Molecular markers related to cashmere thickness of Arbas cashmere and their application

Abstract

The present invention is applicable to the field of biotechnology, and provides a molecular marker related to cashmere thickness of Arbas cashmere goats and its application, wherein the molecular marker comprises at least one or several combinations of 24 SNP sites located on chromosome 8. By using the above SNP sites, molecular marker-assisted breeding is used to retain individuals with favorable genotypes and eliminate individuals with unfavorable genotypes, and the cashmere thickness trait of the population can be significantly improved, thereby achieving the purpose of improving the cashmere production quality of Arbas cashmere goats.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a molecular marker related to the cashmere thickness of an Albas cashmere goat and an application thereof. Background Art

[0002] Inner Mongolia Cashmere Goat is a world-recognized high-quality cashmere goat breed with strong physique, excellent wool quality, high cashmere production and excellent wool quality. The wool of Inner Mongolia Cashmere Goat is known as "soft gold" and enjoys a high reputation in the international market. However, with the current transformation and upgrading of animal husbandry and the increase in people's consumption demand, the cashmere production capacity of Inner Mongolia Cashmere Goat can no longer meet the current demand. Therefore, improving the production performance and quality of cashmere has become one of the urgent problems to be solved, and the genetic improvement of cashmere production performance has become the focus of breeding work.

[0003] Inner Mongolia Cashmere Goats are an excellent local livestock breed that has been bred through long-term natural selection and artificial system selection. The cashmere produced by Inner Mongolia Cashmere Goats has the advantages of being fine, soft, and shiny, and is deeply loved by consumers at home and abroad. The thickness of cashmere is an important factor in determining its quality and economic value. For a long time, researchers have selected high-quality breeding sheep through traditional phenotyping methods. Although certain results have been achieved, there are limitations in improvement efficiency and accuracy. With the development of molecular biology technology, more and more research teams have gradually applied molecular marker-assisted selection (MAS) and whole genome selection (GS) technologies to the breeding practice of cashmere goats. Through GWAS technology, researchers have detected multiple SNP sites on different chromosomes that are significantly associated with cashmere traits. The discovery of these SNP sites provides important clues for further research on the breeding of cashmere thickness.

[0004] By using molecular marker-assisted selection technology, the breeding efficiency of Inner Mongolia cashmere goats can be effectively improved, the thickness of cashmere can be improved, and the market demand for high-quality cashmere can be met. Combined with GWAS technology, it is expected to identify key mutation sites related to the thickness of cashmere goats, thereby effectively improving the efficiency of breeding work. Summary of the invention

[0005] The purpose of the embodiment of the present invention is to provide a molecular marker related to the cashmere thickness of the Albas cashmere goat, aiming to solve the problems raised in the background technology.

[0006] The embodiment of the present invention is implemented as follows: a molecular marker associated with the cashmere thickness of the Albas cashmere goat includes at least one or a combination of the following SNP sites:

[0007] The SNP sites at positions 105745247 and 106016886 on chromosome 8 have polymorphisms of A and C;

[0008] The SNP sites at positions 105620034, 105857933, and 105861346 on chromosome 8 have polymorphisms of A and G;

[0009] The SNP site at position 105859251 on chromosome 8 has polymorphisms of C and A;

[0010] The SNP sites at positions 105858193, 105859025, 105860379, 105860806, 105861058, 106015976, 106016899 and 106021007 on chromosome 8 have polymorphisms of C and T;

[0011] The SNP sites at positions 105861224, 105861291, 105861588, 106016464, 106016735, 106016768 and 106016875 on chromosome 8 have polymorphisms of G and A;

[0012] The SNP site at position 105860067 on chromosome 8 has polymorphisms of C and A;

[0013] The SNP site at position 105859458 on chromosome 8 has polymorphisms of G and T;

[0014] The SNP site at position 105620069 on chromosome 8 has polymorphisms of T and C.

[0015] Another object of the embodiment of the present invention is to provide an application of the above-mentioned molecular marker in breeding cashmere goats based on cashmere thickness traits.

[0016] Preferably, the dominant genotype of the SNP sites at positions 105745247 and 106016886 on chromosome 8 is AA.

[0017] Preferably, the dominant genotype of the SNP sites at positions 105620034, 105857933 and 105861346 on chromosome 8 is AA.

[0018] Preferably, the dominant genotype of the SNP site at position 105859251 on chromosome 8 is CC.

[0019] Preferably, the dominant genotype of the SNP sites at positions 105858193, 105859025, 105860379, 105860806, 105861058, 106015976, 106016899 and 106021007 on chromosome 8 is CC.

[0020] Preferably, the dominant genotype of the SNP sites at positions 105861224, 105861291, 105861588, 106016464, 106016735, 106016768 and 106016875 on chromosome 8 is GG.

[0021] Preferably, at the SNP site at position 105860067 on chromosome 8, the polymorphisms of the site are C and A, and the dominant genotype is GG.

[0022] Preferably, the dominant genotype of the SNP site at position 105859458 on chromosome 8 is GG.

[0023] Preferably, the dominant genotype of the SNP site at position 105620069 on chromosome 8 is TT.

[0024] A molecular marker related to the cashmere thickness of the Arbas cashmere goat provided in an embodiment of the present invention screens 24 SNP sites based on genome-wide association analysis. By detecting the SNP sites, the cashmere thickness of the cashmere goat can be predicted quickly, at low cost and effectively, which is of great significance in improving the quality of cashmere goat wool. By using the above-mentioned SNP sites, through molecular marker-assisted breeding, individuals with favorable genotypes are retained, and individuals with unfavorable genotypes are eliminated, the cashmere thickness trait of the group can be significantly improved, thereby achieving the purpose of improving the cashmere production quality of the Arbas cashmere goat. The molecular marker provided by the present invention can be applied to molecular marker-assisted breeding of Arbas cashmere goats, thereby accelerating the breeding process of Arbas cashmere goats. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 A flowchart of the screening of molecular markers provided in an embodiment of the present invention;

[0026] Figure 2 is the SNP distribution map;

[0027] Figure 3 is the SNP density map;

[0028] Figure 4 This is the distribution map of the velvet thickness phenotype;

[0029] Figure 5Manhattan plot of the genome-wide association analysis results of cashmere thickness in the Arbas cashmere goat;

[0030] Figure 6 This is the QQ plot of genome-wide association analysis of SNPs related to cashmere thickness traits of Arbas cashmere;

[0031] Figure 7 This is the GO functional annotation diagram of candidate genes related to the significant SNPs of cashmere thickness in the Arbas cashmere type;

[0032] Figure 8 This is the KEGG functional annotation diagram of candidate genes associated with significant SNPs of cashmere thickness in the Albas cashmere goat. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0034] In an embodiment of the present invention, 24 molecular marker combinations related to the cashmere thickness trait of cashmere goats are provided, specifically including at least one or several combinations of the following 24 SNP sites, and the SNP sites correspond to sites on chromosomes of the reference sequence of the goat reference genome Caprahircus (Genome assembly ARS1.2):

[0035] The SNP sites at positions 105745247 (chr8:105745247) and 106016886 (chr8:106016886) on chromosome 8 have polymorphisms of A and C;

[0036] The SNP sites located on chromosome 8 are 105620034 (chr8:105620034), 105857933 (chr8:105857933), and 105861346 (chr8:105861346), and the polymorphisms of the sites are A and G;

[0037] The SNP site at position 105859251 (chr8:105859251) on chromosome 8 has polymorphisms of C and A;

[0038] The SNP sites located on chromosome 8 are 105858193 (chr8:105858193), 105859025 (chr8:105859025), 105860379 (chr8:105860379), 105860806 (chr8:105860806), 105861058 (chr8:105861058), 106015976 (chr8:106015976), 106016899 (chr8:106016899) ​​and 106021007 (chr8:106021007), and the polymorphisms of the sites are C and T;

[0039] The SNP sites located on chromosome 8 are 105861224 (chr8:105861224), 105861291 (chr8:105861291), 105861588 (chr8:105861588), 106016464 (chr8:106016464), 106016735 (chr8:106016735), 106016768 (chr8:106016768), and 106016875 (chr8:106016875), and the polymorphisms of the sites are G and A;

[0040] The SNP site at position 105860067 (chr8:105860067) on chromosome 8 has polymorphisms of C and A;

[0041] The SNP site at position 105859458 (chr8:105859458) on chromosome 8 has polymorphisms of G and T;

[0042] The SNP site is located at position 105620069 (chr8:105620069) on chromosome 8, and the polymorphism of the site is T and C.

[0043] At the above-mentioned SNP sites, using the polymorphism of molecular markers, different genotypes have different effects on the cashmere thickness trait. In view of this, the embodiment of the present invention provides a method for molecular marker-assisted cashmere breeding of cashmere goats: using the polymorphism of chr8:105620034, chr8:105861346 and chr8:105857933 molecular markers, the effects of different genotypes on cashmere thickness are AA>GA>GG, so the cashmere goat individuals with A / A genotype are retained; using the polymorphism of chr8:105620069 molecular markers, the effects of different genotypes on cashmere thickness are TT>CT>CC, so the cashmere goat individuals with T / T genotype are retained; using the polymorphism of chr8:105745247 and chr8:106016886 molecular markers, the effects of different genotypes on cashmere thickness are AA>CA>CC , so the cashmere goat individuals with A / A genotype were retained; using the polymorphism of chr8:105858193, chr8:105859025, chr8:105860379, chr8:105860806, chr8:105861058, chr8:106015976, chr8:106016899 and chr8:106021007 molecular markers, the effect of different genotypes on cashmere thickness was CC>TC>TT, so the cashmere goat individuals with C / C genotype were retained; using the polymorphism of chr8:105859251 molecular markers, the effect of different genotypes on cashmere thickness was CC>AC>AA, so the cashmere goat individuals with C / C genotype were retained; using the polymorphism of chr8:105859458 molecular markers, the effect of different genotypes on cashmere thickness was GG>TG>TT , so the cashmere goat individuals with G / G genotype were retained; using the polymorphism of chr8:105860067 molecular marker, the effect of different genotypes on cashmere thickness was GG>CG>CC, so the cashmere goat individuals with G / G genotype were retained; using the polymorphism of chr8:105861224, chr8:105861291, chr8:105861588, chr8:106016464, chr8:106016735, chr8:106016768 and chr8:106016875 molecular markers, the effect of different genotypes on cashmere thickness was GG>AG>AA, so the cashmere goat individuals with G / G genotype were retained.

[0044] Example 1: Figure 1 As shown, this embodiment provides a method for screening candidate markers related to the cashmere thickness trait of Albas cashmere based on genome-wide association analysis, which specifically includes the following process:

[0045] I. Materials and Methods: 1.1 Experimental Animals and Sample Collection: 1500 Arbas cashmere goats in this example were from a sheep farm in Ordos, Inner Mongolia. Blood samples were collected from the group and cashmere thickness data were recorded.

[0046] 1.2 Whole genome resequencing: Genomic DNA was extracted by magnetic bead method according to the conventional extraction steps. The extracted DNA was tested for integrity and purity. DNA that met the requirements was retained, and DNA that did not meet the requirements was re-extracted. Samples that still did not meet the requirements after re-extraction were discarded. The experiment was performed according to the standard protocol provided by BGI. For genomic DNA samples that passed the test, fragments of appropriate size were selected by gel electrophoresis, and then the library was constructed by PCR enrichment. After the library was constructed, Qubit was used for quantitative quality control. The qualified library was sequenced with DNBSEQ-T7, which was completed by Beijing Compson Biotechnology Co., Ltd. (Beijing, China). After DNBSEQ-T7 sequencing, base sequencing quality distribution analysis, base content distribution analysis, and filtering of the raw image data (Rawreads) files obtained by high-throughput sequencing were performed.

[0047] The final sequence obtained by sequencing was re-aligned to the reference genome for subsequent analysis. The reference gene species is goat, and the reference genome link is: Capra hircus genome assembly ARS1.2-NCBI-NLM (nih.gov).

[0048] 1.3 Quality control of genomic data: To obtain reliable GWAS results, PLINK1.9 software was used to perform quality control on genotype data. The quality control conditions were as follows: (1) SNP sites on chromosomes 1-29 were retained; (2) sites with a missing rate greater than 5% were eliminated; (3) sites with a minor allele frequency less than 0.05 were eliminated; (4) sites that did not meet the Hardy-Weinberg test P value less than 10 were eliminated. -6 The location of

[0049] After screening, a total of 15,575,112 SNP loci covering chromosomes 1-29 were finally obtained, and the number of loci on chromosomes before and after quality control changed (see Figure 2 ), density map of the sites after quality control (see Figure 3 ).

[0050] 1.4 Introduction to genome-wide association analysis software: GMAT software was used to conduct genome-wide association analysis on the velvet thickness trait. The current GWAS analysis software only considers the additive effect of genes, ignoring the non-additive effect, especially the interaction effect, resulting in incomplete analysis of complex traits; the research traits also focus on cross-sectional data collected at a certain time point, ignoring longitudinal traits. GMAT software has six modules, including single trait analysis module, multi-trait analysis module, and longitudinal data analysis module. Compared with traditional GWAS analysis software, it is richer in model richness and trait applicability, significantly improves the statistical test power, and is more conducive to mining significant markers associated with traits. In terms of calculation, GMAT software is written in C++ language, calling Eigen and MKL libraries, using block reading and block calculation technology to save memory, and using technical means such as feature decomposition relationship matrix, linear transformation genome estimation value, EM and AI algorithm weighting, making GAMT software extremely efficient, and the calculation efficiency can be increased by thousands of times compared with Fast-LMM algorithm.

[0051] 1.5 Whole-genome association analysis: After the sequencing data was quality controlled, GMAT software was used to conduct an association analysis with velvet thickness based on the LMM model to screen out SNPs with significant effects. The LMM model is as follows:

[0052] y is the phenotypic vector, Xβ is the population structure effect, To test the marker effect, For polygenic effects, is the residual effect; K in the polygenic effect is the kinship matrix inferred by markers.

[0053] 1.6 Candidate gene identification and functional annotation: Download the reference genome information of the corresponding species from the ENSEMBL website, and use ANNOVAR software to annotate genes near significant SNPs. Then use the clusterProfiler package to perform gene function enrichment analysis on the annotated candidate genes according to the GO and KEGG databases.

[0054] 1.7 Analysis of association between significant loci and traits and multiple comparisons: R4.2 software was used to test the association between marker genotype and phenotype. The model is as follows: y = Xβ + Zγ + e; y is the phenotype vector, γ is the marker effect to be tested, and Z is the association matrix of γ. is the residual effect. LSD method was used for multiple comparisons between different genotypes.

[0055] II. Results and analysis: 2.1 Sequencing data quality control and comparison with reference genome: Sample sequencing quality control data are shown in Table 1. Base type distribution detection is mainly used to check whether there is AT and CG separation. As shown in Table 1, the average percentage of G and C in the sample is 44.26% of the total bases, the number of bases with a quality value greater than or equal to 20 accounts for 98.79% of the total bases, and the number of bases with a quality value greater than 30 accounts for 96.41% of the total bases. The average efficiency of comparison between sample DNA and genomic DNA is 99.94%. This shows that the library construction and sequencing of the samples of this population are normal.

[0056] Table 1 Quality control statistics of sample sequencing data

[0057]

[0058] 2.2 Statistics of different cashmere thickness traits of Arbas cashmere goats: The statistical results are shown in Table 2. It can be seen from Table 2 that the maximum, minimum, average, standard deviation and coefficient of variation of cashmere thickness of 1500 Arbas cashmere goats were statistically analyzed. The maximum, minimum and average cashmere thickness were 10cm, 3cm and 6.12cm respectively; the average cashmere thickness of 1500 goats was 6.12cm. The phenotypic distribution (see Figure 4 ).

[0059] Table 2 Statistics of cashmere thickness of Arbas cashmere

[0060]

[0061] 2.3 GWAS analysis results: Based on resequencing, 15,575,112 SNPs were screened for further analysis. Using the commonly used GWAS model LMM statistical analysis, 24 SNPs were found to be significantly associated with the cashmere thickness of the Albas cashmere goat, which are associated with the cashmere thickness trait (see Figure 5 and Figure 6 ), which can be used for auxiliary breeding of wool thickness traits. Detailed information of each significant locus is shown in Table 3.

[0062] Table 3 Information on 24 significantly associated SNPs in Arbas cashmere goats

[0063] 2.4 Identification of candidate genes related to velvet thickness and GO functional annotation: Gene function enrichment analysis was performed based on the GO and KEGG databases, and the functional annotation results (see Figure 7 and Figure 8 ), 24 loci related to the pubescent thickness trait were annotated to the ASTN2 gene (see Table 4). The ASTN2 gene has been identified in some studies as being associated with hair growth and hair follicle development.

[0064] Table 4 Information on 24 significantly associated SNPs in Arbas cashmere goats

[0065] In addition, the sequence information of 50 bp before and after the 24 SNP sites was extracted, as follows:

[0066] The first 50bp sequence of chr8:105620034 is: TAGAACGTCCACAGATCATCTTCCCCATCTGAGCTTCAGTTTCCTCAAGC, which itself is A, and the following 50bp sequence is: TGAAACGCTGATAGGGACCTAACCTCACAGGCTGTTTGGGAGGAGTGAAG. The overall sequence is shown in the sequence listing SEQ ID NO.1.

[0067] The first 50 bp sequence of chr8:105620069 is: TCAGTTTCCTCAAGCATGAAACGCTGATAGGGACCTAACCTCACAGGCTG, which is T itself, and the following 50 bp sequence is: TTGGGAGGAGTGAAGTGGATGCAATACAGTGTGTGGAAGTGCTTTGTGAG. The overall sequence is shown in the sequence listing SEQ ID NO.2.

[0068] The first 50bp sequence of chr8:105745247 is: GTCAACAGGGCCAGCCTGCCCATCTATTACTACTGACATTGATTTGGACA, which itself is A, and the following 50bp sequence is: CCGGGCCAGTGGAGAGCCCATAATTACTGGGAGTTTTAATCAACTGGTGT. The overall sequence is shown in the sequence listing SEQ ID NO.3.

[0069] The first 50bp sequence of chr8:105857933 is: GAGCAGCAGCTGCGCGCTCAGGAGGGCCAAGAGGAGCTACTCCATGTCCA, which itself is A, and the following 50bp sequence is: GGTCAGGAGGGGCAGCCATGAGGAGATACCCCTCGTCCAAGGTAAGGAGT. The overall sequence is shown in the sequence listing SEQ ID NO.4.

[0070] The first 50bp sequence of chr8:105858193 is: GTCTCACTCAATGAAACTAAGCCATGCCCTGTGGGGCCACCCAAGATGGG, which is C itself, and the following 50bp sequence is: GGGACATGGTGGAGAGGCCTGACAGAATGTGGTCCACTGGAGAAGGGAAT. The overall sequence is shown in the sequence listing SEQ ID NO.5.

[0071] The first 50bp sequence of chr8:105859025 is: AGGCTAATAGAGTTTTGCCAAGAGAATGCACTGGTCATAACAAACACCCT, which itself is C. The following 50bp sequence is: TTCCAACAACACAAGAGAAGACTCTACACATGGACATCACCAGATGGTCA. The overall sequence is shown in the sequence listing SEQ ID NO.6.

[0072] The first 50bp sequence of chr8:105859251 is: TTAAATTGAAGAAAGTGGGGAAAACCACTAGACCATTCAGGTATGACCTA, which itself is C, and the following 50bp sequence is: ATCAAATCCCTTATGATTATACGGTGGAAGTGAGAAGTAGATTTAAGGGA. The overall sequence is shown in the sequence listing SEQ ID NO.7.

[0073] The first 50 bp sequence of chr8:105859458 is: AAGTCAAGTGGGCCTTAGAAAGCATCACTACGAACAAAGCTAGTGGAGGT, which itself is G, and the following 50 bp sequence is: ATGGAATTCCAGTTGAACTATTTCAAATCCTGAAAGATGATGCTGTGAAA. The overall sequence is shown in the sequence listing SEQ ID NO.8.

[0074] The first 50bp sequence of chr8:105860067 is: TACTGTCACCCTGCTTATTTAACTTATATGCAGAGTACATCATGAGAAAT, which is G itself, and the following 50bp sequence is: CTGGGCTGGAAGAAGCACAAGCTGGAATTAAGATTGCTGGGAGAAATATC. The overall sequence is shown in the sequence listing SEQ ID NO.9.

[0075] The first 50bp sequence of chr8:105860379 is: ATAATCACTGCAGATGGTGACTGCAGCCATGAAATTAAAAGACACTTACT, which is C itself, and the following 50bp sequence is: CTTGGAAGGAAAGTTGTGACCAACCTAGATAGCATATTGAAAGGCAGAGA. The overall sequence is shown in the sequence listing SEQ ID NO.10.

[0076] The first 50 bp sequence of chr8:105860806 is: GACAGAGGATGAGATGGCTGGATGGCATCACTGACTCGTTGGACATGAGT, which is C itself, and the following 50 bp sequence is: TGAATGAACTCTGTGAGTTGGTGATGGACAGGGAGGCCTGGCGTGCTATG. The overall sequence is shown in the sequence listing SEQ ID NO.11.

[0077] The first 50bp sequence of chr8:105861058 is: TTCAAAGCCCAGAAGCATCCAAGCTTTGGGGTCCATGCTTCTGACCTCCA, which itself is C, and the following 50bp sequence is: GCTATAGGCTCACAGATCAGAGGAAGTTACATCCCAGTTAGTTTTGGGAG. The overall sequence is shown in sequence listing SEQ ID NO.12.

[0078] The first 50 bp sequence of chr8:105861224 is: CCGGAGACTTAAGAGATGTGCATTTGATCTCTGTGCTGGGGAGATTTCCT, which itself is G, and the following 50 bp sequence is: GAGGAGGAAATGGGAACCCATTCCAGTATTTTTGCCTAGATAACCCCATG. The overall sequence is shown in sequence listing SEQ ID NO.13.

[0079] The first 50 bp sequence of chr8:105861291 is: CCCATTCCAGTATTTTTGCCTAGATAACCCCATGCACAGAGGAGCCTGGC, which itself is G, and the following 50 bp sequence is: GACTACAGTCCACAGGGCCACAAAGAGCCAAACACGACTGAGGGGCTGAG. The overall sequence is shown in the sequence listing SEQ ID NO.14.

[0080] The first 50bp sequence of chr8:105861346 is: ACAGTCCACAGGGCCACAAAGAGCCAAACACGACTGAGGGGCTGAGCACA, which itself is A, and the following 50bp sequence is: AACATGGAAGGGGAGACCAAATGAAAACCAGGTGAACAAATGCAAACGTG. The overall sequence is shown in sequence listing SEQ ID NO.15.

[0081] The first 50 bp sequence of chr8:105861588 is: TCAGCGCTTCTGTCTCCAAGAACTGGAAAAATATGACTGAAATCAGCTCA, which itself is G, and the following 50 bp sequence is: TCCATAAAGACACGAAGTGTTGCTTGTATCACAGAGGCAGTGATAGGGAG. The overall sequence is shown in the sequence listing SEQ ID NO.16.

[0082] The first 50bp sequence of chr8:106015976 is: TAGGTTACAGTAGAATGAGCTTCAGACTCGATGACAGGAGTTATAAATAT, which itself is C. The following 50bp sequence is: CTCATTTCACAAAACTTAGGAAAACTGAGGCCCCAAGAGGGCACTTGCTG. The overall sequence is shown in the sequence listing SEQ ID NO.17.

[0083] The first 50bp sequence of chr8:106016464 is: GGTGAAATCTGGACCAGCATCCGTTTTTGGAAAGAAAGTTTGATTAGGAC, which is G itself, and the following 50bp sequence is: CACGTACGTTCATTGCTTTACGTACTGTCTGTGGCAGCTCTCAAGGTGCA. The overall sequence is shown in the sequence listing SEQ ID NO.18.

[0084] The first 50bp sequence of chr8:106016735 is: ACAGTGTTTGGTTTCTGTCAGTGGCCTAGAACATGGTCAGACACGTGGTC, which is G itself. The following 50bp sequence is: GTGCTTGACAAATAGCTGAGAGATTGTGGGGCGGGGAAGAGAGCAGGGAG. The overall sequence is shown in the sequence listing SEQ ID NO.19.

[0085] The first 50bp sequence of chr8:106016768 is: TGGTCAGACACGTGGTCGGTGCTTGACAAATAGCTGAGAGATTGTGGGGC, which itself is G, and the following 50bp sequence is: GGGAAGAGAGCAGGGAGAAAGGCTTCGCTAGAAAATGTTGGAAAAAGGAA. The overall sequence is shown in the sequence listing SEQ ID NO.20.

[0086] The first 50 bp sequence of chr8:106016875 is: GGCTAGAAGAGGTAATACGTAGAGAGAAGGCAAACAGTGGAGACACAGAA, which itself is G, and the following 50 bp sequence is: AGAACAAAAAACAGGACGGACAACGTACGGGAAAAACCACTACAATATTG. The overall sequence is shown in the sequence listing SEQ ID NO.21.

[0087] The first 50bp sequence of chr8:106016886 is: GTAATACGTAGAGAGAAGGCAAACAGTGGAGACACAGAAGAGAACAAAAA, which itself is A, and the following 50bp sequence is: CAGGACGGACAACGTACGGGAAAAACCACTACAATATTGTAAAGTAATTA. The overall sequence is shown in sequence listing SEQ ID NO.22.

[0088] The first 50 bp sequence of chr8:106016899 is: AGAAGGCAAACAGTGGAGACACAGAAGAGAACAAAAAACAGGACGGACAA, which itself is C, and the following 50 bp sequence is: GTACGGGAAAAACCACTACAATATTGTAAAGTAATTAGCCTCCCATTAAA. The overall sequence is shown in the sequence listing SEQ ID NO.23.

[0089] The first 50bp sequence of chr8:106021007 is: GGAGTCCTGTTTACAGGAACCAACAGGAGAACTCCGTCCGGTTTCTATAT, which itself is C, and the following 50bp sequence is: AGGTAAATAGAATCTCCCGGGCCAATGCTGGTTTTACCCGCTTAGACTCT. The overall sequence is shown in the sequence listing SEQ ID NO.24.

[0090] 2.5 Analysis of association between significant loci and traits and multiple comparisons: For the above 24 SNP loci, the association test between marker genotype and phenotype and the LSD method were used to perform multiple comparisons between different genotypes. The results showed that there were three genotypes in the 24 loci in the cashmere goat population (such as the locus chr8:105620034 had three genotypes of GG, GA and AA), and the average cashmere thickness of these three genotypes also had different differences. Among them, the average cashmere thickness of AA cashmere goats at the locus chr8:105620034 was 0.33424 greater than that of GA (significant difference), and 0.629316 greater than the average cashmere thickness of cashmere goats with genotype GG (significant difference). The specific analysis results of other loci are shown in Tables 5-6.

[0091] Table 5 Results of correlation test between SNPs and cashmere thickness in Arbas cashmere goats

[0092] Table 6 Results of correlation test between SNPs and cashmere thickness in Arbas cashmere goats

[0093]

[0094] It should be noted that in Tables 5-6 above, there is no significant difference between the data with the same lowercase letters in the numbers of the same trait, but there is a significant difference between the data with different lowercase letters.

[0095] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. Application of the detection of polymorphism of SNP sites related to cashmere thickness in the breeding of cashmere thickness traits of the Arbas cashmere type, characterized in that: The SNP site is at least one of the following 24 SNP sites, and the genome version referenced by the 24 SNP sites is the goat Capra hicus genome ARS1.2: The SNP sites at positions 105745247 and 106016886 on chromosome 8 have polymorphisms of A or C; The SNP sites at positions 105620034, 105857933, and 105861346 on chromosome 8 have polymorphisms of A or G; The SNP site at position 105859251 on chromosome 8 has a polymorphism of C or A; The SNP sites at positions 105858193, 105859025, 105860379, 105860806, 105861058, 106015976, 106016899 and 106021007 on chromosome 8 have polymorphisms of C or T; The SNP sites at positions 105861224, 105861291, 105861588, 106016464, 106016735, 106016768 and 106016875 on chromosome 8 have polymorphisms of G or A; The SNP site at position 105860067 on chromosome 8 has a polymorphism of G or C; The SNP site at position 105859458 on chromosome 8 has a polymorphism of G or T; The SNP site at position 105620069 on chromosome 8 has a polymorphism of T or C; The dominant genotype of the SNP loci at positions 105745247 and 106016886 on chromosome 8 is AA; The dominant genotype of the SNP sites at positions 105620034, 105857933, and 105861346 on chromosome 8 is AA; The dominant genotype of the SNP locus at position 105859251 on chromosome 8 is CC; The dominant genotype of the SNP loci at positions 105858193, 105859025, 105860379, 105860806, 105861058, 106015976, 106016899, and 106021007 on chromosome 8 was CC; The dominant genotype of the SNP loci at positions 105861224, 105861291, 105861588, 106016464, 106016735, 106016768, and 106016875 on chromosome 8 is GG; The dominant genotype of the SNP locus at position 105860067 on chromosome 8 is GG; The dominant genotype of the SNP locus at position 105859458 on chromosome 8 is GG; The dominant genotype of the SNP locus at position 105620069 on chromosome 8 is TT.

Images