Free DNA bisulfite conversion kit and application thereof

Abstract

The invention provides a free DNA bisulfite conversion kit and application thereof, and belongs to the technical field of molecular biology and medical detection. The invention provides a free DNA (deoxyribonucleic acid) bisulfite conversion kit. The kit specifically comprises a CT conversion solution, a magnetic bead suspension, a DNA protective agent, a binding solution, a rinsing solution, a desulfonation solution and an eluent. The bisulfite reagent provided by the invention can effectively improve the conversion efficiency of the free DNA, shorten the conversion time and protect the integrity of the free DNA.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and medical detection, and particularly relates to a free DNA bisulfite conversion kit and application thereof. Background Art

[0002] Free DNA, also known as circulating DNA and cell-free DNA, is closely related to active cell release, cell apoptosis, and cell necrosis release. Generally speaking, the normal circulating cfDNA level in cancer patients is much higher than that in healthy people. Because as the tumor volume increases, cell turnover also increases, and the number of apoptotic and necrotic cells also increases. Compared with tissues, the detection of cfDNA has three major advantages: 1. Accessibility: cfDNA is easy to obtain and can be sampled repeatedly; 2. Comprehensiveness: It can fully reflect the heterogeneity of tumor tissue; 3. Real-time: It can dynamically monitor the status of the disease in real time (such as drug resistance), so cfDNA testing has gradually become the darling of in vitro diagnostic applications.

[0003] Methylation modification is a way for genes to achieve epigenetic regulation. It plays an important regulatory role in gene expression models and genome stability without changing the DNA sequence. Current studies have found that abnormal methylation levels of multiple genes are associated with the occurrence of cancer, such as SEPT9 methylation and the occurrence of colorectal cancer, and SHOX2 gene and RASSF1A gene methylation are closely related to the occurrence of lung cancer. By detecting the methylation levels of these cancer markers, non-invasive detection of cancer can be achieved, thereby improving the early detection rate of cancer.

[0004] There are many methods for detecting DNA methylation levels, among which the most common methods are based on DNA bisulfite conversion technology. Bisulfite treatment can convert unmethylated cytosine in DNA into uracil, while methylated cytosine remains unchanged, thereby distinguishing methylated DNA from unmethylated DNA. Analysis methods such as pyrosequencing, methylation-specific PCR, restriction endonuclease analysis, and methylation-sensitive high-resolution melting curve analysis after DNA bisulfite conversion are commonly used methods to determine DNA methylation levels and methylation sites. Therefore, the conversion efficiency, recovery rate, template quality, etc. of bisulfite-treated DNA directly affect the subsequent detection effect. In order to ensure the integrity of DNA, the traditional bisulfite conversion method has relatively mild conversion conditions and takes a long time. With the improvement of technology, the current commercialized bisulfite conversion kit can achieve rapid conversion of DNA and basically protect the integrity of genomic DNA. However, because free DNA is more easily degraded and lost than genomic DNA, there are relatively few conversion reagents for free DNA in the market. This also limits the application of research and detection of free nucleic acid methylation levels. Therefore, there is an urgent need for a method that can efficiently and quickly achieve bisulfite conversion and purification of free DNA.

[0005] In the patent application with publication number CN103205418A, a method for purifying DNA during DNA bisulfite conversion is provided, including magnetic beads, conversion solution, DNA protective agent, binding buffer, rinsing solution, sulfite group removal solution and elution solution. Among them, the conversion solution is a mixture of tetraethylammonium chloride and bisulfite at pH 5.0-6.0; the DNA protective agent is an aqueous solution of hydroquinone; the binding solution is a mixture of tris(hydroxymethyl)aminomethane and disodium ethylenediaminetetraacetate; the rinsing solution is 70%-80% ethanol; the sulfite group removal solution is an aqueous solution of sodium hydroxide; and the elution solution is nuclease-free water. This method can obtain genomic DNA conversion products of various species, but the nucleic acid yield for genomic DNA is low and the conversion result is incomplete.

[0006] In the patent application with publication number CN108130359A, a DNA methylation detection kit and its application method are provided, including a magnetic bead suspension, a CT conversion solution, an antioxidant, a binding buffer, a washing solution, a desulfonation solution and an elution solution. Among them, the magnetic bead suspension is a carboxyl magnetic bead with a particle size of 100-200nm; the CT conversion solution is a sodium bisulfite solution with a pH of 4.0-6.0; the antioxidant is an aqueous solution of 5-50mM hydroquinone; the binding solution is a mixture of guanidine hydrochloride and potassium acetate with a pH of 4.0-5.0; the washing solution is 50%-85% ethanol; the desulfonation solution is a mixture of sodium hydroxide and ethanol; and the elution solution is a mixture of tris(hydroxymethyl)aminomethane and ethylenediaminetetraacetic acid. This method can obtain a complete genomic DNA conversion product, but the conversion time is long and the nucleic acid recovery rate is not high. Summary of the invention

[0007] In order to solve the above problems, the present invention provides a free DNA bisulfite conversion kit and application thereof.

[0008] In one aspect, the present invention provides a kit for bisulfite conversion of free DNA.

[0009] Specifically, the kit comprises: (1) CT conversion reagent: 1.5-4.0 M sodium metabisulfite, 0.01-0.06 M hydroquinone; (2) DNA protectant: 30%-70% dimethylformamide solution; (3) CT reagent conditioning solution: 0.5-3.0 M sodium hydroxide solution; (4) Magnetic bead suspension: particle size 150nm-1.5μm, solid content 2.5%, surface coated with silica / ferroferric oxide coated hydroxyl microspheres; (5) Binding solution: 3.0-7.5 M guanidine hydrochloride solution; (6) Rinse solution: 40%-80% ethanol solution; (7) Desulfurization solution: a mixture of 0.3-0.7M sodium hydroxide and 20%-60% ethanol; (8) Eluent: a mixture of 0.01 M trihydroxymethane and 0.001 M ethylenediaminetetraacetic acid.

[0010] Specifically, the CT conversion reagent is stored in the form of dry powder and is prepared as needed when used.

[0011] On the other hand, the present invention provides a use of a free DNA bisulfite conversion kit in modifying DNA.

[0012] Specifically, the modification is to convert the unmethylated cytosine in the extracted free DNA sample into uracil, while the methylated cytosine remains unchanged.

[0013] In yet another aspect, the present invention provides a method for bisulfite conversion of DNA.

[0014] Specifically, the DNA bisulfite conversion method uses the free DNA bisulfite conversion kit of the present invention.

[0015] Specifically, the conversion method comprises the following steps: (1) Extracting the DNA to be tested; (2) preparing a bisulfite conversion system; (3) After the bisulfite conversion system is prepared, set the temperature change program on the PCR thermal cycler to perform bisulfite conversion.

[0016] More specifically, the DNA to be tested is free DNA.

[0017] More specifically, in step (2), the bisulfite conversion system includes X volumes of DNA sample, 20-X volumes of ddH2O, and 130 volumes of CT conversion solution.

[0018] More specifically, in step (3), the temperature change program is: 98°C, 10 min; 64°C 1 h; 4°C, 10 min.

[0019] More specifically, the transformation method further comprises a DNA purification step after bisulfite conversion.

[0020] In certain specific embodiments of the present invention, the DNA purification step comprises: (1) Add binding solution and magnetic bead suspension to the transformation solution and shake to mix; (2) Leave for 5 minutes and centrifuge briefly; (3) Place on the magnetic rack for 5 minutes, remove the waste liquid, and keep the magnetic beads for later use; (4) Add washing solution, shake and mix, centrifuge briefly, place on a magnetic stand for 3 minutes, and remove the waste liquid; (5) Add desulfurization solution, shake and mix, then place for 15 minutes, centrifuge briefly, place on a magnetic stand for 3 minutes, and remove the waste liquid; (6) Add the rinse solution and shake to mix, then centrifuge briefly and place on the magnetic rack for 3 minutes before removing the waste liquid; (7) Add the rinse solution and shake to mix, then centrifuge briefly. After 3 minutes on the magnetic stand, remove the waste liquid and centrifuge briefly to remove as much waste liquid as possible. (8) Open the lid and dry at room temperature for 10 min, add eluent to wash the magnetic beads on the tube wall to the bottom of the tube, and close the lid tightly; (9) Vortex for 5 seconds and leave at room temperature for 4 minutes; (10) Collect the transformed DNA by magnetic attraction for 1 min.

[0021] In yet another aspect, the present invention provides a PCR detection system for quantitatively detecting free DNA before and after bisulfite conversion.

[0022] Specifically, the PCR detection system is: 0.8 μL of forward primer; 0.8 μL of reverse primer; 0.4 μL of probe; 11 μL of nuclease-free plum water; 5 μL of enzyme reagent; and 2 μL of DNA template.

[0023] In certain specific embodiments of the present invention, the forward primer sequence before transformation is shown in SEQ ID NO:1; the reverse primer sequence before transformation is shown in SEQ ID NO:2; the probe sequence before transformation is shown in SEQ ID NO:3; the forward primer sequence after transformation is shown in SEQ ID NO:4; the reverse primer sequence after transformation is shown in SEQ ID NO:5; and the probe sequence after transformation is shown in SEQ ID NO:6.

[0024] In certain specific embodiments of the present invention, the probe has fluorescent groups and quenching groups at both ends. The fluorescent groups include but are not limited to: FAM, Cy5.5, Cy3, HEX, JOE or ROX; the quenching groups include but are not limited to: MGB, BHQ1, BHQ2, BHQ3.

[0025] In certain specific embodiments of the present invention, the amplification conditions of the pre-conversion PCR detection system are: S1: 95°C, 3 min; S2: 95°C, 15 sec, 56°C, 30 sec; 45 cycles; S3: Store at 4℃.

[0026] In certain specific embodiments of the present invention, the amplification conditions of the post-conversion PCR detection system are: S1: 95°C, 3 min; S2: 95°C, 15 sec, 60°C, 30 sec; 45 cycles; S3: Store at 4℃.

[0027] Compared with the prior art, the present invention has the following beneficial effects: 1. The kit provided by the present invention is suitable for the transformation of free DNA and can effectively protect the integrity of free DNA.

[0028] 2. High conversion rate: The conversion efficiency of free DNA is above 98% when the kit provided by the present invention is used to convert the free DNA; 3. Short operation time: The kit provided by the present invention is used to transform free DNA, and the entire transformation process can be completed in only 1 hour. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the quantitative standard curve of free DNA before transformation.

[0030] Figure 2 It is the quantitative standard curve of the sequence after free DNA conversion.

[0031] Figure 3 is the recovery rate of different free DNA.

[0032] Figure 4 is the transformation efficiency of different free DNA.

[0033] Figure 5 Comparison of recovery rates when using different DNA protective agents in Experimental Example 2.

[0034] Figure 6 This is a comparison of the conversion efficiency when using different DNA protectants in Experimental Example 2.

[0035] Figure 7 It is the linear detection interval of the experiment conducted in Experimental Example 3 using the components of Example 1. DETAILED DESCRIPTION

[0036] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0037] Example 1 Detection of nucleic acid products converted from component 1 1. Preparation of conversion solution: 1.1 Preparation of CT conversion reagent: (1) Use an electronic balance to weigh 5.86656 g of sodium metabisulfite and 0.0104 g of hydroquinone respectively and place them into new clean containers; (2) Use deoxygenated purified water to make up to 10 mL; (3) Vortex mix until the solids are completely thawed and then freeze for storage.

[0038] 1.2 Preparation of DNA protective agent: (1) Take 1 mL of dimethylformamide and place it in a new clean container; (2) Use deoxygenated purified water to make up to 2 mL; (3) Mix for 30 seconds and store at room temperature.

[0039] 1.3 Preparation of CT reagent adjustment solution: (1) Use an electronic balance to weigh 0.05 g of sodium hydroxide and place it in a new, clean container; (2) Use deoxygenated purified water to make up to 2 mL; (3) Vortex until the solid is completely melted and store at room temperature.

[0040] 1.4 Preparation of conversion solution: Add 500 μL DNA protectant and 2 mL CT reagent adjustment solution to 10 mL CT transformation reagent, mix and obtain transformation solution for DNA transformation.

[0041] 2. Preparation of binding solution: (1) Use an electronic balance to weigh 8.0 g of guanidine hydrochloride and place it in a new clean container; (2) Use deoxygenated purified water to make up to 10 mL; (3) Vortex until the solid is completely melted and store at room temperature.

[0042] 3. The composition of the rinse solution is as follows: (1) Take 8 mL of anhydrous ethanol and put it into a new clean preparation container; (2) Use deoxygenated purified water to make up to 10 mL; (3) Mix for 30 seconds and store at room temperature.

[0043] 4. Preparation of desulfurization solution: (1) Use an electronic balance to weigh 0.05 g of sodium hydroxide and place it in a new, clean container; (2) Use deoxygenated purified water to make up to 6 mL; (3) Vortex mixing until the solid is completely melted; (4) Add 4 mL of anhydrous ethanol, mix for 30 seconds, and store at room temperature.

[0044] 5. Preparation of eluent: (1) Use an electronic balance to weigh 0.01211 g of trihydroxyaminomethane and 0.00292 g of ethylenediaminetetraacetic acid and place them in a new clean container; (2) Add 4 mL of deoxygenated purified water and vortex until the solid is completely dissolved; (3) Use hydrochloric acid to adjust the pH to 8.0; (4) Add deoxygenated purified water to make up to 10 mL, mix for 30 seconds, and store at room temperature.

[0045] 6. Detection of transformation nucleic acid products (1) Pretreatment of biological samples: The methylation reagent provided by the present invention adopts a magnetic separation technology of specific adsorption to convert the unmethylated cytosine in the free DNA sample extracted from the plasma and other body fluids into uracil, while the methylated cytosine remains unchanged.

[0046] The free DNA extraction kit was the magnetic bead-based free DNA large-scale extraction kit (Cat. No. IVD5435) of Guangzhou Meiji Biotechnology Co., Ltd. After the extraction was completed, the extracted DNA concentration was detected.

[0047] (2) Conversion process: Prepare a bisulfite reaction system in a 200 μL PCR tube. The specific preparation system is shown in Table 1. The total system is 150 μL, of which the amount of DNA is not less than 500 pg. The amount is calculated based on the extraction concentration in step 1 and supplemented to 150 μL with nuclease-free water.

[0048] Table 1

[0049] After the reaction system is prepared, set the conversion program on the PCR instrument to perform bisulfite conversion. The program is shown in the following table: Table 2

[0050] (3) DNA purification after bisulfite treatment Take a new centrifuge tube, add 600 μL of binding solution and 20 μL of magnetic beads MA400H, transfer the conversion solution obtained by the reaction into the binding solution, and shake to mix; Incubate at room temperature for 5 min and centrifuge briefly; Place the centrifuge tube on the magnetic rack for 5 minutes, remove the waste liquid, and keep the magnetic beads for later use; Add 400 μL of washing solution, shake and mix, centrifuge briefly, place on a magnetic stand for 3 min, and remove the waste liquid; Add 200 μL of desulfurization solution and shake to mix, then place at room temperature for 15 min, centrifuge briefly, place on a magnetic stand for 3 min, and remove the waste liquid; After adding 400 μL of washing solution and shaking to mix, centrifuge briefly, place on the magnetic stand for 3 minutes, and then remove the waste liquid; Add 400 μL of washing solution and shake to mix, centrifuge briefly, remove the waste liquid after 3 minutes on the magnetic stand, and centrifuge briefly to remove as much waste liquid as possible; Open the lid and dry at room temperature for 10 minutes, add 25 μL of elution solution to the centrifuge tube, flush the magnetic beads on the tube wall to the bottom of the tube, and close the tube cap tightly; Vortex for 5 seconds and leave at room temperature for 4 minutes; collect the converted DNA by magnetic attraction for 1 minute.

[0051] The converted Bis-DNA can be stored at -20℃ for a long term.

[0052] Example 2 Component 2 1. Preparation of conversion solution: 1.1 CT conversion reagent preparation: (1) Use an electronic balance to weigh the corresponding reagents in the table above and place them into new clean containers; (2) Use deoxygenated purified water to make up to 10 mL; (3) Vortex mix until the solid is completely melted and then freeze for storage 1.2 Preparation of DNA protective agent: (1) Take 1 mL of dimethylformamide and place it in a new clean container; (2) Use an electronic balance to weigh 0.33 mg of tetraethylammonium chloride and 0.07432 g of tetraethylenepentamine pentahydrochloride and add them to a container containing dimethylformamide; (3) Use deoxygenated purified water to make up to 2 mL; (4) Vortex until the solid is completely melted and store at room temperature.

[0053] 1.3 Preparation of CT reagent adjustment solution: (1) Use an electronic balance to weigh 0.25 g of sodium hydroxide and place it in a new clean container; (2) Use deoxygenated purified water to make up to 2 mL; (3) Vortex until the solid is completely melted and store at room temperature.

[0054] 1.4 Preparation of conversion solution: Add 500 μL DNA protectant and 2 mL CT reagent adjustment solution to 10 mL CT transformation reagent, mix and obtain transformation solution for DNA transformation.

[0055] 2. Preparation of binding solution: (1) Use an electronic balance to weigh 3.8212 g of guanidine hydrochloride and 0.9814 g of potassium acetate and place them in a new clean container; (2) Use deoxygenated purified water to make up to 10 mL; (3) Vortex until the solid is completely melted and store at room temperature.

[0056] 3. Preparation of rinsing liquid: (1) Take 5 mL of anhydrous ethanol and put it into a new clean preparation container; (2) Use an electronic balance to weigh 2.3882 g of guanidine hydrochloride and place it in a container. Use deoxygenated purified water to make up to 10 mL. (3) Vortex until the solid is completely melted and store at room temperature.

[0057] 4. Preparation of desulfurization solution: (1) Use an electronic balance to weigh 0.12 g of sodium hydroxide and place it in a new, clean container; (2) Use deoxygenated purified water to make up to 2.5 mL; (3) Vortex mixing until the solid is completely melted; (4) Add 7.5 mL of anhydrous ethanol, mix for 30 seconds, and store at room temperature.

[0058] 5. Preparation of eluent: (1) Use an electronic balance to weigh 0.01211 g of trihydroxyaminomethane and place it in a new clean container; (2) Add 4 mL of deoxygenated purified water and vortex until the solid is completely dissolved; (3) Use hydrochloric acid to adjust the pH to 8.0; (4) Add deoxygenated purified water to make up to 10 mL, mix for 30 seconds, and store at room temperature.

[0059] 6. Detection of converted nucleic acid products, the steps are the same as in Example 1.

[0060] Example 3 Preparation of DNA protective agents with different ingredients 1. Preparation of DNA Protectant 1: (1) Take 1 mL of dimethylformamide and place it in a new clean container; (2) Use deoxygenated purified water to make up to 2 mL; (3) Mix for 30 seconds and store at room temperature.

[0061] 2. Preparation of DNA Protectant 2: (1) Take 1 mL of dimethylformamide and place it in a new clean container; (2) Use an electronic balance to weigh 0.33 mg of tetraethylammonium chloride and 0.07432 g of tetraethylenepentamine pentahydrochloride and add them to a container containing dimethylformamide; (3) Use deoxygenated purified water to make up to 2 mL; (4) Vortex until the solid is completely melted and store at room temperature.

[0062] 3. Preparation of DNA Protectant 3: (1) Take 1 mL of deoxygenated purified water and place it in a new clean container; (2) Use an electronic balance to weigh 0.0704 g of hydroquinone reagent and add it into the container; (3) Use deoxygenated purified water to make up to 2 mL; (4) Mix for 30 seconds and store at room temperature.

[0063] 4. Preparation of DNA Protectant 4: (1) Take 1 mL of deoxygenated purified water and place it in a new clean container; (2) Using an electronic balance, weigh 0.0704 g of hydroquinone, 0.33 mg of tetraethylammonium chloride, and 0.07432 g of tetraethylenepentamine pentahydrochloride and add them to the above container; (3) Use deoxygenated purified water to make up to 2 mL; (4) Mix for 30 seconds and store at room temperature.

[0064] 6. Detection of converted nucleic acid products: Except for the DNA protective agent, the other components and experimental steps are the same as those in Example 1.

[0065] Comparative Example 1 Free DNA conversion was performed using the EZ-96 DNA Methylation-Gold MagPrep Kit (Cat. No. D5042) from Zymo Research.

[0066] The kit includes the following components: 1. Conversion reagent: 1-2.7M sodium metabisulfite; 2. Dissolving solution: 5-50mM hydroquinone; 3. Diluent: purified water; 4. Washing solution: 50-80% ethanol; 5. Binding solution: 2-6M guanidine hydrochloride; 6. Desulfurization solution: 30% isopropanol, 30% anhydrous ethanol, 50-500mM sodium hydroxide; 7. Eluent: 5-15 mM trimethylaminomethane, 0.5-5 mM ethylenediaminetetraacetic acid; 8. Magnetic beads: 100-200nm carboxyl magnetic beads.

[0067] The transformation steps refer to the kit instructions.

[0068] Comparative Example 2 The free DNA was converted using the magnetic bead DNA bisulfite conversion kit (Cat. No. DP215-T3S1) produced by Tiangen Biochemical Technology Co., Ltd.

[0069] Its main ingredients are as follows: 1. Bisulfite dry powder-L: 5-7M sodium bisulfite, 0.6-0.9M ammonium bisulfite; 2. Buffer BML: 1-4 M sodium hydroxide; 3. Buffer DB: 100-600 mM NaOH; 4. Buffer DPL: 25-35 mM hydroquinone; 5. Buffer GDF: 6-8 M guanidine hydrochloride; 6. Magnetic bead suspension: 50 mg / mL super-smooth ferroferric oxide nanoparticles; 7. Buffer PWG: 70-80% ethanol; 8. Elution buffer TBC: nuclease-free water.

[0070] The transformation steps refer to the kit instructions.

[0071] Comparative Example 3 used the methylation detection sample pretreatment kit (Cat. No. CWY105) of Kangwei Century Biotechnology Co., Ltd. to convert free DNA.

[0072] Its main ingredients include: 1. Conversion solution: 1-3M sodium bisulfite / guanidine thiocyanate; 2. Binding solution MB: 0.5-6M guanidine thiocyanate, 10-500mM Tris-HCl, 10-50% isopropanol; 3. Rinse solution WB: 10-70% ethanol; 4. Desulfurization solution DB: 0.1-0.6M sodium hydroxide; 5. Magnetic beads: 40-60 mg / mL silica-coated super-smooth ferroferric oxide nanoparticles; 6. Eluent: 1-30 mM tris(hydroxyaminomethane); 7. Protective solution: 10-50mM hydroquinone.

[0073] The transformation steps refer to the kit instructions.

[0074] Experimental Example 1 Detection of recovery rate and conversion rate of free DNA 1. Free DNA was treated according to Example 1, Example 2, Example 3, Control Example 1, Control Example 2, and Control Example 3, respectively.

[0075] 2. Design a PCR detection system for the human β-actin encoding gene ACTB to quantify the free DNA before and after transformation. The primers used in the detection system are shown in Table 3, wherein SEQ ID NO: 1-2 are primers used for quantification of free DNA before transformation, and SEQ ID NO: 3 is the corresponding probe; SEQ ID NO: 4-5 are primers used for quantification of free DNA after transformation, and SEQ ID NO: 6 is the corresponding probe.

[0076] Table 3 SEQ ID NO: Name Sequence Modifying group 1 Actb-F-UnBis GACTGTGAACCTGTGTCTGC 2 Actb-R-UnBis CAGTTCACGGTACAAGGCTG 3 Actb-P-UnBis AACCTTCAAGGGAGGAGCAG 3'MGB, 5'FAM 4 Actb-F-Bis AACCAATAAAACCTACTCCTCCCTTAA 5 Actb-R-Bis TGGTGATGGAGGAGGTTTAGTAAGT 6 Actb-P-Bis ACCACCACCCAACACACAATAACAAACACA 3'BHQ3, 5'Cy5.5 3. Prepare the reaction system: Table 4

[0077] 4. After mixing and centrifugation, place the mixture in a fluorescent quantitative PCR instrument for reaction. Parameter settings: Table 5

[0078] 5. According to Figure 1 and Figure 2 The quantitative standard curve was used to determine the content of free DNA before and after transformation.

[0079] 6. Method for drawing a standard curve: The DNA sequence before transformation is shown in SEQ ID NO: 7, and the DNA sequence after transformation is shown in SEQ ID NO: 8. After gradient dilution, the fluorescence intensity is detected and a standard curve is drawn.

[0080] Table 6 SEQIDNO: Description Sequence 7 Before transformation AAGACGCCTGCAGCTGAAAGATACAAGGCCAGGGACAGGACAGTCCCATCCCCAGGAGGCAGGGAGTATACAGGCTGGGGAAGTTTGCCCTTGCGTGGGGTGGTGATGGAGGAGGCTCAGCAAGTCTTCTGGACTGTGAACCTGTGTCTGCCACTGTGTGCTGGGTGGTGGTCATCTTTCCCACCAGGCTGTGGCCTCTGCAACCTTCAAGGGAGGAGCAGGTCCCATTGGCTGAGCACAGCCTTGTACCGTGAACTGGAACAAGCAGCCTCCTTCCTGGCCACAGGTTCCATGTCCTTATATGGACTCATCTTTGCCTATTGCGACACACAC 8 After transformation AAGACGTTTGTAGTTGAAAGATATAAGGTTAGGGATAGGATAGTTTTATTTTTAGGAGGTAGGGAGTATATAGGTTGGGGAAGTTTGTTTTTGCGTGGGGTGGTGATGGAGGAGGTTTAGTAAGTTTTTTGGATTGTGAATTTGTGTTTGTTATTGTGTGTTGGGTGGTGGTTATTTTTTTTATTAGGTTGTGGTTTTTGTAATTTTTAAGGGAGGAGTAGGTTTTATTGGTTGAGTATAGTTTTGTATCGTGAATTGGAATAAGTAGTTTTTTTTTTGGTTATAGGTTTTATGTTTTTATATGGATTTATTTTTGTTTATTGCGATATATAT from Figure 3 - Figure 4 It can be seen that when the components in Example 1 are used, the recovery rate is the highest, the conversion efficiency is the highest, and the repeatability of the replicates is the best.

[0081] from Figure 5 - Figure 6 It can be seen that when DNA protectant 1 was used, the recovery rate and conversion efficiency were the highest.

[0082] Experimental Example 2 Linear detection range of Example 1 The free DNA was transformed using the components in Example 1, and the free DNA content after transformation was detected according to the method in Experimental Example 1. A linear detection interval was drawn according to the detection results. The linear detection interval of Example 1 is shown in Figure 7 The lower limit of Example 1 can transform as low as 500 pg of free DNA, and the upper limit test can transform no less than 100 ng of free DNA.

[0083] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A kit for bisulfite conversion of free DNA, characterized in that: The kit comprises the following components: (1) CT conversion reagent: 1.5-4.0 M sodium metabisulfite and 0.01-0.06 M hydroquinone; (2) DNA protectant: 30%-70% dimethylformamide solution; (3) CT reagent conditioning solution: 0.5-3.0 M sodium hydroxide solution; (4) Magnetic bead suspension: particle size 150nm-1.5μm, solid content 2.5%, hydroxyl microspheres coated with silicon dioxide and / or ferrosoferric oxide; (5) Binding solution: 3.0-7.5 M guanidine hydrochloride solution; (6) Rinse solution: 40%-80% ethanol solution; (7) Desulfurization solution: a mixture of 0.3-0.7M sodium hydroxide and 20%-60% ethanol; (8) Eluent: a mixture of 0.01 M trihydroxymethane and 0.001 M ethylenediaminetetraacetic acid.

2. The free DNA bisulfite conversion kit according to claim 1, characterized in that: In component (1), the CT conversion reagent is stored in the form of dry powder.

3. Use of the free DNA bisulfite conversion kit according to claim 1 in DNA conversion.

4. The use according to claim 3, characterized in that: The DNA conversion refers to converting unmethylated cytosine in the DNA to be converted into uracil.

5. A method for bisulfite conversion of DNA, characterized in that: Use the kit according to any one of claims 1 to 2.

6. The method according to claim 5, characterized in that The following steps are involved: (1) Extracting the DNA to be tested; (2) preparing a bisulfite conversion system; (3) Set up a temperature program on the PCR thermal cycler to perform bisulfite conversion.

7. The method according to claim 6, characterized in that In step (1), the DNA to be tested is free DNA.

8. The method according to claim 6, characterized in that In step (2), the bisulfite conversion system includes X volumes of DNA sample, 20-X volumes of ddH2O, and 130 volumes of CT conversion solution.

9. The method according to claim 6, characterized in that In step (3), the temperature change program is: 98°C, 10 min; 64°C 1 h; 4°C, 10 min.

10. The method according to claim 6, characterized in that The method also includes a DNA purification step after bisulfite conversion.

11. The method according to claim 10, characterized in that The DNA purification step comprises: (1) Add binding solution and magnetic bead suspension to the transformation solution and shake to mix; (2) Leave for 5 minutes and centrifuge briefly; (3) Place on the magnetic rack for 5 minutes, remove the waste liquid, and keep the magnetic beads for later use; (4) Add washing solution, shake and mix, centrifuge briefly, place on a magnetic stand for 3 minutes, and remove the waste liquid; (5) Add desulfurization solution, shake and mix, then place for 15 minutes, centrifuge briefly, place on a magnetic stand for 3 minutes, and remove the waste liquid; (6) Add the rinse solution and shake to mix, then centrifuge briefly and place on the magnetic rack for 3 minutes before removing the waste liquid; (7) Add the rinse solution and shake to mix, then centrifuge briefly. After 3 minutes on the magnetic stand, remove the waste liquid and centrifuge briefly to remove as much waste liquid as possible. (8) Open the lid and dry at room temperature for 10 min, add eluent to wash the magnetic beads on the tube wall to the bottom of the tube, and close the lid tightly; (9) Vortex for 5 seconds and leave at room temperature for 4 minutes; (10) Collect the transformed DNA by magnetic suction for 1 min.

12. A PCR detection system for quantitatively detecting free DNA before and after bisulfite conversion, characterized in that: The bisulfite conversion uses the kit described in any one of claims 1-2.

13. The PCR detection system according to claim 12, characterized in that: The PCR detection system includes: 0.8 μL of forward primer; 0.8 μL of reverse primer; 0.4 μL of probe; 11 μL of nuclease-free plum water; 5 μL of enzyme reagent; and 2 μL of DNA template.

14. The PCR detection system according to claim 13, characterized in that: The DNA template is the ACTB gene.

15. The PCR detection system according to claim 14, characterized in that: The forward primer sequence before transformation is shown as SEQ ID NO:1, the reverse primer sequence before transformation is shown as SEQ ID NO:2, the probe sequence before transformation is shown as SEQ ID NO:3, the forward primer sequence after transformation is shown as SEQ ID NO:4, the reverse primer sequence after transformation is shown as SEQ ID NO:5, and the probe sequence after transformation is shown as SEQ ID NO:

6.

16. The PCR detection system according to claim 15, characterized in that: The amplification conditions of the PCR detection system before transformation are: S1: 95°C, 3 min; S2: 95°C, 15 sec, 56°C, 30 sec; 45 cycles; S3: Store at 4℃.

17. The PCR detection system according to claim 15, characterized in that: The amplification conditions of the post-conversion PCR detection system are: S1: 95°C, 3 min; S2: 95°C, 15 sec, 60°C, 30 sec; 45 cycles; S3: Store at 4℃.

Images