Preparation method and application of siRNA for reducing silkworm moth wing area

Abstract

The invention discloses a preparation method and application of siRNA (small interfering Ribonucleic Acid) for reducing silkworm moth wing area. The method comprises the following steps: extracting total RNA in a silkworm fat body, and carrying out reverse transcription to obtain first-chain cDNA; carrying out amplification by taking the silkworm Kurtz cDNA as a template to obtain silkworm Kurtz cDNA; carrying out PCR (Polymerase Chain Reaction) amplification by taking the pFLAG-BmKurtz as a template, and connecting a DNA (Deoxyribose Nucleic Acid) fragment with a vector after enzyme digestion to obtain Carrying out PCR (Polymerase Chain Reaction) amplification by taking the DNA as a template to obtain a reaction Mixing the reaction template with the mixed solution to react, and further treating to obtain BmKurtz siRNA; the BmKurtz siRNA is injected into the abdomen of pupated silkworm chrysalis, and the wing area of the pupated silkworm moth is reduced. The method is realized by regulating bombyx mori metabolism, genetic characteristics of bombyx mori are not changed, and research on substance and energy metabolism mechanisms of bombyx mori, regulation of bombyx mori physiological functions and the like is greatly promoted.

Description

Technical Field

[0001] The invention relates to the field of silkworm material energy metabolism and reproduction, and in particular to a siRNA for reducing the wing area of ​​silkworm moth, a preparation method and application thereof. Background Art

[0002] The silkworm (Bombyx mori) is the most economically resourced insect raised indoors on Earth today. It absorbs various nutrients from mulberry leaves (feed) and supplies them to various tissues and organs in the silkworm body through metabolic physiological processes for growth, development, and reproduction. The silkworm reproduces through mating and egg-laying of silk moths, and the size of the silk moth's wings has a certain impact on its mating and egg-laying.

[0003] Neuropeptides play an important role in regulating important physiological processes such as the material and energy metabolism of insects. The signaling pathways in which they function are mediated by regulatory factors. The research on regulatory factors of insect neuropeptide signaling pathways is relatively lagging. It was not until 2000 that it was first discovered in fruit flies and named Kurtz protein. In silkworms, it was found that the neuropeptide signaling pathway requires the participation of the silkworm kurtz (Bmkurtz) protein in mediation, but there is a lack of research on the role of Bmkurtz in mediating neuropeptides to regulate silkworm growth and material and energy metabolism. Summary of the invention

[0004] In order to solve the problems existing in the background technology, the purpose of the present invention is to provide a method for reducing the wing area of ​​silkworm moth, which adopts RT-PCR cloning, PCR amplification, agarose gel electrophoresis recovery, connection with mammalian expression vector pFlag-CMV-3, mixed reaction with T7 reaction buffer, ATP solution, CTP solution, GTP solution, UTP solution, and T7 enzyme solution, and then injected into the abdomen of silkworm pupae, thereby reducing the wing area of ​​silkworm moth by regulating the material and energy metabolism of silkworm.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] 1. A method for preparing siRNA for reducing the wing area of ​​silkworm moth, the method steps are as follows:

[0007] (1) Dissecting and collecting the fat bodies of fifth-instar silkworms on the 2nd to 3rd day, extracting total RNA from them, and then reverse-transcribing to obtain first-strand cDNA;

[0008] (2) using the first-strand cDNA as a template, amplifying and cloning the silkworm Kurtz cDNA (BmKurtz cDNA) by reverse transcription polymerase chain reaction (RT-PCR);

[0009] (3) using the silkworm Kurtz cDNA as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a BmKurtz DNA fragment, digesting with HindIII / BamHI, and ligating with the mammalian expression vector pFLAG-CMV-3 to obtain pFLAG-BmKurtz;

[0010] (4) using the pFLAG-BmKurtz as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a purified target pFLAG-BmKurtz DNA fragment as a reaction template;

[0011] (5) The reaction template is mixed with 10×T7 reaction buffer, ATP solution, CTP solution, GTP solution, UTP solution and T7 enzyme to react, and then subsequent treatment is performed to obtain BmKurtz siRNA as the siRNA.

[0012] The step (1) specifically comprises: dissecting and collecting the fat bodies of silkworms on the 2nd to 3rd day of the fifth instar, extracting total RNA therefrom using a Trizol kit, and then reversely transcribing the total RNA using a reverse transcription first-strand cDNA synthesis reagent to obtain first-strand cDNA; the reverse transcription conditions are: denaturation at 65° C. for 4 minutes, reaction at 42° C. for 55 minutes, and inactivation at 70° C. for 13 minutes.

[0013] The step (2) specifically comprises: using the first-chain cDNA as a template, performing reverse transcription polymerase chain reaction (RT-PCR) amplification using a forward primer such as SEQ ID NO.1 and a reverse primer such as SEQ ID NO.2, respectively, to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA); the conditions for the reverse transcription polymerase chain reaction (RT-PCR) amplification are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, and extension at 71°C for 2.2min, for 32 cycles.

[0014] In the step (3), the BmKurtz DNA fragment is obtained in the following manner: using Bombyx mori Kurtz cDNA as a template, PCR amplification is performed using a forward primer of SEQ ID NO.3 and a reverse primer of SEQ ID NO.4 to obtain the BmKurtz DNA fragment; the PCR amplification conditions are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, 32 cycles, and extension for 16min with the addition of rTaq enzyme.

[0015] The specific method used in step (4) to obtain the pFLAG-BmKurtz DNA fragment is as follows: using pFLAG-BmKurtz as a template, PCR amplification is performed using a specific primer of SEQ ID NO.5 and a specific primer of SEQ ID NO.6 respectively; the PCR amplification conditions are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, and 32 cycles to obtain the pFLAG-BmKurtz DNA fragment.

[0016] The step (5) is specifically as follows:

[0017] (5.1) Add 1.5-2 μg of reaction template and 2 μL of 10×T7 reaction buffer, 2 μL of ATP solution, 2 μL of CTP solution, 2 μL of GTP solution, 2 μL of UTP solution and 2 μL of T7 enzyme solution mixture into a test tube in sequence;

[0018] (5.2) Continue to add nuclease-free double distilled water to 20 μL and mix thoroughly, place at 37°C for 18 hours, and then cool to room temperature;

[0019] (5.3) Add 1 μL of TURBO DNA enzyme to the mixture obtained in step (5.2), mix well, and incubate at 37°C for 16 min;

[0020] (5.4) Add 30 μL of nuclease-free double distilled water, 30 μL of 7.5 M lithium chloride and 50 mM EDTA to terminate the reaction;

[0021] (5.5) Centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, and add 1 mL of 70% by mass ethanol solution for washing;

[0022] (5.6) Centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass of the ethanol supernatant, and dissolve the precipitate in nuclease-free double distilled water to obtain BmKurtz siRNA.

[0023] 2. An siRNA for reducing the wing area of ​​silkworm moth, prepared by any of the preparation methods described in steps (1) to (5) above.

[0024] 3. Application of siRNA for reducing the wing area of ​​silkworm moth:

[0025] The siRNA obtained by the above method or the siRNA is used to reduce the wing area of ​​silkworm moth.

[0026] 4. Method for using the siRNA to reduce the wing area of ​​silkworm moth:

[0027] BmKurtz siRNA was injected into the abdomen of silkworm pupae, which were then placed in an environment with a certain temperature and humidity and light during the day and dark at night for protection. The silkworm moths with reduced wing area were obtained.

[0028] The BmKurtz siRNA liquid filter membrane was sterilized, and then 16-22 μg BmKurtz siRNA was injected into the abdomen of silkworm pupae on the first day of pupation. The injected silkworm pupae were placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. The injected silkworm pupae were transformed into moths to obtain silkworm moths with reduced wing area.

[0029] A large number of experiments have confirmed that without changing the genetic characteristics of the silkworm, the wing area of ​​the silkworm on the first day of molting that adopts the technology of the present invention is reduced by about 28% compared with the wing area of ​​the silkworm on the first day of molting that does not adopt the technology of the present invention.

[0030] The present invention has the following beneficial effects:

[0031] The method of reducing the wing area of ​​silkworm moth of the present invention is achieved by regulating the metabolism of silkworm without changing the genetic characteristics of silkworm, which has a positive effect on studying the material and energy metabolism mechanism of silkworm and further improving the physiological function of silkworm. DETAILED DESCRIPTION

[0032] The present invention will be further described below in conjunction with the embodiments.

[0033] Embodiments of the present invention are as follows:

[0034] Embodiment 1:

[0035] The fat bodies of silkworms on the second day of the fifth instar were dissected and collected, and the total RNA was extracted using a Trizol kit. The total RNA was then reverse transcribed using a reverse transcription first-strand cDNA synthesis reagent. The reverse transcription conditions were: denaturation at 65°C for 4 min, reaction at 42°C for 55 min, and inactivation at 70°C for 13 min to obtain the first-strand cDNA.

[0036] The first strand cDNA was used as a template, and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using the forward primer 5'-ATGGACGACGCGGGCAGTAACAA-3' of SEQ ID NO.1 and the reverse primer 5'-TCAGGCGTC TGCGTCGGCGCCC-3' of SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA). The RT-PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0037] Using Bombyx mori Kurtz cDNA as template, PCR amplification was performed using the forward primer 5'-rCrAr GrCrGrArGrArCrUrUrArUrCrArGrUrArArArArUrCTG-3' (wherein TG is a DNA nucleotide, the same applies below) as SEQ ID NO.3 and the reverse primer 5'-rCrArGrArUrUr UrUrArCrUrGrArUrArArGrUrCrUrCrGrCrUrGrArC-3' as SEQ ID NO.4. The PCR amplification conditions were: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, 32 cycles, and further extension at 71°C for 16min with the addition of rTaq enzyme to obtain the BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis, digested with HindIII / BamHI, and ligated with the mammalian expression vector pFLAG-CMV-3 to obtain pFLAG-BmKurtz.

[0038] Using pFLAG-BmKurtz as a template, PCR amplification was performed using two specific primers 5′-rArGrArCrUrUrArUrCrArGrUrArArArArUrCrUrGrCrGrUTT-3′ (where TT is a DNA nucleotide, the same applies below) and 5′-rArArArCrGrCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrG-3′ as SEQ ID NO.5 and SEQ ID NO.6, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, to obtain the pFLAG-BmKurtz DNA fragment. The purified target DNA fragment was recovered by agarose gel electrophoresis and used as a reaction template.

[0039] 1.5 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture (the above raw materials are from TaKaRa) were added to a test tube in sequence; then, nuclease-free double distilled water was added to 20 μL, mixed thoroughly, placed at 37°C for reaction for 18 hours, and cooled to room temperature; then, 1 μL TUR BO DNA enzyme (the above raw materials are from TaKaRa) was added to the above mixture, mixed well, and incubated at 37°C for 16 minutes; then, 30 μL nuclease-free double distilled water, 30 μL 7.5M lithium chloride and 50mM EDT were added. A, terminate the reaction; then centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, add 1 mL of 70% by mass ethanol solution for washing; then centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass ethanol supernatant, and dissolve the precipitate with nuclease-free double distilled water to obtain BmKu rtz siRNA.

[0040] The obtained 16 μg BmKurtz siRNA solution was filtered and sterilized, then injected into the abdomen of silkworm pupae on the first day of pupation, and protected in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night. The wing area of ​​the silkworms on the first day of pupation was reduced by 27.4% compared with that in the control area.

[0041] Embodiment 2:

[0042] The fat bodies of fifth instar silkworms on the third day were dissected and collected, and total RNA was extracted using a Trizol kit. The total RNA was then reverse transcribed using a reverse transcription first-strand cDNA synthesis reagent. The reverse transcription conditions were: denaturation at 65°C for 4 min, reaction at 42°C for 55 min, and inactivation at 70°C for 13 min to obtain the first-strand cDNA.

[0043] The first strand cDNA was used as a template, and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using the forward primer 5'-ATGGACGACGCGGGCAGTAACAA-3' of SEQ ID NO.1 and the reverse primer 5'-TCAGGCGTC TGCGTCGGCGCCC-3' of SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA). The RT-PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0044] Using Bombyx mori Kurtz cDNA as a template, PCR amplification was performed using forward primer 5'-rCrAr GrCrGrArGrArCrUrUrArUrCrArGrUrArArArUrCTG-3' as SEQ ID NO.3 and reverse primer 5'-rCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrGrCrUrGrArC-3' as SEQ ID NO.4, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, and rTaq enzyme was added to continue extension for 16min to obtain BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis, digested with HindIII / BamHI, and ligated with mammalian expression vector pFLAG-CMV-3 to obtain pFLAG-BmKurtz.

[0045] Using pFLAG-BmKurtz as a template, PCR amplification was performed using two specific primers 5′-rArGrArCrUrUrArUrCrArGrUrArArArUrCrUrGrCrGrUTT-3′ and 5′-rArArArCrGrCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrG-3′, such as SEQ ID NO.5 and SEQ ID NO.6, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, to obtain the pFLAG-BmKurtz DNA fragment. The purified target DNA fragment was recovered by agarose gel electrophoresis and used as a reaction template.

[0046] 2.0 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture (the above raw materials are from TaKaRa) were added to a test tube in sequence; then, nuclease-free double distilled water was added to 20 μL, mixed thoroughly, placed at 37°C for reaction for 18 hours, and cooled to room temperature; then, 1 μL TUR BO DNA enzyme (the above raw materials are from TaKaRa) was added to the above mixture, mixed well, and incubated at 37°C for 16 minutes; then, 30 μL nuclease-free double distilled water, 30 μL 7.5M lithium chloride and 50mM EDT were added. A, terminate the reaction; then centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, add 1 mL of 70% by mass ethanol solution for washing; then centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass ethanol supernatant, and dissolve the precipitate with nuclease-free double distilled water to obtain BmKu rtz siRNA.

[0047] The obtained 22 μg BmKurtz siRNA solution was filtered and sterilized, then injected into the abdomen of silkworm pupae on the first day of pupation, and protected in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night. The wing area of ​​the silkworms on the first day of pupation was reduced by 28.5% compared with that in the control area.

[0048] Embodiment 3:

[0049] The fat bodies of fifth instar silkworms on the third day were dissected and collected, and total RNA was extracted using a Trizol kit. The total RNA was then reverse transcribed using a reverse transcription first-strand cDNA synthesis reagent. The reverse transcription conditions were: denaturation at 65°C for 4 min, reaction at 42°C for 55 min, and inactivation at 70°C for 13 min to obtain the first-strand cDNA.

[0050] The first strand cDNA was used as a template, and reverse transcription polymerase chain reaction (RT-PCR) amplification was performed using the forward primer 5'-ATGGACGACGCGGGCAGTAACAA-3' of SEQ ID NO.1 and the reverse primer 5'-TCAGGCGTC TGCGTCGGCGCCC-3' of SEQ ID NO.2 to clone and obtain Bombyx mori Kurtz cDNA (BmKurtz cDNA). The RT-PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and 32 cycles.

[0051] Using Bombyx mori Kurtz cDNA as a template, PCR amplification was performed using forward primer 5'-rCrAr GrCrGrArGrArCrUrUrArUrCrArGrUrArArArUrCTG-3' as SEQ ID NO.3 and reverse primer 5'-rCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrGrCrUrGrArC-3' as SEQ ID NO.4, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, and rTaq enzyme was added to continue extension for 16min to obtain BmKurtz DNA fragment. The target DNA fragment was recovered by agarose gel electrophoresis, digested with HindIII / BamHI, and ligated with mammalian expression vector pFLAG-CMV-3 to obtain pFLAG-BmKurtz.

[0052] Using pFLAG-BmKurtz as a template, PCR amplification was performed using two specific primers 5′-rArGrArCrUrUrArUrCrArGrUrArArArUrCrUrGrCrGrUTT-3′ and 5′-rArArArCrGrCrArGrArUrUrUrUrArCrUrGrArUrArArGrUrCrUrCrG-3′, such as SEQ ID NO.5 and SEQ ID NO.6, and the PCR amplification conditions were: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, 32 cycles, to obtain the pFLAG-BmKurtz DNA fragment. The purified target DNA fragment was recovered by agarose gel electrophoresis and used as a reaction template.

[0053] 1.75 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture (the above raw materials are from TaKaRa) were added to a test tube in sequence; then, nuclease-free double distilled water was added to 20 μL, mixed thoroughly, placed at 37°C for reaction for 18 hours, and cooled to room temperature; then, 1 μL TUR BO DNA enzyme (the above raw materials are from TaKaRa) was added to the above mixture, mixed well, and incubated at 37°C for 16 minutes; then, 30 μL nuclease-free double distilled water, 30 μL 7.5M lithium chloride and 50mM EDT were added. A, terminate the reaction; then centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, add 1 mL of 70% by mass ethanol solution for washing; then centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass ethanol supernatant, and dissolve the precipitate with nuclease-free double distilled water to obtain BmKu rtz siRNA.

[0054] The obtained 19 μg BmKurtz siRNA solution was filtered and sterilized, then injected into the abdomen of silkworm pupae on the first day of pupation, and protected in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night. The wing area of ​​the silkworms on the first day of pupation was reduced by 28.1% compared with that of the silkworms in the control area.

[0055] It can be seen from the above embodiments that the present invention reduces the wing area of ​​silkworms by regulating the metabolism of silkworms without changing the genetic characteristics of silkworms, and the technical effect is remarkable. This has a positive effect on studying the material and energy metabolism mechanism of silkworms and further improving the physiological functions of silkworms.

[0056] The genetic sequence involved in the present invention is as follows:

[0057] SEQ ID NO.1:

[0058] Name: Primer 1

[0059] DNA type: other DNA

[0060] Source: Synthetic Construct

[0061] ATGGACGACGCGGGCAGTAACAA

[0062] SEQ ID NO.2:

[0063] Name: Primer 2

[0064] DNA type: other DNA

[0065] Source: Synthetic Construct

[0066] TCAGGCGTCTGCGTCGGCGCCC

[0067] SEQ ID NO.3:

[0068] Name: Primer 3

[0069] RNA type: other RNA

[0070] Source: Synthetic Construct

[0071] CAGCGAGACUUAUCAGUAAAAUCTG

[0072] SEQ ID NO.4:

[0073] Name: Primer 4

[0074] RNA type: other RNA

[0075] Source: Synthetic Construct

[0076] CAGAUUUUACUGAUAAGUCUCGCUGAC

[0077] SEQ ID NO.5:

[0078] Name: Primer 5

[0079] RNA type: other RNA

[0080] Source: Synthetic Construct

[0081] AGACUUAUCAGUAAAAUCUGCGUTT

[0082] SEQ ID NO.6:

[0083] Name: Primer 6

[0084] RNA type: other RNA

[0085] Source: Synthetic Construct

[0086] AAACGCAGAUUUUACUGAUAAGUCUCG.

Claims

1. A method for preparing siRNA for reducing the wing area of ​​silkworm moth, Features The method steps are: (1) Dissecting and collecting the fat bodies of fifth-instar silkworms on the 2nd to 3rd day, extracting total RNA from them, and then reverse-transcribing to obtain first-strand cDNA; (2) using the first-strand cDNA as a template, amplifying and cloning the silkworm Kurtz cDNA by reverse transcription polymerase chain reaction; (3) using the silkworm Kurtz cDNA as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a BmKurtz DNA fragment, digesting with HindIII / BamHI, and ligating with the mammalian expression vector pFLAG-CMV-3 to obtain pFLAG-BmKurtz; (4) using the pFLAG-BmKurtz as a template, amplifying by PCR and recovering by agarose gel electrophoresis to obtain a purified target pFLAG-BmKurtz DNA fragment as a reaction template; (5) The reaction template is mixed with 10×T7 reaction buffer, ATP solution, CTP solution, GTP solution, UTP solution and T7 enzyme to react, and then subsequent treatment is performed to obtain BmKurtz siRNA as the siRNA.

2. A method for preparing siRNA for reducing the wing area of ​​silkworm moth according to claim 1, Features: The step (1) is specifically as follows: dissecting and collecting the fat bodies of silkworms on the 2nd to 3rd day of the fifth instar, extracting total RNA therefrom using a Trizol kit, and then reversely transcribing the total RNA using a reverse transcription first-strand cDNA synthesis reagent to obtain first-strand cDNA; the reverse transcription conditions are: denaturation at 65°C for 4 minutes, reaction at 42°C for 55 minutes, and inactivation at 70°C for 13 minutes.

3. The method for preparing siRNA for reducing the wing area of ​​silkworm moth according to claim 1, Features: The step (2) specifically comprises: using the first-strand cDNA as a template, performing reverse transcription polymerase chain reaction amplification using a forward primer such as SEQ ID NO.1 and a reverse primer such as SEQ ID NO.2, respectively, to clone and obtain the silkworm Kurtz cDNA; the reverse transcription polymerase chain reaction amplification conditions are: 93°C pre-denaturation for 40s, 58°C annealing for 40s, 71°C extension for 2.2min, and performing 32 cycles.

4. The method for preparing siRNA for reducing the wing area of ​​silkworm moth according to claim 1, Features: In the step (3), the BmKurtz DNA fragment is obtained in the following manner: using Bombyx mori Kurtz cDNA as a template, PCR amplification is performed using a forward primer of SEQ ID NO.3 and a reverse primer of SEQ ID NO.4 to obtain the BmKurtz DNA fragment; the PCR amplification conditions are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, 32 cycles, and extension for 16min with the addition of rTaq enzyme.

5. The method for preparing siRNA for reducing the wing area of ​​silkworm moth according to claim 1, Features: The specific method used in step (4) to obtain the pFLAG-BmKurtz DNA fragment is as follows: using pFLAG-BmKurtz as a template, PCR amplification is performed using a specific primer of SEQ ID NO.5 and a specific primer of SEQ ID NO.6 respectively; the PCR amplification conditions are: pre-denaturation at 93°C for 40s, annealing at 58°C for 40s, extension at 71°C for 2.2min, and 32 cycles to obtain the pFLAG-BmKurtz DNA fragment.

6. The method for preparing siRNA for reducing the wing area of ​​silkworm moth according to claim 1, Features: The step (5) is specifically as follows: (5.1) Add 1.5-2 μg reaction template, 2 μL 10×T7 reaction buffer, 2 μL ATP solution, 2 μL CTP solution, 2 μL GTP solution, 2 μL UTP solution and 2 μL T7 enzyme solution mixture into the test tube in sequence; (5.2) Continue to add nuclease-free double distilled water to 20 μL and mix thoroughly, place at 37°C for 18 hours, and then cool to room temperature; (5.3) Add 1 μL of TURBO DNA enzyme to the mixture obtained in step (5.2), mix well, and incubate at 37°C for 16 min; (5.4) Add 30 μL of nuclease-free double distilled water, 30 μL of 7.5 M lithium chloride and 50 mM EDTA to terminate the reaction; (5.5) Centrifuge at 15000 rpm for 16 min at 4°C, remove the supernatant, and add 1 mL of 70% by mass ethanol solution for washing; (5.6) Centrifuge at 15000 rpm for 16 min at 4°C, remove 70% by mass of the ethanol supernatant, and dissolve the precipitate in nuclease-free double distilled water to obtain BmKurtz siRNA.

7. A siRNA for reducing the wing area of ​​silkworm moth, Features: The invention is prepared by the preparation method according to any one of claims 1 to 6.

8. An application of siRNA for reducing the wing area of ​​silkworm moth, Features: The siRNA obtained by the method of claim 1 or the siRNA of claim 7 is used to reduce the wing area of ​​silkworm moth.

9. A method for reducing the wing area of ​​silkworm moth using the siRNA according to claim 8, Features: BmKurtz siRNA was injected into the abdomen of silkworm pupae, which were then placed in an environment with a certain temperature and humidity and light during the day and dark at night for protection. The silkworm moths with reduced wing area were obtained.

10. The method for using siRNA according to claim 9 to reduce the wing area of ​​silkworm moth, Features: The BmKurtz siRNA liquid filter membrane was sterilized, and then 16-22 μg BmKurtz siRNA was injected into the abdomen of silkworm pupae on the first day of pupation. The injected silkworm pupae were placed in an environment with a temperature of 24-25°C, a humidity of 70-80%, and light during the day and dark at night for protection. The injected silkworm pupae were transformed into moths to obtain silkworm moths with reduced wing area.