Application of TRIM34 inhibitor in preparation of tumor treatment medicine

Abstract

The invention belongs to the field of biological medicine, and particularly relates to application of a TRIM34 inhibitor in preparation of tumor treatment drugs. The present invention reveals the use of a three-part domain protein 34 (TRIM34) as a therapeutic target to promote the sensitivity of HCC cells to ferroptosis, thereby providing a new strategy in the immunotherapy of hepatocellular carcinoma. The invention provides a treatment strategy for enhancing the sensitivity of hepatocellular carcinoma cells to ferroptosis by targeting a three-part domain protein 34 (TRIM34), the sensitivity of hepatocellular carcinoma cells to ferroptosis is effectively improved, and the curative effect of combined immunotherapy is enhanced, so that the treatment effect of hepatocellular carcinoma is improved.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine research, and in particular to use of a TRIM34 inhibitor in the preparation of tumor therapeutic drugs. Background Art

[0002] Hepatocellular carcinoma (HCC) is one of the most prevalent malignant cancers in the world, with an annual incidence of more than 800,000 people. Recently, treatment strategies such as immunotherapy, surgical resection, and liver transplantation have made significant progress, but the prognosis of HCC patients and the 5-year survival rate after surgery are still unsatisfactory, accompanied by high recurrence and metastasis rates. Therefore, it is crucial to explore the progression mechanism of HCC and reveal potential diagnostic and therapeutic targets. Poor prognosis and resistance to treatment remain an important challenge. Ferroptosis, a programmed cell death mode characterized by iron-dependent lipid peroxidation, plays a vital role in regulating the development and treatment response of HCC. Resistance to ferroptosis is one of the main factors leading to the development and recurrence of HCC.

[0003] Ubiquitination plays a crucial role in regulating cellular functions, including protein degradation, signaling, and cellular responses to stress. The recently reported association between ubiquitination and ferroptosis reveals a complex interplay between these processes. Understanding the molecular mechanisms underlying this interplay may help identify new therapeutic targets and develop treatment strategies for diseases with dysregulated cell death, such as hepatocellular carcinoma.

[0004] Identifying the mechanisms of resistance of hepatocellular carcinoma cells to ferroptosis is crucial for developing effective therapeutic strategies. In recent years, advances in CRISPR / Cas9 screening technology have made it possible to systematically explore gene functions and molecular mechanisms in cancer. Summary of the invention

[0005] The purpose of the present invention is to solve the shortcomings of the prior art and to propose the use of a TRIM34 inhibitor in the preparation of a tumor treatment drug.

[0006] To achieve the above object, the present invention adopts the following technical solutions: The first aspect of the present invention provides use of a TRIM34 inhibitor in the preparation of a tumor treatment drug.

[0007] In one embodiment, the tumor treatment drug has at least one of the following functions: Inhibit the proliferation of tumor cells; inhibit tumor growth.

[0008] In one embodiment, the TRIM34 inhibitor refers to an inhibitor of TRIM34 activity, or an inhibitor of TRIM34 gene transcription or expression.

[0009] The TRIM34 inhibitor is siRNA, shRNA, antibody or small molecule compound.

[0010] A second aspect of the present invention provides a method for treating tumors, comprising administering a TRIM34 inhibitor to a subject.

[0011] The third aspect of the present invention provides a tumor treatment drug, comprising an effective amount of a TRIM34 inhibitor and a pharmaceutical carrier.

[0012] A fourth aspect of the present invention provides a tumor treatment drug combination, comprising an effective amount of a TRIM34 inhibitor and at least one other tumor treatment drug.

[0013] In a fifth aspect, the present invention discloses a method and composition for increasing the sensitivity of hepatocellular carcinoma cells to ferroptosis.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: the present invention provides a therapeutic strategy for enhancing the sensitivity of hepatocellular carcinoma cells to ferroptosis by targeting tripartite domain protein 34 (TRIM34), effectively increasing the sensitivity of hepatocellular carcinoma cells to ferroptosis, and enhancing the efficacy of combined immunotherapy, thereby improving the therapeutic effect of hepatocellular carcinoma.

[0015] The present application first discovered that the present invention focuses on identifying tripartite domain protein 34 (TRIM34) as a key factor promoting ferroptosis resistance in hepatocellular carcinoma cells, and thus provides a new therapeutic strategy with the prospect of being applied to the preparation of targeted drugs for hepatocellular carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Genome-wide CRISPR / Cas9 screen identifies contribution of TRIM34 to ferroptosis resistance: (A) Schematic diagram of genome-wide CRISPR / Cas9 loss-of-function screening; (B) Log2-fold change of gene enrichment after Erastin treatment at day 24 after CRISPR / Cas9 selection (partial zoom, E3 ubiquitin ligases are labeled on the right); (C) Results from the cross-CRISPR / Cas9 screen and the E3 ubiquitin ligase family were used to identify potential candidate genes for further study to identify TRIM34 using volcano plots and Venn diagrams.

[0017] Figure 2 Transmission electron microscopy (TEM) was used to evaluate changes in mitochondrial ultrastructure in hepatoma cell lines after treatment with erastin or RSL3; scale bar, 500 nm.

[0018] Figure 3 Upregulation of TRIM34 in HCC predicted unfavorable survival of HCC patients: (A) Relative mRNA expression of TRIM34 was compared between HCC and normal liver tissues in cohorts obtained from The Cancer Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx). (B) Waterfall plot showing the changes in TRIM34 mRNA expression in 90 pairs of HCC and adjacent non-tumor tissues; (C) Kaplan-Meier plot of overall survival of HCC samples from the UALCAN online database.

[0019] Figure 4 TRIM34 enhances tumor growth and metastasis in vivo: (A, B) Representative images show xenograft tumors formed in nude mice by subcutaneous injection of HCCLM3- and Huh7-transfected cells ( n = 6 in each group); Tumor volume curves of mouse xenograft tumor models were evaluated (n = 6 per group).

[0020] Figure 5 TRIM34 enhanced tumor growth in vitro.

[0021] Figure 6 TRIM34 directly interacts with UPF1 as a downstream protein.

[0022] (A) Schematic diagram of the discovery of TRIM34 interactors by IP-MS.

[0023] (B) Venn analysis of FerrDb V2 and IP-MS results.

[0024] Figure 7 Ubiquitination levels of UPF1 in HCCLM3- and Huh7-transfected cells.

[0025] Figure 8 TRIM34 ubiquitinates and degrades UPF1 to enhance GPX4 mRNA stability: (A, B) GPX4 mRNA degradation curves of HCCLM3 cells (sh-con or sh3) and Huh7 cells (Lv-con or TRIM34-OE) after treatment with doxorubicin D (5 μg / ml); (C, D) GPX4 protein levels in the above HCCLM3 and Huh7 transfected cells.

[0026] Fig. 9 The TRIM34 / UPF1 axis is associated with clinical prognosis and the efficacy of immunotherapy.

[0027] Fig.10 WB verification image after lentiviral transfection targeted intervention of TRIM34 expression in hepatocellular carcinoma cells. Implementation

[0028] In order to provide a further understanding of the purpose, structure, features, and functions of the present invention, the following detailed description is given in conjunction with the embodiments.

[0029] Please refer to Figure 1 The present invention provides the use of a TRIM34 inhibitor in preparing a tumor treatment drug.

[0030] The present invention discloses a method and composition for increasing the sensitivity of hepatocellular carcinoma cells to ferroptosis. The key findings of the invention are as follows: Identification of TRIM34: Through a comprehensive CRISPR / Cas9 screening approach, TRIM34 has been identified as a candidate gene that is significantly altered by ferroptosis inducers. Figure 2 Further studies found that TRIM34 enhanced the resistance of hepatocellular carcinoma cells to ferroptosis.

[0031] Increased expression in HCC tissues: Please refer to Figure 3 , found that TRIM34 expression was elevated in hepatocellular carcinoma tumor tissues, which was associated with poor prognosis, highlighting the clinical significance of targeting TRIM34.

[0032] Please refer to Figure 4-5 After targeted interference with the expression of TRIM34, the proliferation, migration and metastasis abilities of hepatocellular carcinoma cells were changed accordingly.

[0033] Mechanism research: please refer to Figure 6-8 Mechanistically, TRIM34 was found to directly interact with upstream frameshift 1 (UPF1), a core component of the nonsense-mediated mRNA degradation (NMD) pathway. This interaction promotes the ubiquitination and degradation of UPF1, leading to the degradation of mRNA corresponding to glutathione peroxidase 4 (GPX4), an important ferroptosis suppressor gene in hepatocellular carcinoma cells, thereby increasing the stability of GPX4 mRNA and protein expression.

[0034] Therapeutic potential: The TRIM34 / UPF1 / GPX4 pathway represents a new therapeutic approach to enhance the sensitivity of hepatocellular carcinoma cells to ferroptosis. Fig. 9 , targeting TRIM34 showed the potential to enhance the efficacy of anti-programmed cell death ligand-1 (PD-1) therapy in hepatocellular carcinoma.

[0035] The tissue samples used in the following examples were from the applicant's hepatocellular carcinoma surgery patients. The patients and their families were fully informed of the research purpose and process before surgery and signed informed consent. This study has been approved by the ethics committee of this unit.

[0036] The hepatocellular carcinoma cell lines HCCLM3, Huh7, HLF, Hep3B, SMMC7721, HepG2, and MHCC97L used were purchased from Shanghai Cell Bank.

[0037] The cell culture medium used was prepared with DMEM / F12, 10% fetal bovine serum, 1% penicillin, and 1% streptomycin (Gibco Technologies, Inc.); TRIzol used for RNA extraction was purchased from Invitrogen; All reagents used for qRT-PCR were purchased from Nanjing Norwegian Biotechnology Co., Ltd.

[0038] Interfering gene sequences involved in the embodiments: shTRIM34 Human shRNA1:TTCCCGCCATSTGAAGTATGT; shRNA2:CGGAGGAAGTATTCAAGGAAT; shRNA3:TAGGGTTACAGAATAAATGTA; shTRIM34 Mouse shRNA: CAGTTGGTGGAGGAACTTATC.

[0039] The human CRISPR knockout pooled library (Brunello) contains 76,441 sgRNAs targeting 19,114 protein-coding genes (Addgene #73179), which was provided by Nanjing Corus Biotech Co., Ltd. (Nanjing, China).

[0040] The general knockout screening workflow used in this study is as follows Figure 1 As shown in (A).

[0041] Library amplification and virus preparation were performed according to the manufacturer's instructions.

[0042] HCC cell lines were first engineered to express Cas9 using the Cas9 coding sequence by lentiviral transduction, generating Huh7-Cas9 cells, which were transduced with the gRNA library in the presence of 0.8 μg / mL polybrene, ensuring a minimum coverage of 200-fold, for 24 h.

[0043] The cells were then cultured in fresh DMEM medium containing puromycin (3 μg / mL) for 72 h.

[0044] After screening, transfected cells were divided into three groups, each with approximately 500-fold library coverage; one group was collected at baseline before treatment (T0), while the other groups received a sublethal dose of ferroptosis inducer (IC20) or vehicle exposure over 24 days.

[0045] On day 24, cells were collected and genomic DNA was extracted. Amplified sgRNA samples were ready for next-generation sequencing.

[0046] like Figure 1 (B) shows the log2-fold change in gene enrichment after erastin treatment at day 24 of CRISPR / Cas9 selection (partial zoom, E3 ubiquitin ligases are labeled on the right).

[0047] PCR was used to amplify the sgRNA barcodes. Deep sequencing, performed by Tsingke Biotechnology Co., Ltd. (Shanghai, China), was performed to assess the relative enrichment or depletion of different sgRNA sequences. The quantification and purity of the resulting PCR products were assessed using a QubiT2 fluorometer, and qPCR was performed using the KAPA Library Quantification Kit for Illumina Platforms. For each replicate, the number of reads per kilobase was calculated, and the log2 fold change was determined by comparing the abundance of the sgRNA to that of the initial plasmid pool. Samples with poor reproducibility and guide RNAs with low representation in the initial plasmid pool were excluded.

[0048] like Figure 1 (C) Results from a cross-CRISPR / Cas9 screen and the E3 ubiquitin ligase family were used to identify potential candidate genes for further study to identify TRIM34 using volcano plots and Venn diagrams.

[0049] Example 2: Transmission electron microscopy observation of the effect of TRIM34 on mitochondrial changes in hepatocellular carcinoma ferroptosis.

[0050] like Figure 2 Shown, transmission electron microscopy (TEM) assessed changes in mitochondrial ultrastructure in hepatoma cell lines after treatment with erastin or RSL3; scale bar, 500 nm.

[0051] The indicated hepatoma cells were seeded on 6-cm diameter culture dishes and treated with Erastin (5 μM) or RSL3 (2 μM) for 12 h. Figure 2were acquired using a transmission electron microscope (Hitachi; HT7700, Japan), and all fields were evaluated at a magnification of ×15,000.

[0052] like Figure 5 For the cell counting kit-8 (CCK-8) assay, transfected cells were cultured in 96-well plates (500 cells per well) as indicated. At the indicated time points (1, 2, 3, 4, 5 days), 10 μL of CCK-8 solution diluted in 90 μL of culture medium was added to each well, and the plates were incubated at 37°C for 2 hours.

[0053] The absorbance (450 nm) of each well was measured using Multiskan GO (Thermo Fisher). For 5-ethynyl-2'-deoxyuridine (EdU) experiments, transfected cells were cultured in 96-well plates (20,000 cells per well) for 2 days, 50 μM EdU (RiboBio, Guangzhou, China) was added to each well, and the plates were incubated at 37°C for 2 h. They were then fixed, permeabilized, and nuclei were stained with 400 μL Hoechst 33342. Cells in five randomly selected fields in each well were counted to determine the proportion of EdU-positive cells.

[0054] For colony formation assays, transfected cells were plated into 6-well plates (500 cells per well) and cultured in 2 mL of culture medium for 10–14 days. Proliferating colonies were fixed with 4% PFA and stained with crystal violet.

[0055] like Figure 4 As shown, five-week-old male BALB / c nude mice and C57BL / 6 J mice were obtained from the Laboratory Animal Center of Nanjing Medical University and housed in a specific pathogen free (SPF) facility with a 12 / 12 h day / night cycle with free access to feed and water. This study was approved by the Ethics Committee of the Laboratory Animal Management of Nanjing Medical University. Animals with a weight loss of more than 20%-25% or tumor weight exceeding 10% of body weight were euthanized.

[0056] Subcutaneous tumor formation assay.

[0057] Transfected cells (1×106 cells / 100 μL) were injected subcutaneously into the inguinal site of BALB / c nude mice. Mice were monitored every four days and sacrificed after 28 days. Tumor volume was calculated every 4 days using the formula 1 / 2 (length × width^2).

[0058] Lung metastasis experiment.

[0059] Transfected cells carrying the fluorescein marker (1 × 106 cells / 100 μL) were injected into BALB / c nude mice via the tail vein. Four weeks later, mice were intraperitoneally injected with 100 mg / kg of d-luciferin (Xenogen, Hopkinton, MA, USA) and monitored using an IVIS 100 imaging system (Xenogen). Lungs were then surgically removed, placed in PBS for photographing, fixed, and evaluated with HE staining. Overall survival was recorded at 12 weeks.

[0060] like Fig. 9 Shown is a mouse immune competence model.

[0061] C57BL / 6 J mice bearing tumors arising from shRNA-transfected H22 cells in the left flank were treated with five doses of anti-PD-1 antibody (BioXcell, BE0146) or isotope control IgG (BioXcell, BE0089).

[0062] like Figure 6 Immunoprecipitation coupled with mass spectrometry (IP / MS) experiments were performed, proteins were extracted from transfected cells and immunoprecipitated (IP) using primary antibodies against protein A / G agarose beads (Santa Cruz Biotechnology, Shanghai, China) as shown. The separated immunoprecipitates were then analyzed by mass spectrometry (MS, manufactured by Thermo Scientific, Waltham, MA).

[0063] like Figure 7 As indicated, cells transfected with the indicated proteins were treated with 15 μM MG132 (Sigma) for 8 h before harvesting and then collected in ice-cold PBS. The collected cells were suspended on ice in RIPA buffer (containing 200 mM NaCl, 20 mM Tris-HCl, pH 8.0, 1 mM EDTA, 1 mM EGTA, 1% Nonidet P-40, 0.5% SDS, 0.1% SDS, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4, protease inhibitor cocktail, and 15 μM MG132) and lysed on ice for 10 min. Lysates were subjected to immunoprecipitation of ubiquitinated proteins using specific antibodies. Immunoprecipitated samples were subjected to Western blotting (WB) analysis by SDS-PAGE.

[0064] like Figure 8 Protein extraction and Western blotting (WB) were performed as indicated.

[0065] HCC cells and tissue samples were lysed in radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, Haimen, China). Protein concentrations were determined using an enhanced BCA protein assay kit (Beyotime). Proteins were separated by 10% or 12.5% ​​polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, MA). The membranes were then blocked with blocking buffer (Beyotime, Haimen, China) at room temperature for 2 h and incubated with primary antibodies overnight at 4°C. After three washes (15 min each) with Tris-buffered saline containing 0.1% Tween (TBST), the membranes were incubated with horseradish peroxidase-linked secondary antibodies for 1 h at room temperature. The membranes were then washed again, and the protein expression levels were visualized using a SuperECL luminescent substrate kit (US Everbright, Suzhou). Relative protein expression was quantified using ImageJ software (National Institutes of Health, Bethesda, MD).

[0066] like Fig. 9 As shown, H22 cells stably expressing control shRNA or shTRIM34 were subcutaneously injected under the left rib cage of C57BL / 6J mice. Then, these mice were treated according to the prescribed dosing schedule, with one group treated with anti-PD-1 antibody and the other group treated with isotope control IgG. In mice bearing shTRIM34 tumors, anti-PD-1 antibody significantly inhibited tumor growth, both in terms of size and weight.

[0067] Combination Fig.10 , reflecting effective gene intervention. Lentiviral vectors of target genes, short hairpin RNA (shRNA), and empty vector were synthesized by GenePharma (Shanghai, China). The shRNA sequence is as above. Stable cell lines were generated by selection for one week using penicillin-streptomycin alone (5 μg / mL; Sigma-Aldrich, St. Louis) or in combination with gentamicin (400 μg / mL; Sigma-Aldrich, St. Louis).

[0068] The above examples illustrate that the tripartite domain protein 34 (TRIM34) discovered in the present invention serves as a therapeutic target to promote the sensitivity of HCC cells to ferroptosis, thereby providing a new strategy in the immunotherapy of hepatocellular carcinoma.

[0069] The present invention is not limited to the disclosed embodiments, and the present invention will cover various modifications and equivalent changes within the scope described in the patent and the scope of the claims.

[0070] The present invention has been described by the above-mentioned relevant embodiments, however, the above-mentioned embodiments are only examples for implementing the present invention. It must be pointed out that the disclosed embodiments do not limit the scope of the present invention. On the contrary, changes and modifications made without departing from the spirit and scope of the present invention are all within the scope of patent protection of the present invention.

Claims

1. Use of TRIM34 inhibitors in the preparation of tumor therapeutic drugs.

2. Use of the TRIM34 inhibitor according to claim 1 in the preparation of a tumor treatment drug, characterized in that: The tumor treatment drug has at least one of the following functions: inhibiting the proliferation of tumor cells; inhibiting the growth of tumors.

3. Use of the TRIM34 inhibitor according to claim 1 in the preparation of a tumor treatment drug, characterized in that: The tumor is a tumor that overexpresses TRIM34.

4. Use of the TRIM34 inhibitor according to claim 1 in the preparation of a tumor treatment drug, characterized in that: The TRIM34 inhibitor includes inhibiting TRIM34 activity, or inhibiting TRIM34 gene transcription or expression.

5. Use of the TRIM34 inhibitor according to claim 1 in preparing a tumor treatment drug, characterized in that: The TRIM34 inhibitor is siRNA, shRNA, antibody or small molecule compound.

6. Use of the TRIM34 inhibitor according to claim 1 in the preparation of a tumor treatment drug, characterized in that: The TRIM34 inhibitor is the sole active ingredient or one of the active ingredients of the tumor treatment drug.

7. Use of a TRIM34 inhibitor in the preparation of a drug having at least any of the following functions: activating ferroptosis tolerance in tumor cells; promoting ubiquitination of UPF1 in tumor cells.

8. A method for treating a tumor, comprising administering a TRIM34 inhibitor to a subject.

9. A tumor treatment drug, comprising an effective amount of a TRIM34 inhibitor and a pharmaceutical carrier.

10. A tumor treatment drug combination, comprising an effective amount of a TRIM34 inhibitor and at least one other tumor treatment drug.

Images