DNMT3A gene mutation detection kit and detection method

Abstract

The invention discloses a DNMT3A gene mutation detection kit and a detection method, and belongs to the field of gene detection. The kit comprises an ERA primer aiming at the R882 site of the DNMT3A gene, crRNA targeting R882H / C mutation, a Cas12a protein and a single-stranded DNA fluorescent reporter molecule, and can further comprise an AciI restriction enzyme, an ERA reagent and a DNMT3A gene R882 site mutation positive standard substance, wherein the sequences of the ERA primer, the crRNA, the Cas12a protein and the single-stranded DNA fluorescent reporter molecule are shown as SEQ ID NO.5 and SEQ ID NO10. Through efficient amplification of the ERA and cutting of the AciI incision enzyme, isothermal amplification and restriction enzyme digestion of the ERA are synchronized, a large number of R882 mutation enriched amplification products are generated, the sensing performance of the amplification products is further improved through CRISPR / Cas12a, and therefore the method has the advantages of being good in accuracy, high in sensitivity, high in selectivity, high in anti-interference capacity, good in repeatability and the like.

Description

Technical Field

[0001] The present invention belongs to the field of gene detection, and specifically relates to a DNMT3A hotspot gene mutation R882H / C mutation detection kit and a detection method based on CRISPR / Cas12a. Background Art

[0002] DNA methyltransferase 3alpha (DNMT3A) is one of the important genes regulating DNA methylation. It is about 79kb long and located on chromosome 2. It is one of the members of DNA methyltransferase genes. The DNA methyltransferase it encodes can catalyze the methylation of CpG dinucleotide cytosine residues. CpG dinucleotide clusters (islands) are concentrated in the upstream region of the gene, and their increased methylation levels are usually associated with decreased expression of downstream genes. DNMT3A gene mutation is one of the earliest genetic events in the development of hematological malignancies and can lead to abnormal methylation patterns. Studies have shown that about 25% of newly diagnosed acute myeloid leukemia (AML) patients have DNMT3A gene mutations, of which the most common is the mutation of the arginine (R) codon at position 882 (about 60%). The mutations at R882 site were divided into different types, with the most frequent ones being R882H (c.2645G>A, accounting for 62-65%) and R882C (c.2644C>T, accounting for 24-36%).

[0003] DNMT3A is the most commonly mutated gene in clonal hematopoiesis. Individuals with clonal hematopoiesis have an approximately 10-fold higher risk of developing blood cancers than those without clonal hematopoiesis. Therefore, DNMT3A mutations are also considered to be preleukemic lesions. In patients with normal cytogenetics and those with intermediate risk, the presence of DNMT3A mutations is associated with poor survival. The Cox proportional hazard model showed that DNMT3A mutations were a variable independently associated with overall survival. Other studies have shown that intensive treatment with DNA-damaging anthracyclines can lead to better outcomes for AML patients carrying DNMT3A mutations. In addition, AML cells with DNMT3A mutations are sensitive to specific DOT1L drug inhibitors. Therefore, the detection of DNMT3A gene mutation status is of great significance for the monitoring, diagnosis, prognosis and selection of targeted drugs for hematological malignancies.

[0004] At present, the main clinically used DNMT3A gene mutation detection methods include blocking reagent allele-specific PCR (ASB-PCR), high-resolution melting (HRM) analysis, BNA (NC) probe modified new magnetic bead suspension assay, peptide nucleic acid (PNA) real-time PCR technology, TauI digestion followed by capillary electrophoresis / endonuclease restriction method and high-throughput sequencing (next-generation sequencing, NGS), etc. However, the above methods have problems such as complex operation, expensive equipment and professional training for personnel. Therefore, a DNMT3A hotspot gene mutation detection method with simple operation, low cost, high sensitivity and strong specificity is still needed in the clinic, which will be of great significance for the early detection, medication guidance and prognosis monitoring of related tumors.

[0005] Nucleic acid detection technology based on CRISPR / Cas12a is an emerging molecular diagnostic method. The principle is that Cas12a protein can specifically bind to and cut the target DNA under the guidance of crRNA, while activating its side cutting activity and non-specifically cutting the surrounding single-stranded DNA. When the fluorescent group and quenching group are artificially modified at both ends of the single-stranded DNA (ssDNA), the non-specific cutting reaction will release a fluorescent signal, indicating that the target DNA is positive. This technology can be combined with isothermal amplification technologies such as RPA and LAMP to develop a rapid, sensitive, simple and economical nucleic acid detection method. At present, this technology has been widely used in a variety of pathogens and tumor detection research. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a DNMT3A gene R882H / C mutation detection kit and detection method based on CRISPR / Cas12a. The present invention has low requirements for instruments and equipment, is easy to operate, has strong versatility and high accuracy, and can quickly realize specific detection of DNMT3A gene R882H / C mutation.

[0007] The present invention provides a DNMT3A gene R882H / C mutation detection kit based on CRISPR / Cas12a, the detection kit comprising: Enzymatic Recombinase Amplification (ERA) primers for the R882 site of the DNMT3A gene, crRNA targeting the R882H / C mutation, Cas12a protein and single-stranded DNA fluorescent reporter molecules; it may also include an AciI restriction enzyme that specifically cuts wild-type (WT) nucleic acids; further, it may also include an ERA reagent. Wherein, the ERA primer sequence is:

[0008] Forward primer ERA-F5: CAGAACTAAGCAGGCGTCAGAGGAGTTGGTG (SEQ ID NO. 5),

[0009] Reverse primer ERA-R5: TCAGCCGAGCGAAGAGGTGGCCGATGACTGG (SEQ ID NO. 10).

[0010] The ERA primers ERA-F5 and ERA-R5 are selected from 5 forward primers ERA-F1 to 5 (sequences shown in SEQ ID NOs. 1 to 5) and 5 reverse primers ERA-R1 to 5 (sequences shown in SEQ ID NOs. 6 to 10), and are efficient and specific sequences selected according to the ERA primer design principle. Two base mismatches are introduced into the ERA-R5 sequence to eliminate the AciI restriction enzyme cutting site (CCGC) outside the R882 site.

[0011] The sequence of the crRNA targeting the R882H / C mutation is preferably UAAUUUCUACUAAGUGUAGAUAACAUGAGCUACUUGGCGAGG (SEQ ID NO.11), which contains both R882H and R882C mutant bases, and can be obtained by constructing an in vitro transcription vector and performing in vitro transcription and purification, or directly synthesized.

[0012] The Cas12a protein is preferably an AsCas12a variant protein containing six amino acid variations, and its amino acid sequence is shown in SEQ ID NO.12, and the protein has high activity and a wide PAM recognition range (NNCV and TTTV preference). The Cas12a protein can be obtained by Escherichia coli transformation, induced expression and protein purification.

[0013] The single-stranded DNA fluorescent reporter molecule is a single-stranded DNA (ssDNA) modified with fluorescent groups and quenching groups at both ends, preferably a FAM-ssDNA-BHQ1 fluorescent reporter molecule, and its sequence is preferably 5'-FAM-TTATT-BHQ1-3', which is directly synthesized by the company.

[0014] The DNMT3A gene R882H / C mutation detection kit based on CRISPR / Cas12a may also include a positive standard for mutations at the R882 site of the DNMT3A gene. Further, the positive standard is a 100% mutation rate genomic standard for the R882H mutation of the DNMT3A gene. The genomic standard is extracted from a 293T cell line carrying a homozygous mutation of DNMT3A-R882H, and is reproducible. The 293T cell line with homozygous mutations of DNMT3A-R882H is constructed and screened using CRISPR lead gene editing technology, and its construction method preferably includes the following steps: First, according to the principle of CRISPR lead editing (PE2) technology, a plasmid expressing pegRNA and pairRNA for targeted editing of the R882H mutation is designed and constructed, and transformed, amplified, and purified and extracted in Escherichia coli together with the PE2 editor plasmid. Then, the three are transfected into 293T cells in the logarithmic growth phase at a ratio of 3:1:9. Three days after transfection, green fluorescent labeling and flow cytometry were used to perform monoclonal sorting and culture in 96-well plates. After two weeks of sorting and culture, cell clones were selected for Sanger sequencing, and cell lines carrying the homozygous DNMT3A-R882H mutation were transferred and expanded to obtain a 293T cell line with the homozygous DNMT3A-R882H mutation.

[0015] The present invention also provides a DNMT3A gene R882H / C mutation detection method based on CRISPR / Cas12a, which comprises the following steps: the above-mentioned ERA primers are used to perform ERA isothermal amplification on the nucleic acid sample to be tested, wherein AciI endonuclease is added to simultaneously digest and inhibit WT nucleic acid, and the ERA amplification product enriched with R882 mutation is obtained; the above-mentioned R882H / C-crRNA, Cas12a protein and single-stranded DNA fluorescent reporter molecules are directly added to the ERA amplification product for fluorescent reaction, and the test result is observed by a fluorescence detection instrument (such as a blue light gel cutting instrument, a constant temperature fluorescence detector or an enzyme marker, etc.). Adding restriction endonuclease AciI to cut the WT gene in ERA isothermal amplification can effectively prevent its amplification, and the base realizes the enrichment of mutant genes and improves the detection sensitivity.

[0016] The ERA isothermal amplification reaction system preferably comprises: 10 μL of ERA reaction buffer, 5 μL of ERA enzyme solution, 1.25 μL of R882-F primer (10 μM), 1.25 μL of R882-R primer (10 μM), 1 μL of ERA activator, 1 μL of nucleic acid to be tested, 1 μL of AciI endonuclease (1U), and enzyme-free water to 25 μL. ERA-related reagents were purchased from Suzhou Xianda Gene Co., Ltd.

[0017] The nucleic acid sample to be tested may be a nucleic acid extracted from a clinical sample, or a sample processed by a sample processing method in other nucleic acid detection means.

[0018] The reaction conditions of the ERA isothermal amplification are preferably 37° C. and 15 minutes.

[0019] The fluorescent reaction system is preferably 28 μL, which is directly adding 1 μL of R882H / C-crRNA (1 pmol), 1 μL of Cas12a protein (200 ng), and 1 μL of FAM-ssDNA-BHQ1 fluorescent reporter molecule (25 pmol) to the above 25 μL of ERA amplification product.

[0020] The reaction conditions of the fluorescence reaction are preferably 37° C. and 15 minutes.

[0021] The fluorescence detection instrument can be any fluorescence detection device that can perform fluorescence excitation and detection on the FAM fluorescence channel, or can be used for naked eye visualization observation through a blue light irradiation instrument.

[0022] The mechanism of the present invention is as follows: The present invention uses a type V CRISPR system, in which the effector protein is mainly the Cas12 family, and this type of nuclease generally has non-specific ssDNA cleavage activity. When the Cas12 effector protein targets the target DNA sequence under the guidance of the characteristic crRNA, its cis-reaction activity and trans-cleavage activity are activated. By adding an ssDNA fluorescent reporter probe, when the target DNA sequence is present in the sample, the Cas12 trans-cleavage activity is activated, and the probe is cut off to release fluorescence, thereby realizing the detection of the target gene sequence.

[0023] The present invention has the following advantages and beneficial effects:

[0024] (1) Compared with other existing detection technologies, the method of the present invention only requires a constant temperature device and a simple fluorescence reading device or direct observation with the naked eye, is simple to operate, and has a fast detection speed (about 30 minutes, which is the shortest time among the existing known DNMT3A mutation detection methods). It shows good performance in the detection of DNMT3A hotspot gene mutations and can accurately detect low-abundance DNMT3A hotspot gene mutation sites, and has good application prospects.

[0025] (2) In the method of the present invention, the ERA isothermal amplification is synchronized with the restriction enzyme cutting through the efficient amplification ability of ERA and the cutting of AciI endonuclease, producing a large number of amplified products enriched with R882 mutations. The above-mentioned amplified products can be specifically recognized by Cas12a, and the high specificity and self-amplification ability of CRISPR / Cas12a further improve the sensing performance, so that the detection method has the advantages of good accuracy, high sensitivity, strong selectivity, strong anti-interference ability, and good repeatability.

[0026] (3) The R882H / C-crRNA used in the present invention carries two variant bases targeting R882H and R882C. On the one hand, two mutations can be detected simultaneously with one crRNA, and the mutation coverage rate is high; on the other hand, the two variant bases can further reduce the wild-type crossover signal, killing two birds with one stone.

[0027] (4) The present invention also established a 293T cell line carrying a homozygous mutation of DNMT3A-R882H, which can provide a genome positive standard with a 100% mutation rate that can be sustainably produced for the detection kit. Compared with the plasmid standard in the common mutation detection kit, since the human genome is much more complex than the plasmid sequence, the genome standard of the present invention can more accurately reflect the performance of the kit in detecting human genome samples and is more suitable for clinical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the crRNA test result of the DNMT3A hotspot gene mutation R882H / C.

[0029] Figure 2 These are the results of ERA primer screening for the DNMT3A hotspot gene mutation R882H / C.

[0030] Figure 3 This is the Sanger sequencing identification result of the R882H homozygous mutation 293T cell line.

[0031] Figure 4 These are the results of the identification of the sensitivity and specificity of the DNMT3A hotspot gene mutation R882H.

[0032] Figure 5 The clinical test results of the detection method of the present invention are shown in the figure. In the figure, ①, ② and P1, P2 are DNMT3A-R882H mutation samples, ③, ④ and P3, P4 are DNMT3A-R882C mutation samples, and ⑤, ⑥ and P5, P6 are DNMT3A-R882 wild-type samples. DETAILED DESCRIPTION

[0033] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0034] The experimental methods in the following examples without specific experimental conditions are usually carried out according to conventional experimental conditions or the experimental conditions recommended by the manufacturer. The materials and reagents used are conventional products purchased through commercial channels unless otherwise specified.

[0035] Example 1 Establishment of a DNMT3A gene R882H / C mutation detection method based on CRISPR / Cas12a

[0036] This embodiment provides a method for detecting the R882H / C mutation of the DNMT3A gene based on CRISPR / Cas12a.

[0037] 1. Sequence design and crRNA testing

[0038] The reference sequence of the R882H mutation in codon 822 is as follows, where the underlined bases are the R882H mutation sites of the DNMT3A gene: 5'-CCAGTCCACTATACTGACGTCTCCAACATGAGCC A CTTGGCGAGGCAGAGAC TGCTGGGCCGGTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAG TATTTTGCGTGTGTGTAA-3' (SEQ ID NO. 13).

[0039] The reference sequence of the R882C mutation in codon 822 is as follows, where the underlined bases are the R882C mutation site of the DNMT3A gene: 5'-CCAGTCCACTATACTGACGTCTCCAACATGAGC T GCTTGGCGAGGCAGAGAC TGCTGGGCCGGTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAG TATTTTGCGTGTGTGTAA-3' (SEQ ID NO. 14).

[0040] The wild-type (WT) reference sequence corresponding to the R882H mutation in codon 882 is as follows: 5′-CCAGTCCACTATACTG ACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCTGGGCCGGTCATGGAGCGT GCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAGTATTTTGCGTGTGTGTAA-3′ (SEQ ID NO. 15).

[0041] According to the PAM properties of the Cas12a variant protein (amino acid sequence as shown in SEQ ID NO.12) used in the present invention, R882H / C-crRNA is designed for the R882H / C mutation on codon 882 of exon 26 of the DNMT3A gene, and the sequence is shown in SEQ ID NO.11. The R882H / C-crRNA sequence carries mismatched bases of R882H and R882C at the same time to effectively achieve the comprehensiveness of R882 site mutation detection.

[0042] Furthermore, the crRNA test method uses 1E11 copies of R882H, R882C, and WT DNA fragments (sequences are shown in SEQ ID NO.13, 14, and 15, respectively) as the detection substrate, and directly combines the Cas12a variant protein with the crRNA for a 10-min fluorescence reaction at 37°C. The detection system is 20 μL, containing: 200 ng of Cas12a variant protein, 1 pmol of crRNA, 25 pmol of FAM-ssDNA-BHQ1 (5'-FAM-TTATT-BHQ1-3') fluorescent reporter molecule, 2 μL of 10×NEBuffer3.1, DNA fragment to be tested (1 μL 1E11 copies) and enzyme-free water. The fluorescence is read using a fluorescence thermostatic amplification instrument. The results are as follows Figure 1 As shown, the results show that R882H / C-crRNA1 has high signals for detecting both R882H and R882C mutations, so it is suitable for detecting both R882H and R882C mutations simultaneously. Although there is a weak WT cross signal, it can be subsequently suppressed by introducing the AciI restriction endonuclease in the isothermal amplification system.

[0043] 2. ERA Primer Screening

[0044] Design, synthesize and screen ERA forward and reverse primers for amplifying the R882 site. Note that when the primer contains an additional AciI restriction site other than the 882 site, mismatched bases need to be introduced to eliminate the additional restriction site.

[0045] Specifically, the ERA forward primers designed and synthesized for amplifying the R882 site are ERA-F1-5 (sequences are shown in SEQ ID NOs. 1-5), and the reverse primers are ERA-R1-5 (sequences are shown in SEQ ID NOs. 6-10), as shown in Table 1 below.

[0046] Table 1. Primer sequences for ERA amplification of the DNMT3A gene mutation region

[0047]

[0048] The primer screening method is as follows: 17 pairs of primers are obtained by combining the forward and reverse primers in different ways, and 100 ng of R882H homozygous mutant genome is used as a template for ERA isothermal amplification at 37°C for 15 min. The ERA isothermal amplification reaction system includes: 10 μL of ERA reaction buffer, 5 μL of ERA enzyme solution, 1.25 μL of R882-F primer (10 μM), 1.25 μL of R882-R primer (10 μM), 1 μL of ERA activator, 1 μL of nucleic acid to be tested, 1 μL of AciI endonuclease (1U), and enzyme-free water is added to 25 μL. After amplification, 1 μL of R882H / C-crRNA (1 pmol), 1 μL of Cas12a protein (200 ng), and 1 μL of FAM-ssDNA-BHQ1 fluorescent reporter (25 pmol) were directly added to carry out fluorescence reaction at 37°C for 15 min. The screening results are as follows Figure 2 As shown, the results show that the amplification effects of the primer combinations of F2R2, F3R2, F4R2, and F5R5 are all good, among which the F5R5 primer pair is the best, and therefore is most suitable for the detection method and detection kit of the present invention.

[0049] The R882H homozygous mutant genome was extracted from the DNMT3A-R882H homozygous mutant 293T cell line constructed by the present invention, and the genome Sanger sequencing verification result was as follows: Figure 3 As shown. The 293T cell line with homozygous mutation of DNMT3A-R882H was constructed using CRISPR pilot gene editing technology, and its construction method is as follows: First, according to the principle of CRISPR pilot editing (PE2) technology, the plasmids expressing pegRNA and pairRNA for targeted editing of R882H mutation were designed and constructed, and transformed, amplified and purified and extracted in Escherichia coli together with the PE2 editor plasmid. Then, the three were transfected into 293T cells in the logarithmic growth phase at a ratio of 3:1:9. Three days after transfection, 96-well plate monoclonal sorting and culture were performed using green fluorescent labels and flow sorters. After two weeks of sorting and culture, cell clones were picked for Sanger sequencing, and cell lines carrying homozygous mutations of DNMT3A-R882H were transferred and expanded to finally obtain 293T cell lines with homozygous mutations of DNMT3A-R882H.

[0050] Example 2 Specificity and sensitivity identification of the DNMT3A gene R882H / C mutation detection method based on CRISPR / Cas12a

[0051] In order to test the specificity and sensitivity of the detection method of the present invention, the R882H homozygous mutant genome was mixed with the WT genome in different proportions to obtain DNA templates with mutation rates of 100%, 50%, 10%, 1%, 0.1%, 0.01% and 0% (ie WT) in sequence. The ERA isothermal amplification system containing 1U AciI restriction enzyme was used to perform an amplification reaction at 37°C for 15 minutes. After amplification, Cas12a variant protein, R882H / C-crRNA and FAM-ssDNA-BHQ1 fluorescent reporter molecules were directly added thereto for a fluorescent reaction at 37°C for 15 minutes. The reaction system composition was the same as in Example 1. The results are shown in Figure 4 As shown, the results show that the detection method of the present invention can effectively detect DNMT3A-R882H mutations with a mutation rate as low as 0.1%, and there is no obvious cross signal between WT, which proves the high sensitivity and high specificity of the detection method of the present invention.

[0052] The reaction product can be detected by a fluorescence detection device, using an excitation light with a wavelength of 485 nm to excite fluorescence, and detecting the fluorescence intensity at a wavelength of 535 nm to obtain the detection result; or the result can be directly visually observed and determined by the naked eye through blue light irradiation.

[0053] Example 3 CRISPR / Cas12a-based DNMT3A gene R882H / C mutation detection method for clinical sample detection

[0054] In order to evaluate the performance of the detection method of the present invention in detecting clinical specimens, in this example, two DNMT3A-R882H, two DNMT3A-R882C mutation samples and two DNMT3A-R882 wild-type samples were collected and detected using the CRISPR / Cas12a fluorescence detection system, and the reaction system and conditions were the same as in Example 1.

[0055] The results are as follows Figure 5 As shown, the detection method of the present invention can effectively distinguish DNMT3A-R882H / R882C mutant samples from their corresponding wild-type samples, indicating that the present invention can be effectively used for clinical sample detection, and the detection time is greatly shortened, and the detection can be completed within 30 minutes.

[0056] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A DNMT3A gene R882H / C mutation detection kit based on CRISPR / Cas12a, characterized in that: The detection kit comprises: an ERA primer targeting the R882 site of the DNMT3A gene, a crRNA targeting the R882H / C mutation, a Cas12a protein, and a single-stranded DNA fluorescent reporter molecule; Wherein, the sequence of the ERA primer is: Forward primer ERA-F5: CAGAACTAAGCAGGCGTCAGAGGAGTTGGTG, Reverse primer ERA-R5: TCAGCCGAGCGAAGAGGTGGCCGATGACTGG.

2. The detection kit according to claim 1, characterized in that: Also included is the restriction endonuclease AciI.

3. The detection kit according to claim 1, characterized in that: The sequence of the crRNA targeting the R882H / C mutation is UAAUUUCUAAGUGUAGAUAACAUGAGCUACUUGGCGAGG.

4. The detection kit according to claim 1, characterized in that: The Cas12a protein is an AsCas12a variant protein having an amino acid sequence as shown in SEQ ID NO.

12.

5. The detection kit according to claim 1, characterized in that: The single-stranded DNA fluorescent reporter molecule is 5'-FAM-TTATT-BHQ1-3'.

6. The detection kit according to claim 1, characterized in that: It also contains a positive standard for the R882 mutation of the DNMT3A gene.

7. The detection kit according to claim 1, characterized in that: The DNMT3A gene R882 site mutation positive standard is a genome extracted from a cell line carrying a DNMT3A-R882H homozygous mutation.

8. A method for detecting R882H / C mutation of DNMT3A gene based on CRISPR / Cas12a, characterized in that: The following steps are involved: ERA primers were used to perform ERA isothermal amplification on the nucleic acid sample to be tested, and an ERA amplification product enriched in the R882 mutation was obtained; crRNA, Cas12a protein and single-stranded DNA fluorescent reporter molecules targeting the R882H / C mutation were directly added to the ERA amplification product for fluorescence reaction, and the detection results were observed by a fluorescence detection instrument; Among them, the sequence of the ERA primer is: Forward primer ERA-F5: CAGAACTAAGCAGGCGTCAGAGGAGTTGGTG, Reverse primer ERA-R5: TCAGCCGAGCGAAGAGGTGGCCGATGACTGG; The sequence of crRNA targeting R882H / C mutation is: UAAUUUCUACUAAGUGUAGAUAACAUGAGCUACUUGGCGAGG; The amino acid sequence of Cas12a protein is shown in SEQ ID NO.

12.

9. The detection method according to claim 8, characterized in that: The restriction endonuclease AciI was added to the ERA isothermal amplification.

10. The detection method according to claim 8, characterized in that: The ERA isothermal amplification system comprises: 10 μL of ERA reaction buffer, 5 μL of ERA enzyme solution, 1.25 μL of forward primer, 1.25 μL of reverse primer, 1 μL of ERA activator, 1 μL of nucleic acid to be tested, 1 μL of AciI endonuclease, and enzyme-free water added to 25 μL; The fluorescent reaction system is to add 1 μL of crRNA, 1 μL of Cas12a protein, and 1 μL of single-stranded DNA fluorescent reporter molecules to the ERA amplification product.

Images