Application of RHPS4 in inhibiting monascus to produce citrinin, biological preparation and application of biological preparation

Abstract

The invention provides application of RHPS4 in inhibiting monascus to produce citrinin, a biological agent and application of the biological agent, and belongs to the technical field of microbial fermentation. The invention discloses an application of RHPS4 in inhibiting production of citrinin from monascus, the RHPS4 is named as 3, 11-difluoro-6, 8, 13-trimethyl-8H-quinolo [4, 3, 2-kl] acridine onium methyl sulfate salt, the RHPS4 can reduce citrinin synthesized in the growth process of monascus, when co-fermentation culture is carried out to the tenth day, the concentration of the RHPS4 is 5 [mu] mol / L, detection finds that the citrinin is reduced by 99.7%, and the content of citrinin is reduced by 99.7%. The synthesis of citrinin is effectively inhibited. According to the method, RHPS4 and monascus are co-cultured, so that the content of citrinin is reduced, and popularization and application of monascus products are promoted.

Description

Technical Field

[0001] The invention relates to the technical field of microbial fermentation, and in particular to an application of RHPS4 in inhibiting citrinin production by Monascus, a biological preparation and an application thereof. Background Art

[0002] Monascus spp. is a filamentous fungus that is both edible and medicinal, and has extremely high edible and medicinal value. Monascus can produce many secondary metabolites, such as Monascus pigments (Mps) and Monacolin K (MK), which have important application values ​​and are widely used in food development fields such as food colorants, preservatives and food additives.

[0003] Studies have found that Monascus also synthesizes a fungal toxin, Citrinin (CIT), during its growth. Citrinin is nephrotoxic and hepatotoxic, and is extremely harmful to humans and animals. Its main target organ is the kidney. After ingestion, it can cause symptoms such as kidney enlargement, tubular dilatation, and epithelial cell degeneration and necrosis in experimental animals. Accumulation in the kidney can lead to renal failure. Studies have also found that citrinin has adverse effects on the gastrointestinal tract, bone marrow, embryos, and liver. In addition, excessive intake of citrinin through diet and other means may be toxic, skin irritating, teratogenic, and carcinogenic.

[0004] Therefore, the presence of citrinin has restricted the promotion and application of red yeast rice products to a certain extent, which not only affects the export of red yeast rice products in my country, but also has potential harm to the health of Chinese residents. Therefore, it is of great significance to reduce the content of citrinin in Monascus, find an active compound that can inhibit the synthesis of citrinin, and study its mechanism of action. Summary of the invention

[0005] The main purpose of the present invention is to provide an application of RHPS4 in inhibiting the production of citrinin by Monascus, aiming to solve the problem that citrinin synthesized by Monascus during the growth process limits the application scope of Monascus products, and to a certain extent, effectively promote Monascus products.

[0006] To achieve the above object, the present invention provides an application of RHPS4 in inhibiting citrinin production by Monascus.

[0007] The full name of RHPS4 is 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate, which has the chemical formula as shown in formula (1).

[0008]

[0009] In some embodiments, the citrinin is a mycotoxin.

[0010] In some embodiments, the RHPS4 inhibits the production of citrinin by Monascus by stabilizing the G-quadruplex in the citrinin biosynthesis gene of Monascus, thereby inhibiting the production of citrinin.

[0011] In some embodiments, the concentration of RHPS4 is 0-5 μmol / L.

[0012] The invention also provides a biological preparation for inhibiting citrinin production by Monascus, and the biological preparation comprises RHPS4.

[0013] In some embodiments, the biologic comprises a preservative or a food additive.

[0014] The present invention also provides a method for inhibiting the production of citrinin by Monascus, comprising: using the biological agent described in any one of the above items to reduce the production of citrinin in Monascus, wherein the biological agent comprises RHPS4.

[0015] The beneficial effects of the present invention are as follows:

[0016] The invention discloses application of RHPS4 in inhibiting citrinin production by Monascus. The full name of RHPS4 is 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate. In the technical scheme of the invention, RHPS4 can stabilize G-quadruplex in citrinin biosynthesis gene of Monascus and regulate the expression level of citrinin-related synthesis gene, thereby reducing citrinin synthesized by Monascus during growth and promoting the popularization and application of Monascus products. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The graph is a graph of citrinin content on the 7th day of co-fermentation of 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate with Monascus at different concentrations;

[0018] Figure 2 The graph is a graph of citrinin content on the 10th day of co-fermentation of 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate with Monascus at different concentrations;

[0019] Figure 3 It is a liquid phase diagram detected by HPLC at a concentration of 0 μmol / L of 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate on the 10th day;

[0020] Figure 4The liquid phase diagram of 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate at a concentration of 2 μmol / L detected by HPLC on the 10th day;

[0021] Figure 5 This is a liquid phase diagram detected by HPLC at a concentration of 5 μmol / L of 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate on the 10th day.

[0022] Figure 6 Schematic diagram of circular dichroism (CD) melting evaluation of RHPS4's ability to stabilize the G-quadruplex of genes related to citrinin biosynthesis in Monascus.

[0023] The realization of the purpose, functional features and advantages of the present invention will be further explained in conjunction with embodiments and with reference to the accompanying drawings. DETAILED DESCRIPTION

[0024] To make the purpose, technical scheme and advantages of the embodiment of the present invention clearer, the technical scheme in the embodiment of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiment, it is carried out according to the normal conditions or the conditions recommended by the manufacturer. If the reagents or instruments used do not specify the manufacturer, they are all conventional products that can be purchased commercially. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes, taking "A and / or B" as an example, including scheme A, or scheme B, or schemes that A and B meet at the same time. In addition, the technical schemes between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in the field to achieve. When the combination of technical solutions is contradictory or cannot be achieved, it should be considered that the combination of such technical solutions does not exist, and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without making creative work belong to the scope of protection of the present invention.

[0025] Monascus spp. is a filamentous fungus that is both edible and medicinal, and has extremely high edible and medicinal value. Monascus can produce many secondary metabolites, such as Monascus pigments (Mps) and Monacolin K (MK), which have important application values ​​and are widely used in food development fields such as food colorants, preservatives and food additives.

[0026] Studies have found that Monascus also synthesizes a fungal toxin, Citrinin (CIT), during its growth. Citrinin is nephrotoxic and hepatotoxic, and is extremely harmful to humans and animals. Studies have found that the main target organ of citrinin is the kidney, which can cause symptoms such as kidney enlargement, tubular dilatation, and epithelial cell degeneration and necrosis in experimental animals. Accumulation in the kidney can lead to renal failure. Studies have also found that citrinin has adverse effects on the gastrointestinal tract, bone marrow, embryos, and liver. In addition, excessive intake of citrinin through diet and other means may be toxic, skin irritating, teratogenic, and carcinogenic.

[0027] Therefore, the presence of citrinin has restricted the promotion and application of red yeast rice products to a certain extent, which not only affects the export of red yeast rice products in my country, but also has potential harm to the health of Chinese residents. Therefore, it is of great significance to reduce the content of citrinin in Monascus, find an active compound that can inhibit the synthesis of citrinin, and study its mechanism of action.

[0028] In view of this, the present invention provides an application of RHPS4 in inhibiting the production of citrinin by Monascus, wherein the full name of the RHPS4 is 3,11-difluoro-6,8,13-trimethyl-8H-quinolin-[4,3,2-kl]acridinium methyl sulfate, having a chemical formula as described in formula (1).

[0029]

[0030] The invention discloses application of RHPS4 in inhibiting citrinin production by Monascus. The full name of RHPS4 is 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate. RHPS4 can reduce citrinin synthesized by Monascus during its growth, and promote the popularization and application of Monascus products.

[0031] It should be noted that RHPS4 has some specific properties that make it exhibit unique performance in various applications. These characteristics make RHPS4 of great value in chemical research and applications, such as in the fields of food development and microbial fermentation.

[0032] In any embodiment of the present invention, the RHPS4 inhibits the production of citrinin by Monascus by stabilizing the G-quadruplex in the citrinin biosynthesis gene of Monascus, thereby inhibiting the production of citrinin.

[0033] In any embodiment of the present invention, the concentration of RHPS4 is 0-5 μmol / L, which may be 2 μmol / L and 5 μmol / L. Within this concentration range, as the concentration of RHPS4 increases, the effect of inhibiting citrinin production by Monascus is better.

[0034] In any embodiment of the present invention, the present invention provides a biological agent for inhibiting the production of citrinin by Monascus, wherein the biological agent includes RHPS4. That is to say, in actual production, RHPS4 can be prepared into a biological agent and applied in scenarios where the production of citrinin by Monascus needs to be inhibited.

[0035] In the technical solution provided by the present invention, RHPS4 is used to prepare a biological agent for inhibiting the production of citrinin by Monascus, reducing the potential of the fungal toxin citrinin in Monascus products, and further improving the safety of Monascus products.

[0036] In any embodiment of the present invention, the biological preparation comprises a preservative or a food additive.

[0037] The technical solution of the present invention prepares RHPS4 into various products in production, corresponding to the wide application of Monascus in food development fields such as food colorants, preservatives or food additives, and expands its scope of use.

[0038] The present invention also provides a method for inhibiting the production of citrinin by Monascus, comprising: using the biological agent described in any one of the above items to reduce the production of citrinin in Monascus, wherein the biological agent comprises RHPS4.

[0039] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0040] Experimental Materials

[0041] Monascus is a strain of Monascus ruber 7, and its deposit number is CCAM 070120.

[0042] RHPS4 was purchased from Aladdin Biochemical Technology Co., Ltd. with the product number R287983-25g.

[0043] Performance Testing

[0044] 1. Evaluation test of RHPS4 inhibiting citrinin production by Monascus:

[0045] 1) Monascus was inoculated on potato dextrose agar (PDA) medium for activation and cultured in a 28°C incubator for 14 days;

[0046] 2) Preparation of PDA medium: 200 g peeled potatoes, cut into 1 cm 3size, add distilled water and boil for 30 minutes, collect the filtrate through gauze, add 20g glucose and 15-20g agar powder, add 1000mL distilled water, and use it for Monascus culture;

[0047] 3) Take Monascus spore liquid: After culturing Monascus for 14 days, add 5 mL of sterile water to wash the spores from the slope, collect the filtrate after filtering through sterile double-layer lens paper, and treat it with glass beads for 30-40 minutes. The number of spores is determined by microscope-hemocytometer counting plate. After counting, centrifuge (8000 rpm, 10 min), concentrate the spore liquid, and dilute it with sterile water to a concentration of 1×10 5 spores / mL of Monascus spore suspension;

[0048] 4) Co-fermentation culture: 500 μL of Monascus spore suspension and RHPS4 were inoculated into YES (yeast extract sucrose) medium, where the final concentration of RHPS4 was 0 μmol / L (control group), 2 μmol / L and 5 μmol / L, and cultured at 28°C. YES medium preparation: 160 g / L sucrose, 40 g / L yeast extract, 1 L of distilled water was added, sterilized at 121°C, and used for liquid fermentation of Monascus;

[0049] 5) Sampling: 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate was co-fermented with Monascus and samples were taken on the 7th and 10th days. The fermentation liquid was separated by gauze filtration and used for the determination of citrinin production;

[0050] 6) Extraction of citrinin: Extract with a mixed solvent of toluene-ethyl acetate-formic acid (TEF reagent, volume ratio 7:3:1), centrifuge at 12000rpm for 10min, take the supernatant and place it in a beaker, transfer to a fume hood and wait for the liquid to evaporate (or place in a 65℃ water bath until it evaporates), add 1mL of 80% methanol solution to each beaker after evaporation, fully dissolve the sample, filter through a 0.22μm filter membrane into a liquid phase bottle, and place in a -20℃ refrigerator and wait for HPLC detection;

[0051] 7) HPLC detection: Chromatographic conditions are: Phenomenex C18 column (Phenomenex Luna, 2.1 mm × 100 mm, 1.7 μm); fluorescence detector; mobile phase is A: acetonitrile, B: 0.1% formic acid water, elution program is: 0-3 min, 10% A and 90% B; 3-10 min, 70% A and 30% B; 10.01-12 min, 90% A and 10% B; 12.01-15 min, 10% A and 90% B; flow rate: 1 mL / min; injection volume 20 μL; column temperature is 40°C; detection conditions: E x =330nm, Em =500nm; the obtained liquid phase peak of citrinin was integrated and compared with the standard curve of citrinin standard to calculate the content of citrinin in red yeast rice.

[0052] from Figure 1 The data show that on the 7th day of co-fermentation, as the concentration of 3,11-difluoro-6,8,13-trimethyl-8H-quinolin [4,3,2-kl] acridinium methyl sulfate salt increased from 0μmol / L, 2μmol / L to 5μmol / L, the citrinin content showed a decreasing trend. Among them, at a concentration of 5μmol / L, compared with the control group without adding 3,11-difluoro-6,8,13-trimethyl-8H-quinolin [4,3,2-kl] acridinium methyl sulfate salt, the citrinin content decreased from 14.81μg / mL to 0.12μg / mL, significantly reducing the citrinin content.

[0053] from Figure 2 The data show that on the 10th day of co-fermentation, 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate can effectively inhibit the synthesis of citrinin, and at a concentration of 5 μmol / L, 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate can reduce 99.7% of citrinin.

[0054] from Figure 3 It can be seen that the citrinin content in the co-fermentation product was determined by HPLC. On the 7th day, the retention time of citrinin in RHPS4 at a concentration of 0 μmol / L was 8.895 min. The citrinin content was calculated from the peak area and the citrinin standard curve, and the citrinin content at this concentration was 14.81 μg / mL.

[0055] from Figure 4 It can be seen that the citrinin content in the co-fermentation product was determined by HPLC. On the 7th day, at a concentration of 2 μmol / L of RHPS4, the retention time of citrinin was 8.887 min. The citrinin content was calculated by the peak area and the citrinin standard curve, and the citrinin content at this concentration was 12.26 μg / mL, which can explain that the citrinin content was reduced compared with the control group without adding RHPS4.

[0056] from Figure 5It can be seen that the HPLC determination of the citrinin content in the co-fermentation product showed that on the 7th day, at a concentration of 5 μmol / L of RHPS4, the retention time of citrinin was 8.867 min. The citrinin content was calculated by the peak area and the citrinin standard curve, and the citrinin content at this concentration was 0.12 μg / mL, which can explain that the citrinin content was reduced compared with the control group without adding RHPS4, and the effect was significant.

[0057] 2. Evaluation of the ability of RHPS4 to stabilize the G-quadruplex of citrinin biosynthesis-related genes in Monascus by circular dichroism (CD) melting detection:

[0058] 1) Sample preparation. Prepare the following proportions in a 1.5 mL centrifuge tube: deionized water, Tris-HCl, KCl, and nucleic acid. Mix the above samples to be tested. Heat in a water bath at 95°C for 5 min, pre-fold, cool naturally to room temperature, and place in a 4°C refrigerator for later use. The nucleic acid here refers to the G-quadruplex sequence in the mrl4 gene that regulates citrinin, as shown in SEQ ID NO: 1, and the specific sequence is GGACAGTGGATATGGTAGGG;

[0059] 2) Add RHPS4 before loading, mix gently, and incubate at 30°C for 10 min. Add an equal amount of DMSO to RHPS4 as a control;

[0060] 3) Test on the machine. The cuvette used has an optical path of 1.0 mm and a sample volume of 300 μL. For the G-quadruplex of the Monascus citrinin biosynthesis gene, record the CD value at a wavelength of 265 nm at various temperatures; set the detection temperature range to 4-95°C, and the scanning speed to 1°C / min; after adding the sample, remove the bubbles in the cuvette wall;

[0061] 4) Data processing. After the data are standardized, a graph is drawn with the CD change value as the ordinate and the temperature as the abscissa. The corresponding abscissa value (T) when the ordinate is 0.5 under the two conditions is calculated. m The difference between the two values ​​is ΔT. m .

[0062] Figure 6 The mrl4 in the above refers to the G-quadruplex sequence in the mrl4 gene that regulates citrinin. ml4 is the key gene that regulates citrinin synthesis. GGACAGTGGATATGGTAGGG is a characteristic sequence in this gene (capable of forming a G-quadruplex structure). The melting temperature (Tm value) of the mrl4 G-quadruplex is 58°C at 265nm. After adding RHPS4, the Tm value becomes 75°C, and ΔT mThe value was 15.98℃, indicating that RHPS4 could stabilize the G-quadruplex structure in the mrl4 gene related to citrinin biosynthesis of Monascus, thereby inhibiting the synthesis of citrinin.

[0063] From the above test results, it can be seen that with the increase of the concentration of 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate, the citrinin content shows a downward trend, which reflects a good effect of inhibiting the production of citrinin by Monascus; and through CD melting, it can be seen that RHPS4 has the ability to stabilize the G-quadruplex of genes related to the biosynthesis of citrinin in Monascus, thereby mediating the synthesis of citrinin.

[0064] The above are only preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention may have various changes and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the patent protection scope of the present invention.

Claims

1. Application of RHPS4 in inhibiting citrinin production by Monascus, wherein: The full name of RHPS4 is 3,11-difluoro-6,8,13-trimethyl-8H-quinolino[4,3,2-kl]acridinium methyl sulfate, and has a chemical formula as described in formula (1).

2. The use of RHPS4 as claimed in claim 1 in inhibiting the production of citrinin by Monascus, characterized in that: The RHPS4 inhibits the production of citrinin by Monascus by stabilizing the G-quadruplex in the citrinin biosynthesis gene of Monascus, thereby inhibiting the production of citrinin.

3. The use of RHPS4 as claimed in claim 1 in inhibiting the production of citrinin by Monascus, characterized in that: The concentration of the RHPS4 is 0-5 μmol / L.

4. A biological agent for inhibiting the production of citrinin by Monascus, characterized in that: The biologic comprises RHPS4.

5. The biological agent according to claim 4, characterized in that The biological preparation includes a preservative or a food additive.

6. A method for inhibiting the production of citrinin by Monascus, characterized in that: include: The biological preparation as claimed in any one of claims 4 or 5 is used to reduce the production of citrinin in Monascus.

Images