Anti-PTEN RNA interference oligonucleotides and uses thereof

Abstract

The present invention provides RNA interference (RNAi) oligonucleotides that inhibit the expression of phosphatase and tensin homolog (PTEN), extracellular vesicles comprising said RNAi oligonucleotides, pharmaceutical compositions comprising said RNAi oligonucleotides or said extracellular vesicles, and uses thereof in the treatment of neurological and CNS disorders, and more particularly to their use for the treatment of spinal cord injury.

Description

Technical Field

[0001] The present invention relates to RNA interference oligonucleotides for inhibiting PTEN expression, extracellular vesicles containing the RNAi, pharmaceutical compositions containing the RNAi or the vesicles, and their use in treating neurological disorders, and more specifically, to their use in treating spinal cord injury. Background Art

[0002] Spinal cord damage may result in autonomic dysfunction, loss of sensation, or loss of mobility. Such spinal cord injuries (SCI) are caused by trauma, tumors, ischemia, developmental disorders, neurodegenerative diseases, demyelinating diseases, transverse myelitis, vascular malformations, or other causes. The consequences of SCI depend on the specific nature of the injury and its location along the spinal cord. In addition, because SCI is a dynamic process, the full extent of the injury may not be initially apparent in all acute spinal cord syndromes. Incomplete spinal cord lesions may evolve into more complete lesions; more commonly, the injury rises one or two spinal levels within a few hours to a few days after the initial event. A complex cascade of pathophysiological events explains this clinical deterioration.

[0003] The psychological and social impacts of SCI are often devastating. Some common disabling conditions associated with SCI are permanent quadriplegia, chronic pain, muscle atrophy, loss of bladder and bowel control, sexual dysfunction, and infertility.

[0004] Recent advances in neuroscience have attracted a great deal of attention to SCI research and provided significantly better treatment and rehabilitation options. For example, functional electrical stimulation (FES) has shown the potential to enhance nerve regeneration and can significantly improve recovery and functional ability after SCI. However, not all patients with spinal cord injury are eligible for FES; complete lesions of the spinal cord must be present; patients must be in a neurologically stable state; and peripheral nerves must be intact to respond to exogenous electrical stimulation.

[0005] Axonal regeneration after SCI is limited due to the extremely limited intrinsic capacity of mature neurons to grow, as well as extrinsic factors such as glial scar maturation over time and inhibitory molecules. Attempts have been made to modify extrinsic factors, but with limited success. For example, removal of extracellular inhibitory molecules, delivery of neurotrophic factors, or transplantation of permissive substances have failed to induce robust regeneration of the damaged corticospinal tract.

[0006] Phosphatase and tensin homolog (PTEN) is a highly conserved dual-specificity protein tyrosine phosphatase. The protein dephosphorylates the lipid second messengers phosphatidylinositol 3,4,5-triphosphate [PI(3,4,5)P3] and phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] to generate phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and phosphatidylinositol 4-phosphate [PI(4)P], respectively. This unique activity makes PTEN a major homeostatic regulator and tumor suppressor protein whose function is absent or defective in a wide variety of tumors due to somatic alterations. The important role of the PI3K / AKT / mTOR signaling pathway in cell growth, regeneration, and survival supports the rationale for therapeutic targeting of PTEN. Proposed therapeutic targets based on PTEN inhibition include nerve growth and regeneration after injury or damage, treatment of cardiac ischemia / reperfusion and related diseases, wound repair, and infertility (see Pulido, 2018, Molecules, 23, 285 for review). Interestingly, the main paradigm for PTEN's involvement in cancer is as a cancer suppressor, and PTEN inhibition has been shown to occur in brain metastases (Zhang et al., Nature, 2015, 527, 100–104).

[0007] PTEN is preferentially expressed in neurons of the adult brain and plays a key role in controlling the regeneration of corticospinal neurons by downregulating mammalian mTOR activity. In axotomized adult neurons, mTOR activity is severely inhibited, limiting the synthesis of new proteins required for continued axonal regeneration. Several publications have mentioned the involvement of PTEN in the inhibition of neurogenesis, while others have shown the positive effects of PTEN depletion in conditions associated with axonal damage or injury. Effective inhibition of PTEN would be one of the options to increase mTOR and thus promote neurogenesis.

[0008] WO 2009 / 117389 describes the therapeutic use of PTEN inhibitors for treating neurodegenerative disorders. WO 2015 / 066701 describes a method for regenerating nerves or reducing neurodegeneration by administering PTEN inhibitory peptides at or near damaged nerves. WO 2011 / 044701 describes specific PTEN inhibitory peptides and their use in treating diseases associated with cytotoxic stress, including diseases and injuries of the central nervous system.

[0009] There are a large number of carriers that are considered to be useful for delivering siRNA molecules, including liposomes, protein particles, micelles, and lipid particles, etc. Rungta et al. (Molecular Therapy-Nucleic Acids, 2013, 2, e136) showed that siRNA in lipid nanoparticles (LNPs) can effectively silence neuronal gene expression.

[0010] Extracellular vesicles (EVs) are membrane vesicles secreted by different types of cells. EVs are present in the blood circulation under normal physiological conditions, and their levels are elevated in various diseases such as diabetes and related vascular complications, cardiovascular diseases, hematological malignancies, and solid tumors.

[0011] EVs can be divided into three subgroups: (I) exosomes: typically have a diameter of 30-100 nm and originate from endosomal compartments; (II) microvesicles: have a diameter of 100 nm-1 μm and are released from the cell surface by "encapsulation"; and (III) apoptotic bodies: have a diameter of 1-5 μm and are released from apoptotic cells. EVs contain several elements of the parent cell, including proteins, DNA fragments, microRNAs, and mRNAs.

[0012] EP 2254586 relates to exosomes isolated from mesenchymal stem cells, the exosomes comprising at least one biological property of mesenchymal stem cells. In addition, exosomes are suggested as carriers of different drugs including small molecules and non-coding RNA (e.g., US2017 / 0247708 and Ha et al., Acta Pharmaceutica Sinica B 2016; 6(4): 287–296). Typically, siRNA is introduced into exosomes by electroporation. WO2018 / 033911 of some inventors of the present application teaches mesenchymal stem cell-derived exosomes for treating neurological disorders.

[0013] WO 2019 / 186558 discloses a pharmaceutical composition comprising membrane vesicles, including extracellular vesicles, including extracellular vesicles known as exosomes, loaded with exogenous phosphatase and tensin homolog (PTEN) inhibitors, and a method of using the extracellular vesicles to treat neurological diseases, disorders or conditions.

[0014] However, there is still an unmet need for the development of other safe, efficient, and convenient methods to treat SCI. Summary of the invention

[0015] The present invention discloses new siRNA sequences, which are superior to currently known sequences in targeting and inhibiting PTEN mRNA and reducing PTEN protein expression. The present invention relates to new compositions and methods that can regenerate and restore damaged neurons in the CNS. An example of such CNS damage is spinal cord injury (SCI). By using the siRNA molecules of the present invention, the expression of PTEN protein can be reduced, thereby restoring the regenerative capacity of neurons and the entire CNS.

[0016] In one aspect, the present invention provides an RNA interference (RNAi) oligonucleotide containing a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23 for inhibiting the expression of a phosphatase and tensin homolog (PTEN) protein. According to some embodiments, the RNAi is selected from siRNA and shRNA. Therefore, according to some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide for inhibiting the expression of PTEN, containing a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23, wherein the RNAi is selected from siRNA and shRNA. According to some embodiments, the RNAi is siRNA, and the guide strand consists of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the RNAi oligonucleotide comprises a strand complementary to the guide strand, wherein the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 24-46. According to some embodiments, the RNAi is a siRNA, and the guide strand comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2, 3, and 4. According to some embodiments, the RNAi is a siRNA, and the sense strand comprises or consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 25, 26, and 27. According to some embodiments, the RNAi oligonucleotide is a siRNA comprising a guide strand comprising or consisting of the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and a sense strand comprising or consisting of the nucleic acid sequence GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26).

[0017] According to some embodiments, the present invention provides a conjugate of an RNAi oligonucleotide as defined above. According to some embodiments, the RNAi is conjugated to a hydrophobic molecule. According to some embodiments, the hydrophobic molecule is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

[0018] According to another aspect, the present invention provides an isolated extracellular vesicle (EV) comprising an RNAi oligonucleotide capable of inhibiting PTEN expression as described herein. According to some embodiments, the isolated EV is selected from exosomes, microvesicles, and combinations thereof.

[0019] According to yet another aspect, the present invention provides a pharmaceutical composition comprising at least one RNAi oligonucleotide as defined above and / or an EV comprising the at least one RNAi oligonucleotide, and a pharmaceutically acceptable excipient and / or carrier. According to some embodiments, the pharmaceutical composition of the present invention is formulated for administration by an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral and intracerebral administration routes. According to some embodiments, the pharmaceutical composition of the present invention is used for regenerative therapy. According to some embodiments, the pharmaceutical composition of the present invention is used to treat degenerative diseases or disorders. According to some embodiments, the degenerative disease or disorder is a neurodegenerative disease, a neuronal disorder, a neuronal injury or a CNS damage in a subject. According to one embodiment, the neuronal damage or damage is a spinal cord injury (SCI). According to one embodiment, the use includes intranasal administration of the composition. According to one embodiment, the use includes topical administration of the composition.

[0020] According to another aspect, the present invention provides a method for treating a disease or condition associated with cell degeneration or death, such as a degenerative disease or condition, a neurodegenerative disease or condition, neuronal injury or damage, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the RNAi oligonucleotide, the EV and / or a pharmaceutical composition comprising the RNAi oligonucleotide and / or EV. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Some embodiments of the present invention are described herein with reference to the accompanying drawings by way of example only. With specific detailed reference now to the drawings, it should be emphasized that the details shown are only by way of example and are used for the purpose of illustrative discussion of embodiments of the present invention. In this regard, the description in conjunction with the drawings makes it clear to those skilled in the art how embodiments of the present invention may be practiced.

[0022] Figure 1 Shown is the effect of PTEN siRNA on PTEN gene expression in SH-SY5Y cells.

[0023] FIG. 2 shows the effect of siRNA_1962 on PTEN RNA ( Figure 2A ) and protein levels ( Figure 2B) (qPCR results of PTEN relative RNA levels in HEK293 cells transfected with siRNA-PTEN (20 nM, 72 hrs) compared to non-targeting control (NTC) (sample with lipofectamine containing non-targeting siRNA)). Also shown is a comparison of the effects when using a commercially available siRNA called POC and a non-targeting control (NTC) ( Figure 2C and 2D , showing different statistical calculations). In the figure: NTC - non-targeting control; POC - commercially available siRNA (see sequences in Example 1); siPTEN = NUR001 - siRNA_1962; siPTEN-chol = NUR002 - siRNA_1962 conjugated to cholesterol; siPTEN-chol-cy3 = NUR003 - siRNA_1962 conjugated to cholesterol-cy3; Figure 2E Western blots are shown. Figure 2F Densitometry analysis of PTEN protein levels in HEK293 cells transfected with siRNA_1962 (10 nM, 96 hrs) and appropriate controls is shown. As can be seen in the figure, siRNA_1962 reduced PTEN protein levels by 90%. The experiment was performed at least twice, using duplicate replicates each time. n=4. *p<0.05.

[0024] Figure 3 Shown is the effect of siRNA on the recovery of sensory responses as tested by Von Frey filaments in injured rats, several weeks after treatment.

[0025] Figure 4 Shown are the effects of siRNA on the recovery of tail and paw pinch reflexes in injured rats after 2 weeks of treatment.

[0026] Figure 5 The self-eating tendency of rats from the Exo-PTEN_chol treated group and their controls after surgery is shown in the Kaplan-Meier survival curve. The log-rank (Mantel-Cox) test with multiple comparison Bonferroni correction threshold was used for 3 comparisons (Exo-PTEN_chol treated group vs. each other group, Bonferroni correction α value = 0.166). * p value = 0.01 between Exo-PTEN_chol and PTEN_chol, ** p value = 0.0033 between Exo-PTEN_chol and control.

[0027] Figure 6 Shown are the ratios of tail area to mouth area calculated from MRI images in injured rats 10 weeks after treatment. DETAILED DESCRIPTION

[0028] Before explaining at least one embodiment of the invention in detail, it should be understood that the invention is not necessarily limited in its application to the details set forth in the following description or illustrated by the examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

[0029] According to one aspect, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the RNAi inhibits the expression of phosphatase and tensin homolog (PTEN). According to some embodiments, inhibiting expression comprises inhibiting the expression of the protein. Therefore, in some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23, wherein the RNAi inhibits the expression of phosphatase and tensin homolog (PTEN) protein. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. Therefore, according to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA, comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA, comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23, for inhibiting the expression of PTEN. According to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA, which contains a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23, for inhibiting the expression of PTEN protein. Table 1 summarizes the nucleic acid sequences of the sense and antisense sequences of the RNAi oligonucleotide of the present invention.

[0030] The terms "phosphatase and tensin homolog" and "PTEN" are used interchangeably herein and refer to the human phosphatase and tensin homolog enzyme, which is the product of EntrezGene ID: 5728 and may have an amino acid sequence composition corresponding to UniProt Accession No.: P60484. Other non-human homologs are easily identified using known methods such as BLAST searches, and they are considered to be within the scope of the present invention. The PTEN protein acts as a phosphatase, dephosphorylating phosphatidylinositol (3,4,5)-triphosphate (PtdIns (3,4,5) P3 or PIP3). PTEN specifically catalyzes the dephosphorylation of the 3' phosphate of the inositol ring in PIP3, producing the diphosphate product PIP2 (PtdIns (4,5) P2). This dephosphorylation is important because it leads to inhibition of the AKT signaling pathway.

[0031] As used herein, the term "polynucleotide" refers to a long nucleic acid comprising more than 150 nucleotides. As used herein, the term "oligonucleotide" refers to a short single-stranded or double-stranded sequence of nucleic acid such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA) or its analogs, and the nucleic acid generally has less than or equal to 150 nucleotides. According to some embodiments, the oligonucleotide is composed of 2 to 150, 10 to 100 or 14 to 50 nucleotides. According to other embodiments, the oligonucleotide is composed of 14 to 40, 17 to 35 or 18 to 30 nucleotides.

[0032] The term "RNA silencing" as used herein refers to a group of regulatory mechanisms mediated by RNA molecules (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), repression, co-suppression, and translational repression), which result in the inhibition or "silencing" of the expression of the corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

[0033] The terms "RNA silencing agent", "RNA silencing molecule" and "RNA silencing oligonucleotide" as used herein are used interchangeably herein and refer to RNA that can inhibit or "silence" the expression of a target gene. In certain embodiments, the RNA silencing agent can prevent the complete processing (e.g., complete translation and / or expression) of mRNA molecules by a post-transcriptional silencing mechanism, such as by RNA interference degradation of mRNA. RNA silencing agents include non-coding RNA molecules, such as RNA duplexes comprising paired chains, and precursor RNAs that can produce such small non-coding RNAs. Exemplary RNA silencing agents (also referred to as RNA interference oligonucleotides) include dsRNA, such as siRNA, miRNA and shRNA. In one embodiment, the RNA silencing agent can induce RNA interference. In another embodiment, the RNA silencing agent can mediate translation repression.

[0034] The term "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by RNA interference oligonucleotides (e.g., short interfering RNA (siRNA) and shRNA) in animals. The corresponding process in plants is generally referred to as post-transcriptional gene silencing or RNA silencing, and is also referred to as repression in fungi. The process of post-transcriptional gene silencing is considered to be an evolutionarily conservative cellular defense mechanism for preventing the expression of foreign genes, and is generally shared by a variety of flora and phyla. This protection against foreign gene expression may be a response to the production of double-stranded RNA (dsRNA) caused by viral infection or random integration of transposon elements in the host genome, and evolved by specifically destroying cellular responses to homologous single-stranded RNA or viral genomic RNA.

[0035] The presence of long dsRNA in cells stimulates the activity of ribonuclease III enzyme (known as dicer). Dicer participates in processing dsRNA into short fragments of dsRNA known as short interfering RNA (siRNA). The length of the short interfering RNA derived from dicer activity is generally about 21 to about 23 nucleotides, and comprises a duplex of about 19 base pairs. The RNAi response also has the characteristics of an endonuclease complex, commonly referred to as RNA-induced silencing complex (RISC), which mediates the cutting of a single-stranded RNA whose sequence is complementary to the antisense strand of the siRNA duplex. The cutting of the target RNA occurs in the middle of a region complementary to the antisense strand of the siRNA duplex.

[0036] The terms "small interfering RNA" and "siRNA" refer to small inhibitory RNA duplexes (usually between 18-30 base pairs) that induce RNA interference (RNAi) pathways. Typically, siRNA is chemically synthesized in the form of 21mers, with a central 19bp duplex region and symmetrical 2 base 3'-protrusions on the ends, although it has recently been documented that the effectiveness of chemically synthesized 25-30 base-long RNA duplexes can be increased by up to 100 times compared to 21mers at the same position. In theory, the increased effectiveness observed when triggering RNAi using longer RNAs is due to providing a substrate (27mer) instead of a product (21mer) for Dicer, which increases the rate or efficiency of the siRNA duplexes entering RISC.

[0037] It has been found that the position of the 3'-overhang affects the potency of siRNA, and asymmetric duplexes with a 3'-overhang on the antisense strand are generally more effective than duplexes with a 3'-overhang on the sense strand. This can be attributed to asymmetric strand loading in RISC, as the opposite pattern of efficacy was observed when targeting antisense transcripts.

[0038] According to some embodiments, the RNAi is siRNA. According to some embodiments, the siRNA that inhibits PTEN expression contains a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the siRNA contains a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23.

[0039] The terms "guide strand," "guide strand oligonucleotide," and "antisense strand" are used interchangeably herein and refer to the strand of a siRNA or shRNA that is complementary to a sequence within an mRNA molecule.

[0040] As used herein, the term "inhibiting the expression of PTEN" has the meaning of inhibiting the expression of PTEN gene and inhibiting the production of PTEN protein.

[0041] According to other embodiments, the RNAi is a shRNA. According to some embodiments, the shRNA that inhibits PTEN expression comprises a nucleic acid sequence selected from SEQ ID NOs: 1-23.

[0042] The terms "small hairpin RNA" and "shRNA" as used herein refer to RNA agents with a stem-loop structure known in the art, which comprise a first and a second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient to allow base pairing between the regions, the first and second regions being linked by a loop region, the loop being caused by a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is a number between 3 and 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11 (inclusive). Some nucleotides in the loop may participate in base pair interactions with other nucleotides in the loop. Typically, the shRNA molecule has less than about 400 to 500 nucleotides (nt), or less than 100 to 200 nt, wherein at least one segment of at least 14 to 100 nucleotides (e.g., 17 to 50 nt, 19 to 29 nt) is base paired with a complementary sequence located on the same RNA molecule (single RNA strand), and wherein the sequence and the complementary sequence are separated by an unpaired region of at least about 4 to 7 nucleotides (or about 9 to about 15 nt, about 15 to about 100 nt, about 100 to about 1000 nt), which forms a single-stranded loop above the stem structure generated by the two base complementary regions.

[0043] According to some embodiments, the RNAi oligonucleotide, such as siRNA or shRNA, is not natural, ie, does not exist in nature, and is artificially designed, modified and / or manufactured.

[0044] According to some embodiments, the RNAi oligonucleotide of the present invention, such as siRNA or shRNA, comprises a sense strand, i.e., a strand complementary to a guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the sense strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand consists of 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand consists of 14, 15, 16, 17, 18 or 19 consecutive nucleotides and is complementary to 14, 15, 16, 17, 18 or 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 24-46.

[0045] According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is a siRNA containing a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is a siRNA containing a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is a siRNA containing a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the siRNA comprises a guide strand comprising the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) or consisting of the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3). According to some embodiments, the siRNA comprises a guide strand comprising the nucleic acid sequence UUCCGCCACUGAACAUUGGAA (SEQ ID NO: 2) or consisting of the nucleic acid sequence UUCCGCCACUGAACAUUGGAA (SEQ ID NO: 2). According to some embodiments, the siRNA comprises a guide strand comprising the nucleic acid sequence AAGUUCCGCCACUGAACAUUG (SEQ ID NO: 4) or consisting of the nucleic acid sequence AAGUUCCGCCACUGAACAUUG (SEQ ID NO: 4). According to some embodiments, the siRNA comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 2-4 or consisting of a nucleic acid sequence selected from SEQ ID NOs: 2-4. According to some embodiments, the siRNA comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5 or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to another embodiment, the siRNA that inhibits PTEN expression comprises a sense strand complementary to the guide strand and comprises a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to another embodiment, the siRNA that inhibits PTEN expression comprises a sense strand complementary to the guide strand and consists of a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to another embodiment, the siRNA that inhibits PTEN expression comprises a sense strand complementary to the guide strand, and comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 25-27.According to some embodiments, the siRNA for inhibiting PTEN expression comprises a pair of oligonucleotides comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NOs: 17 and 40; (xviii) SEQ ID NOs: 18 and 41; (xix) SEQ ID NOs: 19 and 42; (xx) SEQ ID NOs: 20 and 43; (xxi) SEQ ID NOs: 21 and 44; (xxii) SEQ ID NOs: 22 and 45; or (xxiii) SEQ ID NOs: 23 and 46.

[0046] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 24. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 24.

[0047] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. In some examples, the siRNA is referred to as siRNA_1455.

[0048] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26). According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26). In some examples, the siRNA is referred to as siRNA_1962.

[0049] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. In some examples, the siRNA is referred to as siRNA_1458.

[0050] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 5 and SEQ ID NO: 28. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 5 and SEQ ID NO: 28. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 6 and SEQ ID NO: 29. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 7 and SEQ ID NO: 30. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 8 and SEQ ID NO: 31. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 9 and SEQ ID NO: 32, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 10 and 33, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 11 and 34, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 12 and 35, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 13 and 36, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NOs: 14 and 37. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NOs: 15 and 38.According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of nucleic acid sequences SEQ ID NOs: 16 and 39, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of nucleic acid sequences SEQ ID NOs: 17 and 40, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of nucleic acid sequences SEQ ID NOs: 18 and 41, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of nucleic acid sequences SEQ ID NOs: 19 and 42, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which comprise or consist of nucleic acid sequences SEQ ID NOs: 20 and 43, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NOs: 21 and 44. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NOs: 22 and 45. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NOs: 23 and 46.

[0051] According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is a shRNA containing a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is a shRNA containing a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the shRNA that inhibits PTEN expression contains a sense complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to another embodiment, the shRNA that inhibits PTEN expression contains a sense strand that is complementary to the guide strand and consists of a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the shRNA that inhibits PTEN expression comprises a pair of oligonucleotides, which comprise or consist of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the pair of sense and antisense sequences is as described for siRNA. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 24. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 24.

[0052] According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25.

[0053] According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26.

[0054] According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively comprise the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand, which respectively consist of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27.

[0055] According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a portion for improving at least one property such as solubility, permeability, loading capacity, stability, blood circulation period, or for targeting the RNAi oligonucleotide to a specific site. In some embodiments, the portion is heterologous and / or exogenous. The term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) that is not normally present in a cell, or the combination or coupling is not present in a cell. Therefore, according to some embodiments, the present invention provides a conjugate of the RNAi oligonucleotide of the present invention. According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a hydrophilic portion. According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a hydrophobic portion. Therefore, according to some embodiments, the siRNA or shRNA oligonucleotide of the present invention is coupled to a hydrophobic molecule. According to some embodiments, the hydrophobic molecule is bound to the guide strand. According to some embodiments, the hydrophobic molecule is bound to the complementary (sense) strand. According to some embodiments, the portion is a load portion. The term "load portion" refers to a portion that allows or enhances the loading of a molecule in a carrier entity (e.g., an extracellular vesicle (EV) or a liposome).

[0056] According to one embodiment, the hydrophobic part is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the RNA interference oligonucleotide is coupled to sterols. In an exemplary embodiment, the part is a sterol cholesterol molecule, so according to such embodiments, the RNA interference oligonucleotide is coupled to cholesterol. According to some embodiments, one chain of the double-stranded RNAi is coupled to a hydrophobic molecule such as cholesterol. According to other embodiments, the two chains of the double-stranded RNAi are coupled to a hydrophobic molecule such as cholesterol. According to other embodiments, the RNA interference oligonucleotide is coupled to a molecule selected from monosialic acid tetrahexosyl ganglioside (GM1), lipids, vitamins, small molecules, peptides or a combination thereof. In some embodiments, the part is a lipid. For example, in certain embodiments, the part is a palmitoyl group. In some embodiments, the part is a sterol, such as cholesterol. Other hydrophobic parts include, for example, phospholipids, vitamin D, vitamin E, squalene and fatty acids. In another exemplary embodiment, the RNAi oligonucleotide is coupled to myristic acid or a derivative thereof (e.g., a myristoylated oligonucleotide cargo). In some embodiments, the hydrophobic portion is coupled to the end of the oligonucleotide cargo (i.e., "terminal modification"). In other embodiments, the hydrophobic portion is coupled to other portions of the oligonucleotide molecule.

[0057] According to some embodiments, the RNAi oligonucleotide of the invention is conjugated to a hydrophobic moiety selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

[0058] According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the cholesterol is coupled to the guide strand of the siRNA. According to other embodiments, the cholesterol is coupled to the complementary strand of the siRNA. According to some embodiments, the cholesterol is coupled to the shRNA. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25, and is coupled to a cholesterol molecule. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26, and is coupled to a cholesterol molecule. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27, and is coupled to a cholesterol molecule. According to some embodiments, the cholesterol is coupled to the 5' of the oligonucleotide. According to some embodiments, the cholesterol is coupled to the 3' of the oligonucleotide.

[0059] According to another aspect, the invention provides a composition comprising the RNAi oligonucleotide of the present invention and a carrier. Any of the above definitions, terms and embodiments are also included in this article and are applicable. The term "carrier" as used herein refers to any compound or composition that can be used to promote the storage, stability, administration, cell targeting and / or delivery of the topical composition, including but not limited to suitable carriers, skin conditioners, skin protectants, diluents, emollients, solvents, excipients, pH regulators, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, defoamers, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, monoglycerides, diglycerides and triesters and derivatives thereof, waxes, oils and water.

[0060] According to some embodiments, the composition is a pharmaceutical composition, and the carrier is a pharmaceutically acceptable carrier. Therefore, according to some embodiments, the present invention provides a pharmaceutical composition comprising a plurality of siRNA and / or shRNA of the present invention as defined above, and a pharmaceutically acceptable carrier. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25 or consist of the nucleic acid sequences, and are optionally coupled to a cholesterol molecule. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26 or consist of the nucleic acid sequences, and are optionally coupled to a cholesterol molecule. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27 or consist of the nucleic acid sequences, and are optionally coupled to a cholesterol molecule.

[0061] According to another aspect, the present invention provides an isolated extracellular vesicle (EV), which comprises an RNA interference (RNAi) oligonucleotide for inhibiting the expression of a PTEN protein as described in any of the above aspects and embodiments. All terms, embodiments and definitions disclosed in any of the above aspects are also applicable and included herein. According to some embodiments, the RNAi oligonucleotide is loaded onto / in the EV. Therefore, according to some embodiments, the present invention provides an isolated extracellular vesicle (EV), which is loaded with an RNA interference (RNAi) oligonucleotide for inhibiting the expression of PTEN. According to some embodiments, the present invention provides an EV comprising an RNAi oligonucleotide for inhibiting the expression of PTEN.

[0062] According to some embodiments, the RNAi oligonucleotide is exogenous. The term "exogenous" as used herein refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) that originates from the outside of a given membrane vesicle (e.g., EV) and does not naturally occur in the vesicle. With respect to EV, the term refers to a molecule or substance that is not naturally present in the vesicle, nor is it naturally present in the cell from which the EV is derived. According to some embodiments, the term "exogenous" refers to a synthetic non-natural molecule. According to some embodiments, the substance is artificially loaded into the EV or the cell from which the EV is derived. With respect to peptides, proteins, and nucleic acids, the term means that the compound is artificially loaded into the cell from which the EV or the vesicle is derived, or is artificially expressed in the cell from which the vesicle is derived, however, the compound is not naturally expressed in the parent cell.

[0063] The terms "extracellular vesicle" and "EV" are used interchangeably herein and refer to cell-derived vesicles that contain a membrane surrounding an internal space. Typically, EVs have a diameter in the range of 30nm to 1500nm, more typically 40nm to 1200nm, and may contain various cargo molecules within the internal space, displayed on the outer surface of the extracellular vesicle and / or across the membrane. The cargo molecules may include nucleic acids, proteins, carbohydrates, lipids, small molecules and / or combinations thereof. EVs can be divided into three subgroups: (I) exosomes: 30-150nm in diameter, derived from endosomal compartments; (II) microvesicles: 100nm-1μm in diameter, released from the cell surface by "encapsulation"; and (III) apoptotic bodies: 1-5μm in diameter, released from apoptotic cells. The term EV also includes the terms "exosomes" and "microvesicles". The terms "exosomes" and "nanovesicles" are used interchangeably herein and refer to EVs with a size between 30 and 150nm in diameter. In some references, exosomes refer to EVs with a diameter between 30 and 100 nm. As used herein, the term "microvesicle" refers to EVs with a diameter between 150 and 1000 nm. Typically, EVs may contain at least a portion of the molecular contents of the cell from which they are derived, such as lipids, fatty acids, polypeptides, polynucleotides, proteins, and / or sugars.

[0064] The EVs of the present invention are mostly spherical, and the terms "size", "particle size", "average particle size" and "particle size" used herein refer interchangeably to the diameter of the EV or the longer diameter of the EV. Any known particle size measurement method can be used to determine the size of the EVs of the present invention. A non-limiting example is nanoparticle tracking analysis (NTA).

[0065] According to some embodiments, the isolated EV is an exosome. According to one embodiment, the exosome has a diameter of 30 to 150 nm, 40 to 120 nm, 50 to 100 nm, 30 to 100 nm, 30 nm to 80 nm, or 60 nm to 80 nm.

[0066] According to another embodiment, the EV is a microvesicle. According to one embodiment, the microvesicle has a diameter of 100 to 1000 nm, 120 to 800 nm, 150 to 600 nm, or 200 to 400 nm. According to another embodiment, the microvesicle has a size of 100 to 300 nm or 150 to 250 nm.

[0067] According to some embodiments, the EV has a diameter of 30 to 250 nm or 50 to 200 nm. According to some embodiments, the EV has a diameter of 70 to 170 nm or 80 to 150 nm.

[0068] The EV may have a range of sizes, for example, between 2nm and 20nm, 2nm and 50nm, 2nm and 100nm, 2nm and 150nm, or 2nm and 200nm. The EV may have a size between 20nm and 50nm, 20nm and 100nm, 20nm and 150nm, or 20nm and 200nm. The EV may have a size between 50nm and 100nm, 50nm and 150nm, or 50nm and 200nm. The EV may have a size between 100nm and 150nm, or 100nm and 200nm. The EV may have a size between 150nm and 200nm. The EV may have a size between 100nm and 600nm, 150nm and 500nm, or 200nm and 400nm.

[0069] The size can be determined by various means. In principle, the size can be determined by size fractionation and filtration through membranes with a relevant size cut-off.

[0070] According to another embodiment, the isolated EVs are a combination of small vesicles and large vesicles, such as a combination of microvesicles and exosomes.

[0071] As described above, the EV is derived from a cell. The terms "derived from" and "originated from" are used interchangeably herein and refer to a vesicle within, produced by, or produced from a specific cell, cell type, or cell population. The terms "maternal cell," "producer cell," and "original cell" used herein include any cell from which extracellular vesicles are derived and isolated. The terms also encompass cells that share the protein, lipid, sugar, or nucleic acid components of the extracellular vesicle. For example, "maternal cell" or "producer cell" includes cells that are a source of extracellular vesicles. According to some embodiments, the cell is a eukaryotic cell.

[0072] The EV can be derived from a biological cell by any of a variety of ways, such as by secretion, budding or diffusion from the biological cell. The EV may be a substance that can be separated from a mesenchymal stem cell (MSC), a neural crest cell (NCC), a mesenchymal stem cell conditioned medium (MSC-CM) or a neural crest cell conditioned medium. The EV may be responsible for or at least have the activity of a maternal cell such as MSC, NCC, NCC-CM or MSC-CM. The EV may be responsible for and perform most or all of the functions of the activity of a maternal cell such as MSC, NCC, NCC-CM or MSC-CM. For example, the EV may be a substitute (or biological substitute) for MSC, NCC, NCC-CM or MSC-CM. For example, the EV may be produced, exuded, released or shed from the biological cell. When the biological cell is in cell culture, the particle may be secreted into the cell culture medium.

[0073] Examples of biological cells from which EVs can be derived include adherent cells expressing mesenchymal markers, such as mesenchymal stem cells, oral mucosal stem cells or olfactory sheathing cells, astrocytes and neural crest cells. Therefore, according to some embodiments, the present invention provides a pharmaceutical composition comprising EVs loaded with exogenous PTEN inhibitors, wherein the EVs are derived from adherent cells expressing mesenchymal markers. According to one embodiment, the adherent cells expressing mesenchymal markers are selected from mesenchymal stem cells (MSCs), oral mucosal stem cells and olfactory sheathing cells. According to one embodiment, the cells are mesenchymal stem cells (MSCs).

[0074] The term "mesenchymal stem cells" refers to multipotent stromal cells that can differentiate into various cell types known in the art, including osteoblasts (bone cells), chondrocytes (cartilage cells), myocytes (muscle cells), and adipocytes (fat cells).

[0075] In the pluripotent state, mesenchymal stem cells typically express the following markers: CD105, CD166, CD29, CD90, and CD73, and do not express CD34, CD45, and CD133.

[0076] Mesenchymal stem cells can be isolated from various tissues, including but not limited to bone marrow, adipose tissue, dental pulp, oral mucosa, peripheral blood and amniotic fluid. According to one embodiment, the mesenchymal stem cells are isolated from bone marrow. According to one embodiment, the mesenchymal stem cells are derived from a site selected from bone marrow, adipose tissue, umbilical cord, dental pulp, oral mucosa, peripheral blood and amniotic fluid. According to some embodiments, the EV is derived from MSC derived from bone marrow. According to other embodiments, the EV is derived from MSC derived from adipose tissue. According to some such embodiments, the EV is selected from exosomes, microvesicles and combinations thereof. According to some embodiments, the cells express CD105, CD166, CD29, CD90 and CD73 markers. According to another embodiment, the cells express CD105, CD166, CD29, CD90 and CD73, and do not express CD34, CD45 and CD133. According to some embodiments, the cells are selected from dental pulp stem cells (DPSCs), exfoliated deciduous tooth stem cells (SHEDs), periodontal ligament stem cells (PDLSCs), apical papilla stem cells (SCAPs), and dental follicle progenitor cells (DFPCs).

[0077] According to some such embodiments, the EV comprises or expresses at least a portion of the markers expressed by the cell from which the EV is derived.

[0078] The EV may comprise one or more proteins, oligonucleotides or polynucleotides secreted by a specific cell type (e.g., mesenchymal stem cells or neural crest cells). The EV may comprise one or more proteins or polynucleotides present in a mesenchymal stem cell conditioned medium (MSC-CM). In a specific embodiment, the EV may comprise miRNA derived from MSC or neural crest cells. For example, the EV may comprise 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more or 70% or more of these proteins and / or polynucleotides. The EV may substantially comprise about 75% of these proteins and / or polynucleotides. The protein may be defined by reference to a protein list or a gene product of a gene list.

[0079] The EV may have at least one property of a mesenchymal stem cell. The particle may have a biological property, such as a biological activity. The particle may have any biological activity of a MSC. The particle may, for example, have a therapeutic or restorative activity of a MSC.

[0080] Methods for isolating, purifying and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, those disclosed by Caplan and Haynesworth in U.S. Pat. No. 5,486,359 and Jones EA et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0081] Mesenchymal stem cell culture can be by diluting BM aspirate (usually 20ml) with an equal volume of Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand Island, NY, USA), and layering the diluted cells on a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, NJ, USA) of about 10ml to produce. After centrifugation at 2500x g for 30 minutes, the mononuclear cell layer is removed from the interface and suspended in HBSS. The cells are then centrifuged at 1500x g for 15 minutes and resuspended in complete medium (MEM, a medium without deoxyribonucleotides or ribonucleotides; GIBCO), 20% fetal calf serum (FCS) (derived from a batch selected for the rapid growth of MSC (Atlanta Biologicals, Norcross, GA)), 100 units / ml penicillin (GIBCO), 100 μg / ml streptomycin (GIBCO) and 2mM L-glutamine (GIBCO). The resuspended cells were plated in about 25 ml of culture medium in 10 cm culture dishes (Corning Glass Works, Corning, NY) and incubated at 37°C and 5% humidified CO2. After 24 hours of culture, non-adherent cells were discarded and adherent cells were thoroughly washed twice with phosphate buffered saline (PBS). The culture medium was replaced with fresh complete culture medium every 3 or 4 days for about 14 days. The adherent cells were then harvested with 0.25% trypsin and 1 mM EDTA (trypsin / EDTA, GIBCO) at 37°C for 5 min, re-plated in 6 cm plates, and cultured for another 14 days. The cells were then trypsinized and counted using a cell counting device such as a hemocytometer (Hausser Scientific, Horsham, PA). The cultured cells were recovered by centrifugation and 1 to 2X 10 per ml with 5% DMSO and 30% FCS. 6Aliquots of approximately 1 ml were slowly frozen and stored in liquid nitrogen.

[0082] To expand the mesenchymal stem cell fraction, the frozen cells were thawed at 37°C, diluted with complete medium, and recovered by centrifugation to remove DMSO. The cells were resuspended in complete medium and plated at approximately 5000 cells / cm 2 After 24 hours in culture, non-adherent cells are removed and adherent cells are harvested using trypsin / EDTA, dissociated by narrow Pasteur pipettes, and preferably plated at a density of about 1.5 to about 3.0 cells / cm 2 Under these conditions, MSC cultures can grow for about 50 population doublings and expand about 2000-fold (Colter DC. et al., Proc Natl Acad Sci USA. 97: 3213-3218, 2000).

[0083] The MSC cultures used in some embodiments of the present invention include three groups of cells defined by their morphological characteristics: small agranular cells (hereinafter referred to as RS-1), small granular cells (hereinafter referred to as RS-2), and large medium granular cells (hereinafter referred to as mature MSCs). The presence and concentration of such cells in the culture can be determined by using, for example, immunofluorescence, in situ hybridization, and activity assays to identify the presence or absence of various cell surface markers.

[0084] According to a specific embodiment, the EV is derived from a cell expressing a marker from a neural crest cell. According to a specific embodiment, the EV is derived from a neural crest cell. According to another embodiment, the neural crest cell is a cranial neural crest cell. According to some embodiments, the cranial neural crest cells include but are not limited to dental pulp stem cells (DPSCs), shedding deciduous tooth stem cells (SHEDs), periodontal ligament stem cells (PDLSCs), apical papilla stem cells (SCAPs) and dental follicle progenitor cells (DFPCs). According to some embodiments, such cells express mesenchymal markers as defined above.

[0085] The EVs can be generated or isolated in several ways. Such methods may include isolating the EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0086] Therefore, the EVs of the present invention are isolated EVs.

[0087] The terms "purified", "purified", "isolated" and "isolated" are used interchangeably herein and refer to the state of a population of EVs (e.g., a plurality of known or unknown amounts and / or concentrations of EVs) that has undergone one or more purification / isolation processes, such as selection of desired EVs, or removal or reduction of residual biological products and / or removal of unwanted EVs, such as removal of EVs of a particular size. According to one embodiment, the ratio of EVs to residual maternal cells is at least 2, 3, 4, 5, 6, 8 or 10 times higher than that of the starting material, or in certain advantageous embodiments at least 50, 100, 1000 or 2000 times higher. According to some embodiments, the ratio is a weight ratio. In some advantageous embodiments, the term "isolated" has the meaning of being substantially cell-free or cell-free, and can be replaced by it.

[0088] According to some embodiments, the EVs, e.g., exosomes, are derived from adherent cells expressing mesenchymal markers. According to some embodiments, the adherent cells expressing mesenchymal markers are selected from mesenchymal stem cells (MSCs) and olfactory ensheathing cells.

[0089] The EVs can be generated or isolated in several ways. Such methods may include isolating the EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0090] According to some embodiments, the present invention provides an isolated EV loaded with an RNA interference (RNAi) oligonucleotide that inhibits PTEN expression as described in any one of the above embodiments and aspects. According to some embodiments, the loading can be performed according to any known method. According to some embodiments, the loading is performed ex vivo. According to some embodiments, the RNAi oligonucleotide is as defined in any one of the above embodiments. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits PTEN expression contains a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the siRNA or shRNA contains a guide strand consisting of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the siRNA comprises a sense (complementary) strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 24-46. According to one embodiment, the siRNA or siRNA is coupled to a hydrophobic portion. According to some embodiments, the hydrophobic portion is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the siRNA or shRNA is coupled to a sterol. In an exemplary embodiment, the portion is a sterol cholesterol molecule, and thus according to such embodiments, the siRNA or shRNA is coupled to cholesterol.

[0091] According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is siRNA. According to some embodiments, the present invention provides an isolated EV comprising a siRNA that inhibits PTEN expression, wherein the siRNA comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the siRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the siRNA for inhibiting PTEN expression comprises a pair of oligonucleotides comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the siRNA is conjugated to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EVs are derived from mesenchymal stem cells. According to some embodiments, the EVs are derived from bone marrow mesenchymal stem cells.According to some embodiments, the EVs are exosomes.

[0092] According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is shRNA. According to some embodiments, the present invention provides an isolated EV loaded with shRNA that inhibits PTEN expression, the shRNA containing a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23 or consisting of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to another embodiment, the shRNA contains a complementary strand comprising a nucleic acid sequence selected from SEQ ID NO: 24-46. According to some embodiments, the shRNA that inhibits PTEN expression comprises a pair of oligonucleotides, which comprise or consist of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the shRNA is conjugated to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EVs are derived from mesenchymal stem cells.According to some embodiments, the EVs are derived from bone marrow mesenchymal stem cells.

[0093] The siRNA and shRNA molecules promote sequence-specific degradation of mRNA to achieve inhibition of expression of a desired protein gene (e.g., PTEN), or a reduction in the expression level of the PTEN gene, such as a 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5% reduction.

[0094] According to some embodiments, the EV of the present invention comprises chondroitinase ABC (chABC enzyme) or a nucleic acid encoding the enzyme.

[0095] Mesenchymal stem cell EVs can be produced by culturing mesenchymal stem cells in a culture medium to modulate it. The culture medium may include DMEM. The DMEM may not contain phenol red. The culture medium may be supplemented with insulin, transferrin or selenoprotein (ITS) or any combination thereof. It may contain FGF2. It may contain PDGF AB. The concentration of FGF2 may be about 5ng / ml FGF2. The concentration of PDGF AB may be about 5ng / ml. The culture medium may contain glutamine-penicillin-streptomycin or mercaptoethanol or any combination thereof.

[0096] The cells can be cultured for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or longer, for example 3 days. The modulated culture medium can be obtained by separating the cells from the culture medium. The modulated culture medium can be centrifuged, for example, at 500 g. It can be concentrated by membrane filtration. The membrane can include a membrane of >1000 kDa. The conditioned medium can be concentrated by about 50 times or more.

[0097] It should be understood that polynucleotides or oligonucleotides such as siRNA or shRNA can also be directly loaded into the EV. In one embodiment, the RNAi oligonucleotide is directly loaded into the EV by electroporation and / or using a transfection agent reagent. In an alternative embodiment, the loading is performed without electroporation and / or without a transfection agent.

[0098] According to one embodiment, the EV is incubated with the RNAi oligonucleotide inhibitor for a period of time sufficient to allow the particle to be loaded with the nucleic acid-based inhibitor. The duration sufficient to allow the EV to be loaded with the nucleic acid-based inhibitor can be optimized for a specific type of cargo, and if modified to include a hydrophobic modification, it can be optimized for the type of modification. Typically, an incubation of about 1 hour or less is sufficient to allow particles to efficiently load nucleic acid cargo. In many cases, hydrophobic modified cargo is efficiently loaded into exosomes in a very fast time, such as within 5 minutes. Therefore, in some embodiments, efficient loading occurs within an incubation period of 5 minutes or less, such as 1-5 minutes. In an exemplary embodiment, efficient loading occurs within an incubation period of 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, etc. In other embodiments, efficient loading may occur within 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 12 hours, 24 hours, etc.

[0099] Loading EVs with oligonucleotides is not highly temperature dependent. In an exemplary embodiment, exosomes are loaded at or about 37°C. In other embodiments, EVs (e.g., exosomes) can be loaded at or about room temperature. In other embodiments, exosomes can be loaded at or about 4°C.

[0100] According to some embodiments, the EV can be loaded without ultracentrifugation. According to other embodiments, the loading further comprises ultracentrifugation. According to some embodiments, the preparation method further comprises a step of purifying or isolating the loaded EV. According to one embodiment, the separation is achieved by centrifugation such as ultracentrifugation. According to another embodiment, the separation is achieved by filtration. According to one embodiment, the ratio of the number of purified EVs to the number of residual maternal cells is at least 2, 3, 4, 5, 6, 8 or 10 times higher than that in the initial material, or in certain advantageous embodiments at least 50, 100 or 1000 times higher. According to some embodiments, the EV is a cell-free EV.

[0101] According to some embodiments, the present invention provides a method for preparing EVs (eg, exosomes), the method comprising incubating EVs with conjugated RNAi oligonucleotides (eg, siRNA or shRNA) at a temperature of 25 to 42° C. for 0.5 to 5 hours. According to some embodiments, the conjugate of the siRNA or shRNA is a conjugate with cholesterol.

[0102] According to one embodiment, the method further comprises the step of separating the loaded EVs using centrifugation (e.g., ultracentrifugation). According to some embodiments, another hydrophobic moiety may be used instead of cholesterol. According to one embodiment, the RNAi oligonucleotide is a siRNA.

[0103] According to other embodiments, EVs loaded with RNAi interference oligonucleotides as described herein can be obtained from cells artificially loaded with RNAi oligonucleotides or loaded with polynucleotides encoding and capable of expressing or producing the RNAi interference oligonucleotides in cells. In this case, the polynucleotide / oligonucleotide reagent is connected to a nucleic acid construct under the control of a cis-acting regulatory element (e.g., a promoter), which can direct the expression of the reagent in a constitutive or inducible manner.

[0104] The nucleic acid reagent can be delivered using a suitable gene delivery vector / method (transfection, transduction, etc.). Optionally, a suitable expression system is used. Examples of suitable constructs include, but are not limited to, pcDNA3, pcDNA3.1 (+ / -), pGL3, PzeoSV2 (+ / -), pDisplay, pEF / myc / cyto, pCMV / myc / cyto, each of which is commercially available from Invitrogen Co.

[0105] The expression construct may also be a virus. Examples of viral constructs include, but are not limited to, adenoviral vectors, retroviral vectors, vaccinia virus vectors, adeno-associated virus vectors, polyoma virus vectors, alphaviral vectors, rhabdoviral vectors, lentiviral vectors, and herpesviral vectors.

[0106] Viral constructs such as retroviral constructs include at least one transcription promoter / enhancer or site-limited element, or other elements of controlling gene expression by other means such as alternative splicing, nuclear RNA export or post-transcriptional modification of messenger. Such vector constructs also include packaging signals, long terminal repeats (LTR) or parts thereof, and positive and negative strand primer binding sites applicable to the virus used, unless it exists in the viral construct. In addition, such constructs generally include a signal sequence for secreting the peptide from the host cell where the peptide is placed. Preferably, the signal sequence for this purpose is a mammalian signal sequence or a signal sequence of a peptide variant of the present invention. Optionally, the construct may also include a signal for instructing polyadenylation, and one or more restriction sites and a translation termination sequence. For example, such constructs generally include 5'LTR, tRNA binding site, packaging signal, the origin of second strand DNA synthesis and 3'LTR or a part thereof.

[0107] Preferably, the viral dose used for infection is at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 or higher pfu or virus particles.

[0108] Double-stranded RNA can be synthesized by adding two opposing promoters to the ends of a gene segment, with one promoter placed directly 5' of the gene and the opposing promoter placed directly 3' of the gene segment. The dsRNA can then be transcribed using a suitable polymerase.

[0109] In another embodiment, the polynucleotide or oligonucleotide agent can be incubated with cells in culture, resulting in efficient uptake of the nucleic acid by the cells. For such embodiments, preferably the nucleic acid agent is hydrophobically modified, as further described below.

[0110] Regardless of the method used to load the particles with the nucleic acid reagents described herein, the cells are then incubated for a period of time sufficient to produce EVs, such as exosomes. The exosomes separated from the culture medium contain exosomes loaded with nucleic acid molecules absorbed, produced or expressed by the cells. Therefore, in one embodiment, a method for loading EVs with oligonucleotide cargo is provided, the method comprising incubating cells capable of producing EVs (e.g., producing exosomes) with oligonucleotides for a period of time sufficient to allow the oligonucleotides to be internalized by the cells, culturing the cells for a period of time sufficient to allow exosomes to be secreted, and isolating exosomes loaded with the oligonucleotides from the culture medium.

[0111] According to some embodiments, the present invention provides isolated EVs prepared according to any of the above embodiments.

[0112] According to yet another aspect, the present invention provides liposomes comprising an RNAi oligonucleotide as defined in any one of the above aspects and embodiments. All terms, embodiments and definitions disclosed in any of the above aspects are also applicable and included herein. According to some embodiments, the RNAi oligonucleotide that inhibits PTEN expression is shRNA or siRNA. According to some embodiments, the present invention provides liposomes comprising siRNA, shRNA or both that inhibit the expression of PTEN protein and comprise a guide chain, the guide chain comprising a nucleic acid sequence selected from SEQ ID NO: 1-23 or consisting of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to another embodiment, the siRNA and / or shRNA contains a complementary chain comprising a nucleic acid sequence selected from SEQ ID NO: 24-46. According to some embodiments, the siRNA and / or shRNA that inhibits PTEN expression comprises a pair of oligonucleotides comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; ID NOs: 17 and 40; (xviii) SEQ ID NOs: 18 and 41; (xix) SEQ ID NOs: 19 and 42; (xx) SEQ ID NOs: 20 and 43; (xxi) SEQ ID NOs: 21 and 44; (xxii) SEQ ID NOs: 22 and 45; or (xxiii) SEQ ID NOs: 23 and 46. According to some embodiments, the siRNA and / or shRNA comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NOs: 2 and SEQ ID NOs: 25, respectively.According to some embodiments, the siRNA and / or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA and / or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the shRNA is conjugated to cholesterol.

[0113] The term "liposome" as used herein is well known in the art and refers to a microscopic closed vesicle with an internal phase surrounded by a lipid bilayer. Liposomes can be small single-film liposomes such as small unilamellar vesicles (SUV), large single-film liposomes such as large unilamellar vesicles (LUV), larger single-film liposomes such as giant unilamellar vesicles (GUV), multilamellar liposomes with multiple concentric membranes such as multilamellar vesicles (MLV) or liposomes with multiple irregular and non-concentric membranes such as multivesicular vesicles (MVV). The liposomes can be prepared as known in the art.

[0114] According to another aspect, the present invention provides a pharmaceutical composition comprising a plurality of RNAi oligonucleotides as defined in any one of the above aspects and embodiments and / or a plurality of vesicles carrying the RNAi oligonucleotides, and a pharmaceutically acceptable carrier. According to some embodiments, the vesicle is an EV. According to other embodiments, the vesicle is a liposome. Non-limiting examples of vesicles are exosomes, liposomes, lipid nanoparticles, microvesicles, ectosomes, nanoparticles, nanocarriers, microparticles or apoptotic bodies. Any of the above definitions, terms and embodiments are also included herein and are applicable.

[0115] According to some embodiments, the present invention provides a pharmaceutical composition comprising a plurality of RNA interference (RNAi) oligonucleotides for inhibiting the expression of phosphatase and tensin homolog (PTEN) proteins selected from siRNA and shRNA and containing a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-23, and a pharmaceutically acceptable carrier. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV comprising an RNA interference (RNAi) oligonucleotide for inhibiting the expression of PTEN protein, wherein the RNAi oligonucleotide contains a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the present invention provides a pharmaceutical composition comprising a vesicle, such as a liposome, comprising an RNAi oligonucleotide for inhibiting the expression of PTEN protein, wherein the RNAi oligonucleotide contains a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the RNAi oligonucleotide is shRNA. According to some embodiments, the siRNA or shRNA contains a guide strand consisting of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to some embodiments, the siRNA or shRNA comprises a sense (complementary) strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. The term "complementary" as used herein refers to the ability of a first polynucleotide to hybridize with a second polynucleotide under certain conditions, such as stringent conditions. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 24-46.According to some embodiments, the siRNA or shRNA comprises a pair of oligonucleotides comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to one embodiment, the siRNA or siRNA is coupled to a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA is coupled to a sterol. In an exemplary embodiment, the moiety is a sterol cholesterol molecule, and thus according to such embodiments, the siRNA or shRNA is coupled to cholesterol.

[0116] According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV containing a siRNA molecule that inhibits PTEN expression, wherein the siRNA molecule contains a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-23 or consisting of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to another embodiment, the siRNA contains a complementary strand containing a nucleic acid sequence selected from SEQ ID NO: 24-46. According to some embodiments, the siRNA comprises a pair of oligonucleotides comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; ID NOs: 17 and 40; (xviii) SEQ ID NOs: 18 and 41; (xix) SEQ ID NOs: 19 and 42; (xx) SEQ ID NOs: 20 and 43; (xxi) SEQ ID NOs: 21 and 44; (xxii) SEQ ID NOs: 22 and 45; or (xxiii) SEQ ID NOs: 23 and 46. According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV comprising an siRNA molecule comprising a guide strand and a sense strand comprising or consisting of the nucleic acid sequences SEQ ID NOs: 2 and 25, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV comprising an siRNA molecule comprising a guide strand and a sense strand comprising or consisting of the nucleic acid sequences SEQ ID NOs: 3 and 26, respectively.According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV comprising an siRNA molecule, wherein the siRNA molecule comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the siRNA is conjugated to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0117] According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV comprising an shRNA that inhibits PTEN expression, wherein the shRNA comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the shRNA comprises a pair of oligonucleotides comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the shRNA is coupled to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0118] According to any of the above embodiments, the shRNA or siRNA is loaded on the vesicles, such as EVs.

[0119] The siRNA and shRNA molecules promote sequence-specific degradation of mRNA to achieve inhibition of desired protein gene expression or reduction in PTEN gene expression levels, such as by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5%.

[0120] The term "pharmaceutical composition" as used herein refers to a composition comprising an active ingredient, i.e., an RNAi oligonucleotide as described herein (whether as such or loaded on a vesicle, in particular an EV such as an exosome), formulated together with one or more pharmaceutically acceptable carriers.

[0121] The formulation of the pharmaceutical composition can be adjusted according to the application. Specifically, the pharmaceutical composition can be prepared using methods known in the art so as to provide rapid, continuous or delayed release of the active ingredient after administration to a mammal. For example, the preparation can be selected from plasters, granules, lotions, liniments, lemonade, aromatic waters, powders, syrups, eye ointments, liquids and solutions, aerosols, sprays, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, ophthalmic solutions, tablets, suppositories, injections, spirits, capsules, creams, lozenges, tinctures, pastes, pills and any one of soft or hard gelatin capsules.

[0122] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to any and all solvents, dispersion media, preservatives, antioxidants, coatings, isotonic and absorption delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, glidants, pH regulators, buffers, enhancers, wetting agents, solubilizers, surfactants, antioxidants, etc. that are compatible with drug administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds to provide supplementary, additional or enhanced therapeutic functions. Solid carriers or excipients such as lactose, starch or talc, or liquid carriers such as water, fatty oils or liquid paraffin. Other examples of the carrier include culture media such as DMEM or RPMI; low-temperature storage media containing components that scavenge free radicals, provide pH buffering, colloid osmosis / osmotic support, energy substances and ion concentrations, and balance the intracellular state at low temperatures; and mixtures of organic solvents and water.

[0123] According to any one of the above embodiments, the pharmaceutical composition is formulated for administration by a route of administration selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral and intracerebral administration routes. According to one embodiment, the pharmaceutical composition is formulated for intranasal administration. According to some embodiments, such pharmaceutical compositions take the form of liquid solutions, nasal drops, sprays and measured strays. According to other embodiments, the pharmaceutical composition is formulated for injection, such as intralesional, intrathecal or intravenous injection. According to such embodiments, the pharmaceutical composition takes the form of a sterile injection solution.

[0124] According to some embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from the group consisting of intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes.

[0125] According to one embodiment, the pharmaceutical composition is formulated for intranasal administration.

[0126] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an siRNA or shRNA molecule that inhibits PTEN protein expression, the molecule comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23 or consisting of a nucleic acid sequence selected from SEQ ID NO: 1-23. According to another embodiment, the siRNA or shRNA that inhibits PTEN protein expression comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NO: 24-46. According to some embodiments, the siRNA or shRNA that inhibits PTEN expression comprises a pair of oligonucleotides, which comprises or consists of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27, respectively.

[0127] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with a siRNA or shRNA molecule that inhibits PTEN protein expression, wherein the molecule comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the siRNA or shRNA that inhibits PTEN protein expression comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the siRNA or shRNA that inhibits PTEN expression comprises a pair of oligonucleotides, which comprises or consists of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; NO: 17 and 40; (xviii) SEQ ID NO: 18 and 41; (xix) SEQ ID NO: 19 and 42; (xx) SEQ ID NO: 20 and 43; (xxi) SEQ ID NO: 21 and 44; (xxii) SEQ ID NO: 22 and 45; or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which comprise or consist of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27, respectively.According to some embodiments, the siRNA or shRNA is coupled to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells.

[0128] According to some embodiments, the pharmaceutical composition is formulated for topical administration. Non-limiting examples of such formulations are ophthalmic formulations and injectable formulations.

[0129] According to some embodiments, the pharmaceutical composition of the present invention further comprises chondroitinase ABC (chABC enzyme).

[0130] According to any one of the above embodiments, the pharmaceutical composition of the present invention can be used to treat diseases, disorders or conditions requiring cell regeneration. Therefore, according to some embodiments, the pharmaceutical composition of the present invention is used for regenerative therapy. According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is used to treat nerve regeneration. According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is used to treat a disease or condition selected from neurodegenerative diseases, neuronal disorders, neuronal damage or CNS damage. According to some embodiments, the pharmaceutical composition is used to treat neuronal damage or damage in a subject. According to some embodiments, the neuronal damage or damage is a spinal cord injury (SCI). According to some embodiments, the damage or damage is a traumatic damage or damage. According to some embodiments, the pharmaceutical composition comprising siRNA or shRNA (which contains a guide strand and a sense strand comprising nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25 or consisting of nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25, respectively) is used to treat a disease, disorder or condition requiring cell regeneration as described above in a subject, for example, for treating neuronal damage or damage. According to some embodiments, the pharmaceutical composition comprising siRNA or shRNA (which contains a guide strand and a sense strand comprising or consisting of the nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26, respectively) is used to treat a disease, disorder or condition requiring cell regeneration as described above in a subject, such as for treating neuronal injury or damage. According to some embodiments, the pharmaceutical composition comprising siRNA or shRNA (which contains a guide strand and a sense strand comprising or consisting of the nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27, respectively) is used to treat a disease, disorder or condition requiring cell regeneration as described above in a subject, such as for treating neuronal injury or damage.

[0131] The term "neurological disease, disorder or condition" refers to a disease, disorder or condition of the brain, spinal column and / or the nerves connecting them.

[0132] According to certain embodiments, the condition is due to injury. According to one embodiment, the injury is damage to the spinal cord, i.e., spinal cord injury (SCI). According to other embodiments, the neurological disease, disorder or condition is neuronal damage or neuronal injury. According to some embodiments, the disease or damage is directed to the central nervous system (CNS).

[0133] The terms "spinal cord injury" and "SCI" ​​are used interchangeably herein and refer to damage to the spinal cord. According to one embodiment, the injury is the result of trauma. According to another embodiment, the injury or damage is the result of degeneration or disease. Depending on the location of the spinal cord and nerve roots damaged, symptoms may vary greatly, for example, from pain to paralysis to incontinence. Spinal cord injury is described as a variety of different levels of "incomplete" injury, which can range from no effect on the patient to "complete" injury (meaning complete loss of function). There are many causes of spinal cord injury, but it is usually related to major trauma caused by motor vehicle accidents, falls, sports injuries and violence. Therefore, according to one embodiment, the SCI is selected from complete and incomplete SCI. According to some embodiments, the spinal cord injury is selected from acute or chronic SCI. The spinal cord injury may be prone to secondary tissue damage, including but not limited to: glial scar formation, myelin inhibition, demyelination, cell death, lack of neurotrophic support, ischemia, free radical formation and excitotoxicity.

[0134] Diseases of the spinal cord include, but are not limited to, autoimmune diseases (eg, multiple sclerosis), inflammatory diseases (eg, arachnoiditis), neurodegenerative diseases, poliomyelitis, spina bifida, and spinal tumors.

[0135] Subjects that can be treated according to the teachings of the present invention include mammalian subjects, such as humans, mice, rats, monkeys, dogs, and cats. In one embodiment, the subject is a human subject.

[0136] The term "neurodegenerative disease or disorder" refers to any disease or disorder characterized by dysfunction and / or death of neurons, resulting in loss of neurological function in the brain, spinal cord, central nervous system, and / or peripheral nervous system. Neurodegenerative diseases can be chronic or acute. Examples of neurodegenerative diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, frontotemporal dementia, frontotemporal dementia with Parkinson's disease, frontotemporal dementia, pallidum-pontine-nigral degeneration, progressive supranuclear palsy, multisystem tauopathy, multisystem tauopathy with Alzheimer's disease, Wilhelmsen-Lynch disease, Pick's disease, and disease), Pick's disease-like dementia, mild cognitive impairment, diffuse Lewy body disease, dementia with Lewy bodies, demyelinating diseases such as multiple sclerosis and acute transverse myelitis, Balo's concentric sclerosis, acute disseminated encephalomyelitis, neuromyelitis optica, transverse myelitis or leukodystrophy, amyotrophic lateral sclerosis, Huntington's disease, Creutzfeldt-Jakob disease, AIDS dementia complex, extrapyramidal and cerebellar disorders such as corticospinal disorders, basal ganglia disorders, corticobasal ganglionic degeneration, progressive supranuclear palsy, structural cerebellar disorders, spinocerebellar degeneration such as spinal ataxia, Friedreich's ataxia, cerebellar cortical degeneration, multisystem degeneration (Mencel, Dejerine-Thomas, Shi-Drager, and Machado-Joseph), multiple system atrophy, systemic disorders (Refsum Disease, dysproteinemia, ataxia, telangiectasia and mitochondrial multisystem disorder), motor unit disorders such as neurogenic muscular atrophy (anterior horn cell degeneration, infantile spinal muscular atrophy and juvenile spinal muscular atrophy), progressive bulbar palsy, middle-aged Down syndrome, subacute sclerosing panencephalitis, Hallervorden-Spatz disease, dementia pugilistica, primary lateral sclerosis, progressive pseudobulbar palsy or post-poliomyelitis syndrome; peripheral neuropathy is hereditary (HNPP, CMT1A, CMT1B, DSS, CMT1X, CMT4B1), infectious (leprosy, HIV), immune (GBS), diabetic (type I, type II), injury (temporary nerve compression, chronic compression injury, partial nerve ligation, spinal nerve ligation, preserved nerve injury) and chemotherapy (such as cisplatin) induced neuropathy; etc.

[0137] The term "treating" a condition or patient refers to taking steps to obtain a beneficial or desired result, including a clinical result. Beneficial or desired clinical results include, but are not limited to, improving, eliminating, substantially inhibiting, slowing down or reversing the progression of a disease, condition or disorder, substantially improving or alleviating the clinical or aesthetic symptoms of a condition, substantially preventing the appearance of clinical or aesthetic symptoms of a disease, condition or disorder, and protecting the patient from harmful or annoying symptoms. Treatment further refers to achieving one or more of the following: (a) reducing the severity of the disorder; (b) limiting the development of symptoms characteristic of the disorder being treated; (c) limiting the worsening of symptoms characteristic of the disorder being treated; (d) limiting the recurrence of the disorder in patients who have previously suffered from the disorder; and / or (e) limiting the recurrence of symptoms in patients who were previously asymptomatic for the disorder. According to some embodiments, the term "treatment" includes reduction of neural regeneration, axonal propagation, astrogliosis and microgliosis at the site of injury. According to other embodiments, the term covers the improvement of symptoms associated with a disease or condition. According to one embodiment, the term "treatment" includes improvement of motor parameters. According to one embodiment, the improvement in a motor parameter comprises a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% improvement in a motor parameter compared to an untreated subject. According to some embodiments, the treatment comprises reducing astrogliosis and / or microgliosis at the site of injury. According to one embodiment, reducing astrogliosis and / or microgliosis comprises a 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% reduction in astrogliosis and / or microgliosis compared to an untreated subject.

[0138] The pharmaceutical composition of the present invention can be administered using any known method. The term "administration" of a substance, compound or medicament to a subject can be performed using one of various methods known to those skilled in the art. For example, the compound or medicament can be administered intranasally (e.g., by inhalation), intrathecal (in the spinal canal or subarachnoid space), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, ocularly, sublingually, orally (by ingestion), intracerebrally and transdermally (by absorption, e.g., by skin catheter). The compound or medicament can also be appropriately introduced by a replaceable or biodegradable polymer device or other device (e.g., patch and pump) or a formulation providing an extension, slow or controlled release of the compound or medicament. Administration can also be performed, for example, once, multiple times and / or in one or more extended time periods. According to some embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a day. According to other embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a month. In some embodiments, administration includes direct administration (including self-administration) and indirect administration (including prescribing behavior). For example, as used herein, a physician who instructs a patient to self-administer a drug or have another person administer a drug and / or provides a prescription for a drug to a patient is administering the drug to the patient. According to one embodiment, the pharmaceutical composition of the present invention is administered intranasally. According to another embodiment, the pharmaceutical composition of the present invention is administered intralesionally. According to another embodiment, the pharmaceutical composition of the present invention is administered near a lesion or injury. According to one embodiment, the pharmaceutical composition is administered orally. According to one embodiment, the pharmaceutical composition is administered intranasally. According to some embodiments, the pharmaceutical composition is administered topically. According to some embodiments, the pharmaceutical composition is administered systemically.

[0139] For a 70 kg human, an exemplary dose of membrane vesicles (e.g., exosomes) that may be administered (e.g., intranasally) per treatment might be 1 x 10 6 – 1x 10 20 Between and / or 1x 10 9 – 1x10 15 between.

[0140] According to another aspect, the present invention provides a method for treating a disease or condition associated with cell degeneration or cell death, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide as described in any one of the above embodiments, an extracellular vesicle comprising it, or a pharmaceutical composition comprising them. According to some embodiments, a method includes treating neuronal injury or damage in a subject in need thereof. According to some embodiments, the method includes administering to the subject a therapeutically effective amount of an isolated EV of the present invention, which comprises an RNA interference oligonucleotide of the present invention. According to some embodiments, the administration is intranasal. According to other embodiments, the method further comprises administering chondroitinase ABC (chABC enzyme). The term "therapeutically effective amount" of EV, when administered to a subject, will have the expected therapeutic effect, such as treating neuronal injury or damage such as SCI. The complete therapeutic effect is not necessarily achieved by a single dose, and may only be achieved after the administration of consecutive doses. Therefore, the therapeutically effective amount can be administered in one or more administrations. The exact effective amount required by the subject will depend on, for example, the subject's size, health status and age, the nature and extent of cognitive impairment, the therapeutic agent or combination of therapeutic agents selected for administration, and the mode of administration. The effective amount for a given situation can be readily determined by a skilled artisan through routine experimentation.

[0141] The term "therapeutically effective amount" of membrane vesicles will have the expected therapeutic effect when administered to a subject, such as treating neuronal damage such as SCI. A complete therapeutic effect is not necessarily achieved by a single dose, and may only be achieved after continuous doses are administered. Therefore, a therapeutically effective amount can be administered in one or more administrations. The exact effective amount required for the subject will depend on, for example, the subject's size, health status and age, the nature and degree of cognitive impairment, the therapeutic agent or therapeutic agent combination selected for administration, and the mode of administration. Professional and technical personnel can easily determine the effective amount for a given situation by routine experiments.

[0142] According to some embodiments, the membrane vesicles, e.g., EVs, are administered intranasally, intralesionally, intraperitoneally, topically, systemically, or orally.

[0143] According to another aspect, the present invention provides the use of a RNAi oligonucleotide as described in any one of the above aspects and embodiments for the preparation of a medicament for treating a disease or disorder associated with cell degeneration or cell death.

[0144] In another aspect, the present disclosure provides a method for inhibiting or reducing the expression level of PTEN gene and / or PTEN protein in a cell in vivo or in vitro, the method comprising introducing the siRNA or shRNA molecule of the present invention, the EV of the present invention or the pharmaceutical composition as described above into the cell, so that the expression level of PTEN gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10% or at least 5%. According to some embodiments, the siRNA or shRNA that inhibits the expression of PTEN molecules contains a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 1-23 or consisting of the nucleic acid sequence. According to another embodiment, the siRNA or shRNA contains a complementary strand comprising a nucleic acid sequence selected from SEQ ID NO: 24-46. According to some embodiments, the siRNA or shRNA that inhibits PTEN expression comprises a pair of oligonucleotides, which comprises or consists of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 24; (ii) SEQ ID NOs: 2 and 25; (iii) SEQ ID NOs: 3 and 26; (iv) SEQ ID NOs: 4 and 27; (v) SEQ ID NOs: 5 and 28; (v) SEQ ID NOs: 6 and 29; (vii) SEQ ID NOs: 7 and 30; (viii) SEQ ID NOs: 8 and 31; (ix) SEQ ID NOs: 9 and 32; (x) SEQ ID NOs: 10 and 33; (xi) SEQ ID NOs: 11 and 34; (xii) SEQ ID NOs: 12 and 35; (xiii) SEQ ID NOs: 13 and 36; (xiv) SEQ ID NOs: 14 and 37; (xv) SEQ ID NOs: 15 and 38; (xvi) SEQ ID NOs: 16 and 39; (xvii) SEQ ID NOs: 17 and 18; ID NOs: 17 and 40; (xviii) SEQ ID NOs: 18 and 41; (xix) SEQ ID NOs: 19 and 42; (xx) SEQ ID NOs: 20 and 43; (xxi) SEQ ID NOs: 21 and 44; (xxii) SEQ ID NOs: 22 and 45; or (xxiii) SEQ ID NOs: 23 and 46. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of the nucleic acid sequences SEQ ID NOs: 2 and SEQ ID NOs: 25.According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand, which respectively comprise or consist of nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the siRNA or shRNA is coupled to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0145] The terms "comprising", "including", "having" and "containing" are used interchangeably herein and have the meaning of "consisting at least in part of...". When interpreting each statement in this specification that includes the term "comprising", features other than the one or more features preceding the term may also be present. Related terms such as "including" and "comprising" should be interpreted in the same manner. The terms "having" and "comprising" may also encompass the meanings of "consisting of..." and "consisting essentially of..." and may be replaced by these terms. The term "consisting of..." does not include any components, steps or procedures that are not specifically described or listed. The term "consisting essentially of..." means that the composition or component may include additional ingredients, but only if the additional ingredients do not substantially change the basic and novel characteristics of the claimed composition or method.

[0146] As used herein, the term "about" when referring to a measurable value such as an amount, duration, etc., is meant to encompass variations of + / - 10% or + / - 5% or + / - 1% or even + / - 0.1% from the specified value.

[0147] As used herein, references without a specific number include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof.

[0148] Throughout this application, various embodiments of the present invention may be presented in the format of a range. It should be understood that the description of the range format is only for convenience and brevity and should not be interpreted as a hard limit to the scope of the present invention. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and each numerical value within the range. For example, the description of a range such as 1 to 6 should be considered to have specifically disclosed sub-ranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and each number within the range, such as 1, 2, 3, 4, 5 and 6. This applies regardless of the breadth of the range.

[0149] Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integer) within the indicated range. The phrases "range between a first indicated numeral and a second indicated numeral" and "range from a first indicated numeral to a second indicated numeral" are used interchangeably herein and are meant to include the first and second indicated numerals and all fractions and integers therebetween.

[0150] The term "method" as used herein refers to manners, means, techniques and procedures for accomplishing a given task, including but not limited to those manners, means, techniques and procedures known to practitioners in the fields of chemistry, pharmacology, biology, biochemistry and medicine or readily developable from known manners, means, techniques and procedures.

[0151] It should be understood that certain features of the present invention, which are described in the context of separate embodiments for the sake of clarity, may also be provided in combination in a single embodiment. Conversely, various features of the present invention, which are described in the context of a single embodiment for the sake of brevity, may also be provided separately or in any suitable sub-combination, or in any other described embodiment of the present invention when appropriate.

[0152] Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

[0153] Example

[0154] Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

[0155] Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are fully explained in the literature.

[0156] Materials and methods

[0157] Exosome purification protocol

[0158] Human MSCs were purchased from Lonza (Basel, Switzerland). The cells were cultured and expanded. The cells were cultured with platelet lysate without exosomes (Rabin Medical Center, Israel), and the culture medium was collected after 2-3 days. Exosomes were purified using a standard differential centrifugation protocol, which involved separating the culture fluid and centrifuging at 300g for 10 min. The supernatant was recovered and centrifuged at 2000g for 10 min, then re-centrifuged at 10000g for 30 min. The supernatant was then passed through a 0.22 μm filter and centrifuged at 100000g for 180 min. The precipitate containing exosomes and proteins was washed three times using a 30 kDa Amicon filter. Exosomes were characterized using NanoSight technology, electron microscopy, and Western blotting, with calnexin as a negative marker and CD9 and CD81, CD63, and TSG101 as positive markers.

[0159] Example 1

[0160] According to predetermined criteria, hundreds of RNA sequences that are considered to be useful for siRNA preparation (directed binding to mRNA encoding PTEN protein) were ranked. The 23 highest-scoring sequences among these sequences were prepared and tested. Interestingly, the siRNA used in WO2019 / 186558 (antisense UUCUGUUUGUGGAAGAACUC (SEQ ID NO: 47) and just GAGUUCUUCCACAAACAGAA (SEQ ID NO: 48), hereinafter also referred to as proof of concept (POC) sequence) ranked 489th. The sequences of the antisense (guide) and just sense oligonucleotides of the siRNA are provided in Table 1. In some cases, the sequence complementary to the guide polynucleotide comprises 14 to 19 nucleotides.

[0161] Table 1

[0162]

[0163]

[0164] In sequence listing files, the letter "t" represents uracil (U).

[0165] Example 2

[0166] SH-SY5Y cells were cultured in 24-well TC plates until 70-80% confluence. Lipofectamine TMCells were transfected with each siRNA duplex (at 50 pmol / well) using RNAiMAX transfection reagent (Thermo Fisher). Cells were collected 36 hours later and RNA was extracted using the RNeasy mini kit (QIAGEN) according to the manufacturer's protocol. cDNA was prepared from the lysate of the above cells using a high-capacity cDNA reverse transcription kit (Thermo Fisher). Real-time quantitative PCR was performed on the QuantStudio 12K Flex Real-Time PCR System. Primers suitable for PTEN (ThermoFisher, assay ID: Hs02621230_s1) or GAPDH (Thermo Fisher, assay ID: Hs02786624_g1) were added. Amplification reaction conditions: 95°C 20s, 95°C 3s and 60°C 30s for a total of 40 cycles, 10 μL reaction, triplicate. Relative expression levels were determined using the ΔΔCt method, in which the target gene was normalized to GAPDH expression.

[0167] Since the commercially available sequence considered as a reference (here named siRNA Reference and used as our positive control) contained a cholesterol moiety intended to improve its transfection efficiency, each siRNA molecule was tested with and without conjugated cholesterol to determine whether it had an important effect on the transfection of our molecules.

[0168] The sequence designated as siRNA_pten5 is defined in Table 2.

[0169] Table 2. Pten5 (control) sequence

[0170]

[0171] The results are presented in Figure 1 The relative quantification (RQ) on the Y axis is equivalent to 2 -ΔΔCt The RQ is the multiple change compared to the calibrator (in this case, untreated cells). The RQ value of the calibrator is 1. All samples are compared to the calibrator. An RQ of 10 means that the expression of the gene in sample x is 10 times higher than in the calibrator sample. Pten5 (control), 1455, 1962 and 1458 are the coded names of the four different PTEN siRNA molecules with and without cholesterol tested.

[0172] As can be seen from the examples, the tested siRNA molecules have higher inhibitory abilities compared to the siRNA reference.

[0173] Example 3. Effect of siRNA_1962 on PTEN protein expression in human embryonic kidney cells

[0174] The effect of siRNA_1962 on PTEN protein expression was performed in human embryonic kidney cells (HEK293: a non-cancerous cell line).

[0175] HEK 293 cells were transfected with siRNA / NTC molecules using Lipofectamine 3000 (ThermoFisher) according to the manufacturer's protocol. 96 hours after transfection, cells were harvested in ice-cold PBS.

[0176] RNA was extracted using the RNeasy Mini Kit (QIAGEN), and cDNA was synthesized using the High Capacity cDNA Kit (Thermo). qPCR was performed using TaqMan probes (Thermo) to determine the expression levels of PTEN and GAPDH.

[0177] Proteins were extracted with a nonionic lysis detergent (NP-40 lysis buffer). Under denaturing conditions, the protein extracts were separated in SDS-PAGE gel electrophoresis and then transferred to a nitrocellulose membrane using a Trans-Blot Turbo transfer system (BIO-RAD). The membrane was blocked with EveryBlot blocking buffer (BIO-RAD) and exposed to anti-PTEN mouse monoclonal antibody (Santa Cruz) overnight at 4°C. In order to visualize the signal, the membrane was exposed to anti-mouse IgG-HRP antibody for one hour, and then a substrate (ECL kit) for enhanced chemiluminescence was provided. Signal detection was performed in LAS4000. The membrane was then washed and exposed to anti-GAPDH rabbit polyclonal antibody for one hour at room temperature to determine the internal control, and then exposed to anti-rabbit IgG-HRP. The signal was detected using LAS4000.

[0178] The results are presented in Figure 2A and 2B As can be seen, siRNA_1962 significantly reduced RNA and protein levels; PTEN RNA levels were reduced by ∼80% and PTEN protein levels were reduced by about 90%. Interestingly, a commercially available anti-PTEN siRNA, referred to herein as POC siRNA, showed a much weaker effect ( Figure 2C and 2D As can be seen in the figure, siRNA_1962 significantly reduced PTEN RNA and protein levels compared to POC siRNA. Figure 2D As shown in, siRNA_1 962 reduced PTEN RNA expression with an efficiency about 3 times higher than that of POC siRNA. The experiment was repeated at least 4 times. Figure 2E and 2F Shown is the effect of siRNA_1962 on PTEN protein expression.

[0179] Example 3

[0180] In addition, the efficacy of siRNA_1962 (coupled to cholesterol) loaded into extracellular vesicles (EVs) to inhibit PTEN was tested. The experiment was performed on HEK293 cells by incubating the EVs with the cells.

[0181] Loading of exosomes involved incubation of siRNA sequences (0.1 nmol) with 40 μl BM-MSC-derived exosomes (1*10E7 particles / μl) at 30°C for 4 h and washing of unloaded siRNA using a 30 kDa amicon filter or 100000G ultracentrifugation for 2 h.

[0182] Example 4. In vivo efficacy of siRNA_1962

[0183] Rats underwent surgery to completely transect the spinal cord at T10 and were divided into four treatment groups:

[0184] 1. Exo–siRNA PTEN_cholesterol—Exosomes loaded with siRNA_1962 siRNA conjugated to cholesterol (n=4)

[0185] 2. siRNA conjugated with cholesterol_1962siRNA (n=3)

[0186] 3. Exosomes only (n=4)

[0187] 4. Saline (n=6)

[0188] Rats received 5 days of treatment starting on the day of surgery, followed by 2 days of rest and then another 5 days of treatment.

[0189] Starting 1 week after surgery, rats were exercised on a treadmill 5 days per week and subjected to dorsal Von Frey test, weighed, and walking recorded for weekly BBB scores. During week 10, the spinal cords of the rats were scanned by MRI.

[0190] result

[0191] Sensory recovery was tested by Von Frey filaments, where a gradient of bending force was applied to the dorsal aspect of the hindlimb to determine the paw withdrawal threshold as an indicator of sensory recovery. Figure 3 As seen in the figure, one week after surgery, the sensory response reached 75% in the treatment group administered Exo-PTEN_chol and 33% or less in the control group. Starting from the second week, the percentage of rat legs with restored sensation remained the same as one week later until the end of the experiment. None of the rats in the saline group achieved any sensory recovery.

[0192] Two weeks after surgery, the reflex recovery was tested by tail and paw pinching, and the results are presented in Figure 4 After complete transection SCI surgery, all rats lost the pinch reflex. We examined whether the treatment affected the reflex recovery 2 weeks after the rats completed the surgery. Our results showed that the percentage of rats that recovered the pinch reflex 2 weeks after surgery was much higher in rats treated with Exo PTEN-chal (75%) compared to rats treated with Exo only (25%), PTEN-chol (33%), and control (0%) (see Figure 4 ). After the second week, the recovery reflexes remained unchanged in all animals until the end of the experiment.

[0193] The health of rats was assessed by their tendency to cannibalize in rats that were treated after injury. Rats that underwent SCI surgery were prone to cannibalism. We tracked cannibalism in our rats and found that ( Figure 5 ) The percentage of rats without self-eating behavior in the Exo-PTEN_chol treated group was significantly higher than that in the control group (p value = 0.0033) and the PTEN_chol group (p value = 0.01), but not significantly higher than that in the Exo only group (p value = 0.1).

[0194] Sagittal MRI images, axial sections, and cross-sectional images at 4 mm from the center of T10 in healthy rats or from the tail and mouth of the injury center in untreated, exosome-treated, or ExoPTEN-treated rats were analyzed, and the ratio of the tail to mouth area representing the regeneration of tissue downstream of the injury was calculated. The results are shown in Figure 6 Middle. In vivo MRI imaging clearly demonstrated neural tissue regeneration.

[0195] Although the present invention has been described above by way of preferred embodiments thereof, modifications may be made thereto without departing from the spirit and nature of the invention as defined in the appended claims.

Claims

1. An RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA, comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23, wherein the RNAi oligonucleotide inhibits the expression of phosphatase and tensin homolog (PTEN) protein.

2. The RNAi oligonucleotide according to claim 1, wherein the RNAi oligonucleotide is a siRNA, and wherein the guide strand consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-23.

3. The RNAi oligonucleotide of claim 1 or 2, comprising a sense strand complementary to the guide strand, wherein the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. The RNAi oligonucleotide according to claim 3 , wherein the sense strand consists of 14 to 21 nucleotides.

5. The RNAi oligonucleotide according to claim 3 or 4, wherein the complementary strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 24-46.

6. The RNAi oligonucleotide of claim 1, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand comprising the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and a sense strand comprising the nucleic acid sequence GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26).

7. The RNAi oligonucleotide according to claim 6, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand consisting of the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and a sense strand consisting of the nucleic acid sequence GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26).

8. The RNAi oligonucleotide according to any one of claims 1 to 7, coupled to a load moiety.

9. The RNAi oligonucleotide of claim 8, wherein the cargo moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof. 10 . An isolated extracellular vesicle comprising the RNAi oligonucleotide for inhibiting PTEN protein expression according to claim 1 .

11. The isolated extracellular vesicle of claim 11, wherein the extracellular vesicle is loaded with the RNAi oligonucleotide ex vivo.

12. The isolated extracellular vesicle according to claim 10 or 11, wherein the extracellular vesicle is selected from the group consisting of exosomes, macrovesicles, microvesicles and combinations thereof.

13. The isolated extracellular vesicles according to any one of claims 10 to 12, wherein the extracellular vesicles are derived from adherent cells expressing mesenchymal markers.

14. The isolated extracellular vesicle of claim 13, wherein the adherent cells expressing mesenchymal markers are selected from mesenchymal stem cells and olfactory ensheathing cells.

15. A pharmaceutical composition comprising the RNAi oligonucleotide according to any one of claims 1 to 9 or the extracellular vesicle according to any one of claims 10 to 14 and a pharmaceutically acceptable carrier and / or excipient.

16. The pharmaceutical composition of claim 15, formulated for administration via an administration route selected from the group consisting of intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, transdermal, topical, local and intracerebral administration routes.

17. The pharmaceutical composition of claim 16, which is formulated for intranasal administration.

18. A pharmaceutical composition according to any one of claims 15 to 17 for use in regenerative therapy.

19. The pharmaceutical composition according to claim 18, wherein the use comprises treating nerve regeneration.

20. The pharmaceutical composition of claim 18 or 19, wherein the use comprises treating a disease or condition selected from a neurodegenerative disease, a neuronal disorder, a neuronal injury or a CNS damage in a subject.

21. The pharmaceutical composition of claim 20, wherein the neuronal injury or damage is spinal cord injury (SCI).

22. A pharmaceutical composition for use according to any one of claims 18 to 20, wherein the use comprises intranasal administration of the composition.

23. A pharmaceutical composition for use according to any one of claims 18 to 20, wherein the use comprises topical administration of the composition.

24. A method for treating a disease or condition associated with cell degeneration or death, the method comprising administering to the subject a therapeutically effective amount of the RNAi oligonucleotide according to any one of claims 1 to 9, the extracellular vesicle according to any one of claims 10 to 14, or the pharmaceutical composition according to any one of claims 15 to 17.

25. The method of claim 24, wherein the disease or condition is selected from a neurodegenerative disease, a neuronal disorder, a neuronal injury, or a CNS damage in a subject.

Images