LAMP-LFB reaction system for rapidly detecting blue marneffei and application of LAMP-LFB reaction system

Abstract

The invention discloses an LAMP-LFB reaction system for rapidly detecting blue marneffei and application, and belongs to the technical field of biological detection. The LAMP reaction system comprises two external primers F3 and B3, two internal primers FIP (F2 + F1) and BIP (B1 + B2), and two loop primers LF and LB. According to the invention, a set of LAMP amplification specific primers is designed aiming at the ITS1 gene of the Brachybacterium marneffei, and a set of rapid, sensitive and specific LAMP-LFB detection system aiming at the Brachybacterium marneffei is established. The detection sensitivity to the blue marneffei bacteria is as low as 400g / reaction, the detection precision is greatly improved, the detection time is shortened, and rapid detection and emergency detection of the blue marneffei bacteria can be realized.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, and in particular to a LAMP-LFB reaction system for rapidly detecting blue bacteria marneffei and its application. Background Art

[0002] Penicillium marneffei (PM) is the only temperature-biphasic pathogen among Penicillium and is a rare pathogen. Penicillium marneffei can occur in healthy people, but is more common in immunodeficient or immunosuppressed people. With the increasing number of HIV-infected people, reports of PM disease have also increased year by year. In recent years, cases of PM infection have also been reported in non-endemic areas. The transmission route of PM is still unclear, and inhalation of fungal spores through the respiratory tract is considered to be the most common route of infection. Common manifestations of PM infection include recurrent fever, anemia, weight loss, skin lesions, hepatosplenomegaly, lymphadenopathy, gastrointestinal and respiratory signs. When PM infection spreads throughout the body, it can develop rapidly and will be life-threatening without timely and effective antifungal treatment. Therefore, rapid and accurate identification of PM in its early stages is very necessary for PM disease prevention and control.

[0003] Traditional diagnostic methods for PM infection rely on culture or microscopy, both of which are time-consuming and have a low positive rate, but are still used in clinical microbiology laboratories. Therefore, it takes more time and effort to cultivate and identify PM in clinical microbiology laboratories. With the rapid development of nucleic acid diagnostic technology, PCR-based diagnostic techniques (such as conventional PCR technology and fluorescent PCR technology) are used for the detection of PM. However, these methods rely on expensive instruments and equipment, complex electrophoresis operations, expensive probe synthesis, and skilled operators, which greatly limits the application of these technologies. In addition, these detection technologies are time-consuming and not conducive to rapid detection and emergency detection.

[0004] In order to overcome the disadvantages of PCR amplification technology, many constant temperature amplification technologies have been developed in recent years. Compared with PCR technology, constant temperature amplification technology does not rely on thermal cycle amplification equipment, has a fast reaction speed and good sensitivity. Therefore, constant temperature amplification technology is conducive to rapid amplification, convenient detection and on-site diagnosis. So far, more than 10 constant temperature amplification technologies have been developed. The development of loop-mediated isothermal amplification technology (LAMP), one of the most widely used technologies, has greatly improved the detection of pathogenic microorganisms.

[0005] LAMP can amplify the target sequence under constant temperature conditions, and can use only one constant temperature displacement enzyme, with the characteristics of fast amplification speed, sensitive reaction and high specificity. In order to make this technology more widely used in the fields of biology, medicine and health, subsequent studies have combined LAMP technology with nano lateral flow detection technology to achieve fast, simple, specific and sensitive detection of nano biosensing technology, that is, loop-mediated isothermal amplification linked with gold nanoparticle lateral flow biosensor (Loop-Mediated Isothermal Amplification Linked With Nanoparticle-Based Lateral Flow Biosensor, LAMP-LFB). If LAMP-LFB technology can be used for the detection of PM, a set of LAMP amplification primers can be designed for the ITS1 gene of the blue-shaped bacteria of Marneffei, and it is expected to establish a fast, sensitive and specific LAMP-LFB detection system for PM. At present, there is no relevant report on the use of LAMP-LFB for the detection of blue-shaped bacteria of Marneffei. Summary of the invention

[0006] The purpose of the present invention is to provide a LAMP-LFB reaction system for rapid detection of T. marneffei and its application, so as to solve the problems existing in the above-mentioned prior art.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] One of the technical solutions of the present invention is the use of a LAMP reaction system in the preparation of a product for detecting blue bacteria of Marneffei, wherein the LAMP reaction system comprises: external primers F3 10 pmol and B3 10 pmol, internal primers FIP 40 pmol and BIP 40 pmol, loop primers LF* 20 pmol and LB 20 pmol, Bst DNA polymerase 1 μL, 10×Bst DNA polymerase buffer 12.5 μL, strand displacement DNA polymerase 10 U and template 1 μL, and deionized water is added to 25 μL;

[0009] The LAMP reaction system is reacted at a constant temperature of 64-68° C. for 35 minutes to obtain an amplification product;

[0010] The sequence of the external primer F3 is shown in SEQ ID NO.1, and the sequence of B3 is shown in SEQ ID NO.2; the sequence of the internal primer FIP is shown in SEQ ID NO.3, and the sequence of BIP is shown in SEQ ID NO.4; the sequence of the loop primer LF* is shown in SEQ ID NO.5, and the sequence of LB is shown in SEQ ID NO.6;

[0011] Labeling the 5' end of the loop primer LF with FAM to obtain a labeled amplification primer LF*;

[0012] The amplification product is detected by using a gold nanoparticle lateral flow biosensor method.

[0013] The second technical solution of the present invention is a product for detecting T. marneffei, comprising the LAMP reaction system.

[0014] The third technical solution of the present invention is a method for detecting T. marneffei for purposes other than disease detection or treatment, which uses the LAMP reaction system to detect T. marneffei in a sample to be tested.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] The present invention designs a set of LAMP amplification specific primers for the ITS1 gene of Pseudomonas marneffei, and establishes a set of rapid, sensitive and specific LAMP-LFB detection system for Pseudomonas marneffei. The detection sensitivity of Pseudomonas marneffei is as low as 400 ag / reaction, which greatly improves the detection accuracy, shortens the detection time, and can realize rapid detection and emergency detection of Pseudomonas marneffei. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 Schematic diagram of primer design of the present invention.

[0019] Figure 2 Schematic diagram of LFB detection results of LAMP amplification products.

[0020] Figure 3 It is a dynamic curve diagram of different turbidities at different reaction temperatures.

[0021] Figure 4 Schematic diagram of LFB detection results of each LAMP amplification product under different reaction concentrations.

[0022] Figure 5 Schematic diagram of LFB detection results after amplification of different microorganisms using the primers of the present invention. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0029] The embodiment of the present invention provides an application of a LAMP reaction system in preparing a product for detecting blue bacteria of Marneffei, wherein the LAMP reaction system comprises: external primers F3 10 pmol and B3 10 pmol, internal primers FIP 40 pmol and BIP 40 pmol, loop primers LF* 20 pmol and LB 20 pmol, Bst DNA polymerase 1 μL, 10×Bst DNA polymerase buffer 12.5 μL, strand displacement DNA polymerase 10 U and template 1 μL, and deionized water is added to 25 μL;

[0030] The LAMP reaction system is reacted at a constant temperature of 64-68° C. for 35 minutes to obtain an amplification product;

[0031] The sequence of the external primer F3 is shown in SEQ ID NO.1, and the sequence of B3 is shown in SEQ ID NO.2; the sequence of the internal primer FIP is shown in SEQ ID NO.3, and the sequence of BIP is shown in SEQ ID NO.4; the sequence of the loop primer LF* is shown in SEQ ID NO.5, and the sequence of LB is shown in SEQ ID NO.6;

[0032] The 5' end of the loop primer LF is labeled with FAM to obtain a labeled amplification primer LF*;

[0033] The amplification product is detected by using a gold nanoparticle lateral flow biosensor method.

[0034] In some specific embodiments, the LAMP reaction system is subjected to a constant temperature reaction at 67° C. for 35 min.

[0035] In some specific embodiments, after the LAMP amplification reaction is completed, the amplification result is detected using a visual color method or a biosensor detector.

[0036] (1) Visual color method: Add a visual dye (specific nucleic acid amplification indicator, Visual Detection Reagent, VDR) to the mixture after the LAMP amplification reaction. LAMP will produce a large amount of cations while synthesizing DNA. The cations can change the pH in the reaction tube, thereby changing the color of the VDR. Therefore, the results can be interpreted by the color change of the reaction tube. After the amplification is completed, the positive changes from colorless to bright green (indicating that the detection template is PM), and remains colorless to negative (indicating that the detection template is not PM).

[0037] (2) LFB method: The PM-LAMP product is directly added to the sample pad area of ​​the LFB, and then 120 μL of detection buffer (composition: Tris-HCl 40 mM at pH = 8.8, KCl 20 mM, MgSO4 16 mM, (NH4)2SO4 20 mM, Tween-20 0.2%, Betaine 1.6 M, dNTPs 2.8 mM; DNA isothermal amplification kit from Tianjin Huidexin Technology Development Co., Ltd.) is added to the sample pad area. The PM-LAMP product moves from the sample pad to the absorbent pad under the action of siphoning. When the PM-LAMP product reaches the gold-labeled pad, one end of the product reacts with (streptavidin coupled to polymer nanoparticles). As the product continues to move, the other end of the labeled product (i.e., the fluorescein-labeled end) binds to the antibody in the detection line area, fixing the product in the detection line area. As the product accumulates in the test line area, a color reaction is performed through the (streptavidin coupled to polymer nanoparticles) at the other end, thereby achieving visual detection of PM-LAMP products. In addition, the excess streptavidin coupled to polymer gold nanoparticles can bind to the B-BSA (streptavidin coupled to polymer nanoparticles) in the CL (quality control line) area to perform a direct color reaction to determine whether the function of LFB is normal. Since the hapten labeled with the LAMP primer for PM detection is FAM (fluorescein), when two red bands appear, it is positive (indicating that the detection template is PM), and when one red band (CL) appears, it is negative (indicating that the detection template is not PM). The two bands refer to TL (Test Line, TL, detection line) and CL (quality control line).

[0038] The embodiment of the present invention also provides a product for detecting T. marneffei, comprising the LAMP reaction system.

[0039] In some specific embodiments, the product comprises a reagent, a test strip, or a kit.

[0040] The embodiment of the present invention also provides a method for detecting T. marneffei for purposes other than disease detection or treatment, and the LAMP reaction system is used to detect T. marneffei in a sample to be tested.

[0041] The sources of the reagents involved in each embodiment of the present invention are as follows:

[0042] Anti-fluorescein antibody (anti-FITC), polymer nanoparticles coupled with streptavidin (SA-NP) and biotin-coupled bovine serum albumin (B-BSA) were purchased from Beijing Hi-Tech Zhengyuan Biotechnology Co., Ltd.

[0043] The backing plate, sample pad, gold label pad, fiber membrane and absorbent pad were purchased from Jie-Yi Company.

[0044] Isothermal Amplification Kit and visual dye (VDR) were purchased from Beijing HaiTai-Zhenyuan Biotechnology Co., Ltd. (Beijing, China).

[0045] DNA extraction kits (QIAamp DNA minikits; Qiagen, Hilden, Germany) were purchased from Qiagen, Germany.

[0046] DL1000 DNA Marker was purchased from Takara Biotechnology (Dalian) Co., Ltd.

[0047] The remaining reagents were commercially available products.

[0048] Example 1

[0049] Extraction and preparation of pathogen templates

[0050] 1. Genome extraction: The genomic DNA of T. marneffei and other pathogens was extracted using the DNA extraction kit of Qiagen Company according to the instructions. The concentration and purity of the genomic DNA were determined by UV spectrophotometer. Other pathogens were also extracted using the corresponding method and stored at -20℃ for future use.

[0051] The DNA cloning plasmid of T. marneffei was established, and the ITS1 of T. marneffei DNA was subcloned into the pUC57 vector. The plasmid was extracted and its initial concentration was quantified, and pUC57-PM-ITS1 was diluted to the required concentration. The specificity of PM-LAMP technology was evaluated using DNA of common fungi and conditional pathogens as templates.

[0052] The information of each bacterial strain used in the present invention is shown in Table 1. The isolated strains used in the embodiments of the present invention are all from the Microbiology Laboratory of the Medical Laboratory Department of Guiyang First People's Hospital.

[0053] It should be noted that the inventors have actually verified dozens of PM strains from different sources, and the method of the present invention can effectively verify them; however, due to space considerations, only the verification results of 6 strains are reflected in the examples (corresponding to Example 5).

[0054] Table 1 Information of each bacterial strain

[0055]

[0056] Example 2

[0057] Feasibility verification of primer detection

[0058] 1. Targeting the PM-specific gene ITS1. Use the primer design software PrimerExplorer V5 (EikenChemical) (http: / / primerexplorer.jp / e / ) to design LAMP primers, and perform sequence comparison analysis on the obtained specific primers in the NCBI database (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to exclude possible non-specific matches between the primers and sequences of other species, and finally obtain the optimized LAMP amplification primers. The position and direction of primer design are shown in Figure 1 .

[0059] LAMP primers include 6 primers, which recognize 6 regions of the target sequence respectively, including two external primers F3 and B3, two internal primers FIP and BIP, and two loop amplification primers LF and LB. The above primers can monitor turbidity with an isothermal amplification instrument after the LAMP reaction. In order to construct a detectable product, the 5' end of the loop amplification primer LF is labeled with fluorescein (6-carboxy-fluorescein, FAM) and named LF*. The two internal primers FIP and BIP are the main primers that mediate LAMP amplification, and the replacement primers F3 and B3 play a replacement role in the LAMP reaction. The two loop amplification primers LF* and LB can accelerate the LAMP reaction and increase the amount of LAMP products. The labeled amplification products can be used to detect the amplification results by a biosensor detector (LFB), reducing the use of special equipment.

[0060] 2. Establish a LAMP reaction system.

[0061] The reaction system includes: the external primers F3 (10pmol, SEQ ID NO.1: ccgagcgtca tttctgcc) and B3 (10pmol, SEQ ID NO.2: agttcagcgg gtaactcct), the internal primers FIP (40pmol, SEQ ID NO.3: tcgaggacca gacggacgtc tcaagcacgg cttgtgtg) and BIP (40pmol, SEQ ID NO.4: tatggggctctgtcactcgc tcacctgatc cgaggtcaac c), the loop primers LF* (20pmol, SEQ ID NO.5: FAM-gctgcctttc gggcaggt) and LB (20pmol, SEQ ID NO.6: tggtcaccac catatttac), 1μL of BstDNA polymerase, 12.5μL of 10×Bst DNA polymerase buffer, 10U of strand displacement DNA polymerase and 1μL of template, add deionized water to 25μL, and react at 64℃ for 35 minutes.

[0062] Different groups were set up according to the added templates, and each group was repeated 3 times. 4pg of 1μL pUC57-PM-ITS1 plasmid template was added as the treatment group, 10pg of Candida albicans DNA template was added as the negative control group 1, 10pg of Klebsiella pneumoniae DNA template was added as the negative control group 2, and 1μL of double distilled water was used instead of the template as the blank control group.

[0063] 3. Visual color verification: Add VDR to the reaction mixture in step 1.

[0064] The results showed that the treatment group changed from colorless to bright green, while the negative control groups 1, 2 and the blank control group remained colorless. That is, only the treatment group showed positive amplification, indicating that the LAMP primers designed for ITS1 to detect PM are feasible and highly specific.

[0065] 4. LFB detection. Add each group of LAMP amplification products directly to the sample pad area of ​​the LFB, then add 120 μL of detection buffer and observe the bands that appear. The results are as follows: Figure 2 shown. Figure 2 From left to right: treatment groups ( Figure 2 1 in the negative control group 1 ( Figure 2 2), negative control group 2 ( Figure 2 3), blank control group ( Figure 2 4). Only the treatment group showed two bands, while the other groups showed only one band, which was the same as the result of the visual color method.

[0066] Example 3

[0067] Temperature selection for amplification reactions

[0068] Under the reaction system conditions of Example 2, 1 μL 4 pg PM-ITS1 was selected as the template. Other conditions were exactly the same, and the reaction temperature was set to 61-68°C, with a temperature difference of 1°C between each treatment. A real-time turbidity meter was used for detection, and dynamic curves of different turbidities were obtained at different temperatures. The results are shown in FIG. Figure 3 As shown. Under the amplification conditions of 64-68℃, the positive results are first observed in the LAMP reaction, so it is the optimal reaction temperature of LAMP primers ( Figure 3 D~3H), the subsequent verification of the present invention selected 67°C as the constant temperature condition for LAMP amplification. Figure 3 A temperature dynamic curve diagram of LAMP primers designed for PM detection targeting the ITS1 gene.

[0069] Example 4

[0070] Sensitivity testing of primer detection

[0071] The pUC57-PM-ITS1 plasmid serially diluted in Example 1 was used to perform a standard LAMP amplification reaction according to the treatment group in Example 2, and then detected by LFB. The results are as follows: Figure 4 shown. Figure 4 The corresponding template concentrations from left to right are: 4ng ( Figure 4 1), 400pg( Figure 4 2), 40pg( Figure 4 3), 4pg( Figure 4 4), 400fg( Figure 4 5), 40fg( Figure 4 6), 4fg( Figure 4 7), 400ag( Figure 4 8), 40ag( Figure 4 9), 4ag( Figure 4 10), the rightmost is the blank control ( Figure 4 11): 1 μL double distilled water was used instead of the template.

[0072] The results showed that the detection range of LAMP-LFB was 4ng~400ag, and LFB test was positive ( Figure 4 1 to 8 lanes); when the template is reduced to 40ag ( Figure 4 8), the LFB result was negative.

[0073] Example 5

[0074] Specificity testing of primer assays

[0075] The specificity of the primers provided by the present invention was evaluated using the microorganisms provided in Table 1 as templates. The reaction system and method of Example 2 were used as the templates, and the microorganisms in Table 1 were used in an amount of 1 μL 10 pg. The results are shown in FIG. Figure 5 shown. Figure 5 Among them, 1 to 6 are PM templates from 6 different sources, 7 is Staphylococcus aureus template, 8 is Klebsiellapneumoniae template, 9 is Haemophilus influenzae template, 10 is Candida albicans template, 11 is Candida tropicalis template, 12 is Candida glabrata template, 13 is Candidaparapsilosis template, 14 is Meyerozymaguilliermondii template, 15 is Pichia kudriavzevii template, 16 is Listeria monocytogenes template, 17 is Norovirus clinicalsamples template, 18 is EVA71 template, 19 is CVA16 template, 20 is Enterococcusfaecalis, 21 is Escherichia coli, and 22 is a blank control. 1uL double distilled water was used instead of the template. The results showed that LAMP-LFB can correctly detect the target sequence.

[0076] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Application of the LAMP reaction system in the preparation of a product for detecting the blue bacteria of Marneffei, characterized in that: The LAMP reaction system includes: external primers F3 10 pmol and B3 10 pmol, internal primers FIP 40 pmol and BIP 40 pmol, loop primers LF* 20 pmol and LB 20 pmol, Bst DNA polymerase 1 μL, 10×Bst DNA polymerase buffer 12.5 μL, strand displacement DNA polymerase 10 U and template 1 μL, and deionized water is added to 25 μL; The LAMP reaction system is reacted at a constant temperature of 64-68° C. for 35 minutes to obtain a positive amplification product; The sequence of the external primer F3 is shown in SEQ ID NO.1, and the sequence of B3 is shown in SEQ ID NO.2; the sequence of the internal primer FIP is shown in SEQ ID NO.3, and the sequence of BIP is shown in SEQ ID NO.4; the sequence of the loop primer LF* is shown in SEQ ID NO.5, and the sequence of LB is shown in SEQ ID NO.6; Labeling the 5' end of the loop primer LF with FAM to obtain a labeled amplification primer LF*; The amplification product is detected by using a gold nanoparticle lateral flow biosensor method.

2. The use according to claim 1, characterized in that: The LAMP reaction system was kept at 67° C. for 35 min.

3. A product for detecting blue bacteria of Marneffei, characterized in that: It comprises the LAMP reaction system according to claim 1.

4. The product according to claim 3, characterized in that The products include reagents, test strips or test kits.

5. A method for detecting T. marneffei for purposes other than disease detection or treatment, characterized in that: The LAMP reaction system according to claim 1 is used to detect the blue bacteria of Marneffei in the sample to be tested.

Images