method includes causing the COL4A5 gene of the test animal to undergo a COL4A5-c.1517-1G>T mutation.

[0064] In an optional embodiment, the subject animal comprises a mammal, including but not limited to monkeys, dogs, cats, mice, rats, cows, horses, camels, alpacas, goats or sheep.

[0065] In an optional embodiment, the test animal comprises a mouse.

[0066] In an optional embodiment, the test animal is a mouse, and the Col4a5-c.1517-1G>T mutation is performed using the ENSMUST00000112931.7 transcript as a reference sequence.

[0067] In an optional embodiment, the Alport syndrome animal model has one or more of the following properties (i)-(vi) compared to the non-mutated test animal:

[0068] (i) increased urine protein / creatinine ratio;

[0069] (ii) elevated levels of serum urea nitrogen (BUN) and creatinine (Cre);

[0070] (iii) abnormal glomerular morphology;

[0071] (iv) atrophy and / or disappearance of the tubular brush border;

[0072] (v) Decreased number of podocytes;

[0073] (vi) Immune cell infiltration occurs in the renal interstitium.

[0074] In an optional embodiment, the abnormal glomerular morphology includes one or more of proliferation of parietal epithelial cells, crescent formation, focal sclerosis, global sclerosis and increased renal fibrosis.

[0075] In an optional embodiment, the immune cells infiltrating the renal interstitium include CD3 + T cells and / or CD68 + Macrophages.

[0076] In an optional embodiment, the construction method includes using a gene editing system to mutate the COL4A5 gene of the test animal. The gene editing system can use an optional gene editing system acceptable in the art, and the present invention is not limited thereto.

[0077] In an optional embodiment, gene editing is performed using at least one CRISPR / Cas gene editing system.

[0078] In an optional embodiment, the CRISPR / Cas gene editing system includes one or more of (i) to (iii):

[0079] (i) an sgRNA targeting a target fragment, or a polynucleotide encoding the sgRNA;

[0080] (ii) donor DNA, or a polynucleotide encoding the donor DNA (Donor);

[0081] (iii) Cas nuclease, or a polynucleotide encoding a Cas nuclease.

[0082] In an optional embodiment, the polynucleotide encoding the sgRNA is mRNA or a recombinant vector, and the mRNA or the recombinant vector is transformed into a test cell to express the sgRNA.

[0083] In an optional embodiment, the polynucleotide encoding the donor DNA is mRNA or a recombinant vector, and the mRNA or recombinant vector is transformed into a test cell to express the donor DNA.

[0084] In an optional embodiment, the polynucleotide encoding the Cas nuclease is mRNA or a recombinant vector, and the mRNA or the recombinant vector is transformed into a test cell to express the Cas nuclease.

[0085] In an optional embodiment, the Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HFCas9, Cas12a, Cas12b, SaCas9 or SpCas9;

[0086] In an optional embodiment, the Cas nuclease is Cas9.

[0087] In an optional embodiment, the test animal is a mouse, the sgRNA includes sgRNA1 with a nucleotide sequence as shown in SEQ ID NO.1 and sgRNA2 with a nucleotide sequence as shown in SEQ ID NO.2, and the nucleotide sequence of the donor DNA (donor) is shown in SEQ ID NO.3.

[0088] In an optional embodiment, the construction method may use any conventional method known in the art to introduce the CRISPR / Cas gene editing system into cells, such as but not limited to liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electrofection, transduction, gene gun or microinjection.

[0089] In an optional embodiment, the construction method further includes mating a heterozygous female test animal with a COL4A5-c.1517-1G>T mutation corresponding to the Alport syndrome patient's gene with a wild-type male test animal, and using the mutant male mice produced by the passage as an animal model.

[0090] In a second aspect, a kit for constructing an Alport syndrome animal model is provided, wherein the animal model is a mouse, and the kit comprises one or more of (i) to (iii):

[0091] (i) an sgRNA targeting a target fragment, or a polynucleotide encoding the sgRNA; the sgRNA comprises an sgRNA1 having a nucleotide sequence as shown in SEQ ID NO.1 and an sgRNA2 having a nucleotide sequence as shown in SEQ ID NO.2;

[0092] (ii) donor DNA, or a polynucleotide encoding the donor DNA; the nucleotide sequence of the donor DNA is shown in SEQ ID NO.3;

[0093] (iii) Cas nuclease, or a polynucleotide encoding a Cas nuclease.

[0094] In an optional embodiment, the polynucleotide encoding the sgRNA is mRNA or a recombinant vector, and the mRNA or the recombinant vector is transformed into a test cell to express the sgRNA.

[0095] In an optional embodiment, the polynucleotide encoding the donor DNA is mRNA or a recombinant vector, and the mRNA or recombinant vector is transformed into a test cell to express the donor DNA.

[0096] In an optional embodiment, the polynucleotide encoding the Cas nuclease is mRNA or a recombinant vector, and the mRNA or the recombinant vector is transformed into a test cell to express the Cas nuclease.

[0097] In an optional embodiment, the Cas nuclease includes Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9;

[0098] In an optional embodiment, the Cas nuclease is Cas9.

[0099] In a third aspect, a method for constructing an Alport syndrome animal model as described in the first aspect, or use of the kit for constructing an Alport syndrome animal model as described in the second aspect in the preparation of a drug for preventing and / or alleviating Alport syndrome is provided.

[0100] The present invention is further described below by means of specific examples. However, it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0101] Unless otherwise specified, the following examples were analyzed using one-way ANOVA, using Prism software (version 8, GraphPad Sofware). All results were presented in the form of mean scatter plots, and statistical significance was indicated by *p<0.05 and **p<0.01 levels.

[0102] Example 1

[0103] Clinical manifestations of patients with Alport syndrome

[0104] Clinical information of the patient: The patient is a male. When he was 8 years old, he visited a local hospital for cough and facial edema and found abnormal urine test results. He was then transferred to Guangzhou Women and Children's Medical Center for inpatient treatment. Blood test results were normal, except for the total plasma protein value of 50.4g / L [normal range 64-83g / L] and globulin of 13.4 [normal range 20-30g / L]. Urinalysis showed 6.88g [normal range ≤0.4g]. Urine microscopy showed 350 red blood cells / μl. After completing renal tissue biopsy and renal pathology examination ( Figure 1), the patient was highly suspected of Alport syndrome. Combined with the patient's family history of kidney disease, complete eye, ear and gene examinations, the patient was finally diagnosed with Alport syndrome. Family analysis showed that many members of the patient's family suffered from kidney disease, and the results of the second-generation sequencing suggested ( Figure 2 ), the patient's sister and mother both had COL4A5-c.1517-1G>T mutation. Based on the patient's medical history and laboratory test results, Alport syndrome was diagnosed.

[0105] Example 2

[0106] Wild-type plasmid and COL4A5-c.1517-1G>T mutant plasmid were constructed and then transfected into 293T cells.

[0107] The experimental method is as follows: pcDNA3.1 vector was used to construct the minigenes of pcDNA3.1-COL4A5-WT and pcDNA3.1 COL4A5. The NM 000495.4:Exon23:c.1517-1G>T mutation is located on intron 22. Wild-type and mutant target gene fragments were obtained by double enzyme digestion recombination reaction and inserted into the cloning vector. The recombinant products were transformed into competent cells and cultured, and clones were selected for PCR amplification. Sanger sequencing and RT-PCR were performed to determine whether the target fragment of the COL4A5 gene was correctly inserted into the vector. The correct recombinant wild-type minigene plasmid and mutant minigene plasmid were selected. The plasmids were transferred into 293T cells.

[0108] By analyzing the band size of the PCR amplification product and the results of Sanger sequencing, it was found that the mRNA sequence transcribed by the WT plasmid was consistent with expectations, containing complete mRNA products transcribed from exon 22 and exon 23; the 293T cells into which the mutant plasmid was transferred expressed abnormal fragments. The theoretical amplification length of the COL4A5 gene is 474bp, of which Exon23 is 71bp. The COL4A5-c.1517-1G>T mutation causes exon23 to jump, shortening the amplified fragment to 403bp ( Figure 3 ). Sequencing of abnormal mRNA products such as Figure 4 As shown, the above results indicate that the COL4A5-c.1517-1G>T mutation causes abnormal mRNA splicing.

[0109] Example 3

[0110] Model mouse construction:

[0111] Construction of Col4a5 knockout mice, editing the transcript of Col4a5-202 (ENSMUST00000112931.7) Figure 5). Based on the CRISPR / Cas9 system, sgRNA1 and sgRNA2 containing the Col4a5-c.1517-1G>T mutation site were designed as follows:

[0112] sgRNA1: ATGTGTGTCTTAGGATCTCT, SEQ ID NO.1;

[0113] sgRNA2:TTAGGATCTCTTGGAATCCC, SEQ ID NO. 2.

[0114] The constructed donor vector (the nucleotide sequence (positive chain) of the donor sequence is tctagatgcgtgtgattggggtgggggcgcttacggctcagtgctcacctgacctatgtgtgtcttatgatctttgggaatccctggagagaagggggacaaagga, as shown in SEQ ID NO.3), Cas9 and sgRNA were microinjected into the fertilized eggs of C57BL / 6JGpt mice for homologous recombination, and the fertilized eggs were transferred to the oviduct of pseudo-pregnant ICR females. F0 mice were born 19 to 21 days after transplantation. All F0 mice were female mice, and the offspring of mice with Col4a5-c.1517-1G>T gene mutation (F0 mice) were identified by PCR and Sanger sequencing.

[0115] The genotype of the mouse model with Col4a5-c.1517-1G>T gene mutation established by CRISPR / Cas9 technology was identified by PCR and DNA sequencing. Genomic DNA was extracted from the mouse tail. The primers for PCR genotype identification were:

[0116] Col4a5-mut-tF: 5'-AGAACTCATGCCCAACCTCACAG-3' (SEQ ID NO. 4);

[0117] Col4a5-mut-tR: 5'-CTCTCCAGGGATTCCCAAAGATCA-3' (SEQ ID NO. 5).

[0118] Col4a5 knockout mice were constructed according to the above method, and all F0 generation mice were generated using the CRISPR / Cas9 system. Heterozygous females were mated with wild-type male mice, and the target mice were generated from subsequent generations. The genotypes of F1 generation mice were identified by PCR and Sanger sequencing. The results are shown in Figure 6 and Figure 7The above data show that the Col4a5-c.1517-1G>T gene mutation mice have been successfully constructed. In the following text, KI mice are used to represent Col4a5-c.1517-1G>T gene mutation mice.

[0119] Example 4

[0120] Verification of the clinical characteristics of Alport syndrome patients in model mice with Col4a5-c.1517-1G>T gene mutation: All animal experiments were approved by the ethics committee. All mice were allowed to drink water and eat standard food at will, and were placed in an animal room with suitable temperature and humidity. A total of 39 male mice were used in this example. Initially, 40 male mice were used, including 20 wild-type male mice and 20 mutant mice (F3 generation), but one mutant mouse died at 26 weeks of age. Serum biochemical tests were performed on 5 Col4a5-c.1517-1G>T male mice and 5 control male mice.

[0121] 1. Col4a5-c.1517-1G>T mutant mice develop hematuria, proteinuria and renal impairment:

[0122] (1) The characteristics of KI mice were evaluated from the perspective of growth and development. It was found that the growth and development of male KI mice lagged behind that of wild-type mice. Compared with wild-type male mice, the average weight gain of KI mice had slowed down at week 14 ( Figure 8 (A).

[0123] (2) To evaluate the renal function of KI mice, we collected urine to measure hematuria and urine protein / creatinine. The dipstick method detected hematuria in KI mice at 7 weeks of age. The urine protein / creatinine ratio of KI group mice increased significantly at 14 weeks of age, and urine protein continued to increase at 21 weeks of age (Fig. 4B), indicating impaired renal function. However, the urine protein / creatinine ratio of wild-type male mice remained at a low level ( Figure 8 Compared with wild-type male mice, the levels of serum urea nitrogen (BUN) and creatinine (Cre) in KI mice were significantly increased compared with those in control mice at 28 weeks of age ( Figure 8 C and D).

[0124] (3) After euthanizing the mice, the kidneys were removed and the capsules were removed. From the appearance observation, the kidney morphology of KI mice showed signs of sclerosis and atrophy with increasing age. At 7 weeks of age, the kidney surface of the model mice was smooth and the size was very similar to that of wild-type mice. However, at 28 weeks of age, the kidney surface of male mutant mice was observed to be uneven and the appearance showed granular changes. Renal pathological staining showed that at 7 weeks of age, some capillary clusters collapsed in the glomeruli of KI mice, and the overall morphological structure of the tubular interstitium was normal. With the increase of age, the manifestations of renal sclerosis gradually worsened. By 28 weeks of age, a large number of glomeruli had abnormal morphology, including crescent formation of parietal epithelial cells, focal sclerosis, and global sclerosis, and increased renal fibrosis. In the tubular interstitium, it can be seen that some tubular brush borders have atrophied and disappeared ( Figures 9 to 11 ). Previous studies have shown that a decrease in the number of podocytes is an important pathological change in the kidneys of patients with Alport syndrome. HE staining in this study showed ( Fig.12 ), at 21 weeks of age, the number of podocytes in KI mice was significantly lower than that in wild-type mice, and the difference between the two increased further at 28 weeks of age ( Fig.13 ), Fig.13 The average podocyte density per glomerulus was calculated as the number of WT1+ cells / number of glomeruli.

[0125] (4) Electron microscopic histological changes in Col4a5-c.1517-1G>T mutant mice: Transmission electron microscopy and scanning electron microscopy were used to evaluate the renal pathological changes in KI group mice and wild-type mice of the same littermate ( Fig.14 and Fig.15 ). The ultrastructure of the KI group mice at 7 weeks of age showed mild thinning of the glomerular basement membrane and fusion of a few foot processes. The glomerular basement membrane of the wild-type control group mice at 7 weeks of age was uniform in thickness, and the foot processes of adjacent cells crossed each other and adhered closely to the outside of the basement membrane. At 28 weeks of age, the ultrastructure of the KI group mice showed tearing and stratification of the glomerular basement membrane, severe uneven thickness of the glomerular basement membrane, and large-scale fusion and disappearance of foot processes. Scanning electron microscopy showed that the tight occlusal relationship of the foot processes of the podocytes in the glomerular basement membrane of the KI group mice disappeared, and the cell bodies shrank. No obvious pathological changes were observed in the kidneys of the wild-type control group mice by electron microscopy.

[0126] (5) Immune cell infiltration in the tubulointerstitium of Col4a5-c.1517-1G>T mutant mice: Disturbance of the immune microenvironment is another important factor that promotes the deterioration of renal function in Alport syndrome, and the infiltration of immune cells is also an important indicator of the prognosis of patients with Alport syndrome. However, the existing reports of Alport syndrome mice with Col4a5 gene mutations did not mention whether there was a large amount of immune cell infiltration in the mouse renal interstitium. On this basis, the kidneys of 28-week-old KI group mice and wild-type mice were extracted, and the content of immune cell infiltration was detected by immunohistochemistry. The results showed that ( Fig.16 ), there were a large number of CD3-positive T cells and CD68-positive macrophages in the renal tubular interstitium of mutant mice. However, no obvious CD3- and CD68-positive cell infiltration was found in the renal interstitium of control mice.

[0127] Materials and methods

[0128] Methods for detecting urine protein (Alb) and urine creatinine levels, serum creatinine and urea nitrogen: Mice were placed in metabolic cages to collect urine samples for 24 hours. Urine protein (Alb) and urine creatinine levels (U-Cre) were measured using an automatic analyzer (Hitachi 7600-020). Mice were anesthetized under triple mixed anesthesia (medetomidine, midazolam and butorphanol: 0.15, 3.0 and 3.75 mg / kg), then abdominal dissection and blood was collected from the heart. After whole blood was centrifuged, the upper serum was taken and serum creatinine and urea nitrogen were measured using an Automatic Analyzer (Chemray 800, Rayto Co., Ltd., China).

[0129] Electron microscopic examination method: After the kidney samples were processed by standard procedures, they were used for optical microscopy, transmission electron microscopy and scanning electron microscopy. The tissues were fixed with 4% paraformaldehyde, embedded in paraffin and sliced. According to the instructions, hematoxylin and eosin (HE), periodic acid Schiff (PAS), periodic acid-silvermethenamine (PASM) and Masson trichrome (MT) were used to stain the paraffin samples. The tissues of the electron microscopy specimens were fixed with 2.5% glutaraldehyde and observed by electron microscopy scanning at an accelerating voltage of 15kv and 30pa.

[0130] Immunohistochemical method: Kidneys were removed and fixed in 4% paraformaldehyde for 4 hours and then placed in 18% sucrose solution for more than 16 hours. The fixed kidneys were frozen and sectioned. The antibodies we used were WT1 (Rabbit monoclonal, Cambridge, UK, ×300 dilution), CD3, CD68 (antibody catalog number). Type IV collagenα5 (Rabbit polyclonal, Cambridge, UK, ×200 dilution). Immunohistochemical staining was performed according to the manufacturer's instructions.Action.

[0131] The mutation sites of Alport syndrome model mice with Col4a5 gene mutations in the past were all located in the exon region, that is, in the gene coding region. The above example found a mutation in the intron region. The kidneys of the Alport syndrome patients found in the above example showed persistent hematuria and massive proteinuria. Electron microscopy results showed the typical manifestation of uneven thickness of the patient's glomerular basement membrane. Next-generation sequencing and family tracing further confirmed that the child had Alport syndrome. Intron COL4A5-c.1517-1G>T mutation was found in the patient's COL4A5 gene. By consulting the database, we found that other patients with Alport syndrome in the patient's family had mutations at the same site, while other people in the family without clinical symptoms such as hematuria and 200 other healthy controls did not detect mutations at this site. These evidences highly suggest that COL4A5-c.1517-1G>T may cause Alport syndrome. However, there is still a lack of direct evidence as to whether this site can directly lead to the onset of Alport syndrome, and its molecular mechanism is still unclear.

[0132] In order to study whether the intron mutation can cause Alport syndrome, minigene experiments were further used. Example 2 constructed wild-type plasmids and COL4A5-c.1517-1G>T mutant plasmids and transfected them into 293T cells. It was found that the mutant plasmid transcription product exon23 jumped, and the amplified fragment was shorter than that of the control group, further confirming that the c.1517-1G>T mutation can cause splicing variation. On this basis, Example 3 used CRISPR / Cas9 technology to construct Col4a5-c.1517-1G>T male model mice (KI mice) with the same mutation site as the patient. The mice did not show obvious abnormal renal function at birth. At 7 weeks of age, there was no significant statistical difference in the renal function biochemical indicators between the KI group mice and the control group mice. At 14 weeks of age, the renal function indicators of the KI group mice were significantly abnormal and progressively aggravated, and progressed to end-stage renal disease at week 28. Renal pathology showed that at 28 weeks of age, the mouse kidneys showed typical Alport syndrome-like uneven basement membrane thickness changes, accompanied by glomerular mesangial proliferation, focal sclerosis and tubulointerstitial fibrosis and other pathological changes. Compared with the existing X-linked recessive Alport mouse model, the onset time of the mouse model constructed in Example 3 was consistent with the previously reported G5X and R471X XLAS models, but the survival time was longer than the reported model mouse survival period, which may be related to the mutation type being a splice variation.

[0133] Example 4 found that in male model mice with Col4a5-c.1517-1G>T mutation, a large amount of CD68 + Macrophages and CD3 +T cells, especially in the late stages of kidney disease. This phenomenon has not been mentioned in previous studies of the Col4a5 mouse model. More and more studies have shown that abnormally activated immune cells and unbalanced immune regulatory factors are key factors leading to the deterioration of Alport syndrome. In mouse models, studies have shown that mice lacking Col4a3 have macrophage infiltration, and mice with different genetic backgrounds have significant differences in the number and timing of renal inflammatory responses and macrophage infiltration, indicating that genetic background may affect the degree of macrophage infiltration. A large number of macrophage infiltrations were observed in the Col4a5-c.1517-1G>T mutant mouse model constructed in Example 3. In addition, a large number of CD3 + These new findings provide a new perspective and mouse model for studying the mechanism of action of immune cells in Alport syndrome.

[0134] The non-coding sequences in the eukaryotic genome are composed of non-coding regions and introns. Introns are removed during mRNA processing. Therefore, there are no non-coding sequences (introns) in mature mRNA. In addition, introns are meaningless to the structure of the translation product and are often not screened by natural selection. Therefore, they are more likely to be inherited to the next generation than exon mutations. The inventors established an Alport syndrome mouse model with c.1517-1G>T mutation based on the findings in clinical work. Considering that the pathogenic mechanisms of different variants may be different, the c.1517-1G>T mouse model provides a new tool and platform for studying the pathogenesis and therapeutic targets of XLAS. This is also the first reported mouse model of Alport syndrome with X-linked recessive inheritance caused by splicing mutations.

[0135] In summary, the above examples found a splicing variation c.1517-1G>T in the COL4A5 gene of XLAS patients, and confirmed through in vivo and in vitro experiments that it can cause Alport syndrome. This discovery expands the variation spectrum of the COL4A5 gene in the X-linked dominant inheritance model, and helps to increase our understanding of the molecular pathogenesis of Alport syndrome.

[0136] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing an Alport syndrome animal model, characterized in that: The method includes causing the COL4A5 gene of the test animals to undergo a COL4A5-c.1517-1G>T mutation corresponding to the mutation in Alport syndrome patients.

2. The construction method according to claim 1, characterized in that: The test animals include mammals; Optionally, the mammal comprises a monkey, a dog, a cat, a mouse, a rat, a cow, a horse, a camel, an alpaca, a goat or a sheep; Optionally, the test animal comprises a mouse.

3. The construction method according to claim 2, characterized in that: The test animal is a mouse, and the Col4a5-c.1517-1G>T mutation is performed using the ENSMUST00000112931.7 transcript as a reference sequence.

4. The construction method according to claim 1, characterized in that: The Alport syndrome animal model has one or more of the following properties (i) to (vi) compared to the non-mutated test animal: (i) increased urine protein / creatinine ratio; (ii) elevated levels of serum urea nitrogen and creatinine; (iii) abnormal glomerular morphology; (iv) atrophy and / or disappearance of the tubular brush border; (v) Decreased number of podocytes; (vi) Immune cell infiltration occurs in the renal interstitium; Optionally, the abnormal glomerular morphology includes one or more of parietal epithelial cell hyperplasia, crescent formation, focal sclerosis, global sclerosis and increased renal fibrosis; Optionally, the immune cells include CD3 + T cells and / or CD68 + Macrophages.

5. The construction method according to any one of claims 1 to 4, characterized in that: Using a gene editing system to mutate the COL4A5 gene in the test animals; Optionally, gene editing is performed by at least one CRISPR / Cas gene editing system.

6. The construction method according to claim 5, characterized in that: The CRISPR / Cas gene editing system includes one or more of (i) to (iii): (i) an sgRNA targeting a target fragment, or a polynucleotide encoding the sgRNA; (ii) a donor DNA, or a polynucleotide encoding the donor DNA; (iii) Cas nuclease, or a polynucleotide encoding a Cas nuclease; Optionally, the Cas nuclease comprises Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; Optionally, the Cas nuclease is Cas9.

7. The construction method according to claim 6, characterized in that: The test animal is a mouse, the sgRNA includes sgRNA1 with a nucleotide sequence as shown in SEQ ID NO.1 and sgRNA2 with a nucleotide sequence as shown in SEQ ID NO.2, and the nucleotide sequence of the donor DNA is shown in SEQ ID NO.

3.

8. A kit for constructing an Alport syndrome animal model, characterized in that: The animal model is a mouse, and the kit includes one or more of (i) to (iii): (i) an sgRNA targeting a target fragment, or a polynucleotide encoding the sgRNA; the sgRNA comprises an sgRNA1 having a nucleotide sequence as shown in SEQ ID NO.1 and an sgRNA2 having a nucleotide sequence as shown in SEQ ID NO.2; (ii) donor DNA, or a polynucleotide encoding the donor DNA; the nucleotide sequence of the donor DNA is shown in SEQ ID NO.3; (iii) Cas nuclease, or a polynucleotide encoding a Cas nuclease.

9. The kit according to claim 8, characterized in that The Cas nuclease includes Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; Optionally, the Cas nuclease is Cas9.

10. Use of the method for constructing an Alport syndrome animal model according to any one of claims 1 to 7, or the kit for constructing an Alport syndrome animal model according to claim 8 or 9 in the preparation of a drug for preventing and / or alleviating Alport syndrome.

Images