Small interfering nucleic acid for inhibiting NOX1 gene expression and pharmaceutical application thereof

Abstract

The invention relates to a small interfering nucleic acid for inhibiting NOX1 gene expression and pharmaceutical application thereof. The invention claims application of a small interfering nucleic acid for inhibiting NOX1 gene expression in preparation of a medicament for treating primary biliary cholangitis or primary sclerosing cholangitis. The small interfering nucleic acid can effectively improve the aging condition of bile duct epithelial cells by inhibiting NOX1 gene expression and reduce the speed of an inflammation-mediated hepatic fibrosis process, so that the small interfering nucleic acid is expected to be applied to medicines for treating primary biliary cholangitis or primary sclerosing cholangitis.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a small interfering nucleic acid for inhibiting NOX1 gene expression and its pharmaceutical use. Background Art

[0002] RNA interference (RNAi) refers to a gene silencing phenomenon induced by double-stranded RNA in molecular biology. Its mechanism is to inhibit gene expression by hindering the transcription or translation of specific genes. When double-stranded RNA homologous to the coding region of endogenous messenger RNA (mRNA) is introduced into cells, it can induce the degradation of target mRNA, resulting in gene expression silencing. Double-stranded small interfering RNA (siRNA) with a length of 20-25nt can trigger RNAi, specifically downregulate or shut down the expression of specific genes, and has the advantages of high efficiency, easy synthesis and easy operation. Therefore, this technology has been widely used in the field of gene function exploration and gene therapy for infectious diseases and malignant tumors.

[0003] Primary biliary cholangitis (PBC) and primary sclerosing cholangitis (PSC) are chronic cholestatic liver diseases characterized by inflammation, fibrosis, and destruction of the intrahepatic and extrahepatic bile ducts, which can progress to advanced fibrosis, cirrhosis, portal hypertension, and hepatocellular carcinoma (HCC). Severe patients require liver transplantation. In addition, PBC and PSC can be complicated by related immune-mediated diseases such as inflammatory bowel disease, arthritis, and other diseases with common susceptibility. Currently, the first-line treatment for PBC and PSC is ursodeoxycholic acid (UDCA), but about one-third of patients do not fully respond to UDCA; the second-line treatment drug obeticholic acid (OCA) is limited by significant side effects, including itching and hyperlipidemia, and is contraindicated in patients with portal hypertension and / or liver decompensation. In addition, the treatment cycle of both is long, and the need to take medication every day leads to poor patient compliance. Studies have shown that senescence of bile duct epithelial cells is involved in the pathogenesis of PBC and PSC. Therefore, exploring the key molecules that regulate the aging of bile duct epithelial cells is of great significance for the prevention and treatment of PBC and PSC and the development of new drugs. Summary of the invention

[0004] The purpose of the present invention is to provide a small interfering nucleic acid for inhibiting NOX1 gene expression and its pharmaceutical use, which plays an important role in treating primary biliary cholangitis and / or primary sclerosing cholangitis.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A use of a small interfering nucleic acid for inhibiting NOX1 gene expression in preparing a drug for primary biliary cholangitis and / or primary sclerosing cholangitis.

[0007] Preferably, the small interfering nucleic acid consists of its sense strand and its antisense strand, the sense strand and the antisense strand are completely or partially reverse complementary to form a double-stranded region, the antisense strand is reverse complementary to a segment on the target gene, the sense strand has a nucleotide sequence as shown in SEQ ID NO.1 and / or a sequence in which any nucleotide of the nucleotide sequence is modified, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO.2 and / or a sequence in which any nucleotide of the nucleotide sequence is modified;

[0008] in:

[0009] The positive strand is 5′-CUGAGUCUUGGAAGTGGAUCCUU-3′ (SEQ ID NO. 1);

[0010] The antisense strand is 5'-AAGGAUCCACUUCCAAGACUCAG-3' (SEQ ID NO. 2).

[0011] Preferably, in order to increase the biological stability of the molecule or to increase the physical stability of the duplex formed between the polynucleic acid molecule and the target nucleic acid, the sugar moiety of the small interfering nucleic acid is modified at the 2' position.

[0012] Preferably, the modification of the sugar moiety is one or more of a 2'-O-methyl modification, a 2'-O-methoxyethyl modification, a 2'-O-aminopropyl modification, a 2'-deoxy modification, a T-deoxy-2'-fluoro modification, a 2'-O-aminopropyl modification, a 2'-O-dimethylaminoethyl modification, a 2'-O-dimethylaminopropyl modification, a T-O-dimethylaminoethoxyethyl modification or a 2'-ON-methylacetamido modification.

[0013] Preferably, at least one phosphate group in the small interfering nucleic acid is a phosphate group containing a modified group, and the phosphate group containing a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

[0014] Preferably, the 3' end of the sense strand and / or antisense strand is connected with 1 to 4 additional nucleotides, and after complementary pairing of the sense strand and antisense strand, at least one 3' overhang consisting of 1 to 4 nucleotides is formed, and the end of the 3' overhang is 2 consecutive deoxythymine nucleotides dTdT.

[0015] Preferably, the small interfering nucleic acid is at least one of the following two modified sequences:

[0016] siNOX1-1:

[0017] Justice Chain:

[0018] 5'-mC-s-mU-s-mGmAmGmUmCmUmUmGfGmAfAmGTmGmGmAmUmCmCmUmUdTdT-3';

[0019] Antisense strand:

[0020] 5'-mA-s-fA-s-mG-fG-fA-fU-mC-fCmAfCmUmUmCfCmAfAmGmAmCmUmCmAmGdTdT-3';

[0021] siNOX1-2:

[0022] Sense strand: 5′-CsUsGAGUCUUGGAAGTmGmGmAmUmCmCmUmUdTdT-3′;

[0023] Antisense strand: 5′-mA-s-mA-s-mGmGmAmUmCCACUUCCAAGACUCAGdTdT-3′;

[0024] Among them, m means that the ribose group of the nucleotide on the right side of the letter is 2'-methoxyribose; s means that the phosphate groups between the ribonucleotides on both sides of the letter are thiophosphates; f means that the ribose group of the nucleotide on the left side of the letter is substituted by fluorine to form a 2'-fluororibose; d means that the nucleotide on the right side of the letter is a deoxyribonucleotide.

[0025] Beneficial effects:

[0026] The small interfering nucleic acid targeted by the present invention can inhibit the expression of NOX1 gene, effectively reduce the oxidative stress in the liver, improve the aging of bile duct epithelial cells, inhibit the inflammatory level and liver fibrosis in the liver; it can effectively reduce the bile pigment deposition and liver fibrosis area in the liver in the DDC-induced mouse PSC model, and improve the liver fibrosis symptoms of mice. In addition, it can reduce the degree of liver fibrosis in the mouse model after bile duct ligation surgery. Compared with the prior art, it has better therapeutic effects and can be effectively used in drugs for treating liver diseases such as primary biliary cholangitis or primary sclerosing cholangitis. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The specific implementation modes of the present invention are further described in detail below in conjunction with the accompanying drawings.

[0028] Figure 1 The graph shows the inhibitory effect of siNOX1-1 on CCL20 in each group of cells.

[0029] Figure 2 The graph shows the inhibitory effect of siNOX1-1 on NLRP3 in each group of cells.

[0030] Figure 3 This is a graph showing the inhibitory effect of siNOX1-1 on NOX1 in each group of cells.

[0031] Figure 4 This is the result graph of siNOX1-1 inhibiting the bile pigment-positive area.

[0032] Figure 5 This is the result of siNOX1-1 inhibiting liver fibrosis area.

[0033] Figure 6 This is a graph showing the effect of siNOX1-2 on ALP.

[0034] Figure 7 This is a graph showing the effect of siNOX1-2 on ALT.

[0035] Figure 8 This is a graph showing the effect of siNOX1-2 on AST.

[0036] Fig. 9 This is a graph showing the effect of siNOX1-2 on TBIL.

[0037] Fig.10 This is a graph showing the effect of siNOX1-2 on NOX1.

[0038] Fig.11 This is a pathological section of liver tissue in the sham operation control group.

[0039] Fig.12 This is a pathological section of liver tissue in the surgical model group.

[0040] Fig.13 This is a picture of liver tissue pathological section after using siNOX1-2. DETAILED DESCRIPTION

[0041] Embodiment 1:

[0042] siNOX1-1 siRNA improves senescence of bile duct epithelial cells

[0043] During the aging process, bile duct epithelial cells secrete a large number of inflammatory factors, such as chemokine ligand 20 (CCL20), NOD-like receptor thermal protein domainassociated protein 3 (NLRP3), interleukin 6, etc. CCL20 and its chemokine receptor CCR6 are involved in the formation and function of mucosal lymphoid tissue, especially in PBC, an immune-mediated lymphocytic cholangitis, which can induce Th17 cells and CD8 effector T cells to localize to bile duct cells and the periportal vein area, accelerating the deterioration of PBC. NLRP3 can assemble with apoptosis-associated speck-like protein (ASC) and effector molecule caspase-1 to form inflammasomes, mediating inflammatory responses. NOX1 is a catalytic subunit of NADPH oxidase, which can catalyze the production of reactive oxygen species (ROS), leading to increased oxidative stress in the liver, thereby inducing senescence of bile duct epithelial cells and accelerating inflammation-mediated liver fibrosis. Therefore, by inhibiting the expression of NOX1 protein, it is possible to effectively reduce oxidative stress in the liver, improve senescence of bile duct epithelial cells, and inhibit the inflammatory level in the liver, thereby treating inflammation-mediated liver diseases.

[0044] 1. Experimental methods

[0045] (1) Human intrahepatic bile duct epithelial cells in the logarithmic growth phase were digested with trypsin, and a medium containing 2% FBS was added to terminate the digestion and the cells were collected by centrifugation. The cells were resuspended in a medium containing 2% FBS, counted using a hemocytometer, and then 70,000 cells were added to each well of a 12-well plate.

[0046] (2) Preparation of LipoRNAi MAX (invitrogen) and siRNA mixture: negative control NC sequence and siNOX1-1 were selected. The negative control NC sequence was: positive strand: 5'-UUCUCCGAACGUGUCACGUTT-3' (SEQ ID NO: 3); antisense strand: 5'-ACGUGACACGUUCGGAGAATT-3' (SEQ ID NO: 4).

[0047] 10 nM negative control NC sequence and siNOX1-1 and 3 μL LipoRNAi MAX (Invitrogen) were diluted in 50 μL serum-free culture medium (Opti-MEM, purchased from Gibco), and then the above siRNA solution and LipoRNAi MAX (Invitrogen) solution were mixed and allowed to stand at room temperature for 5 minutes.

[0048] (3) Add 100 μL of the mixed solution of siRNA and LipoRNAi MAX (invitrogen) of the corresponding group to each well.

[0049] (4) After 48 hours of culture, the cells were stimulated with H2O2 at three concentrations: 100 μM, 300 μM, and 500 μM. After 2 hours, the H2O2 in the 12-well plate was discarded, and the cells were washed once with enzyme-free PBS and then added with culture medium containing 2% FBS. The cells were cultured for another 5 days, during which time the culture medium containing 2% FBS was replaced every day.

[0050] (5) After 5 days of continuous culture, the culture medium was discarded, and the cells were washed twice with enzyme-free PBS and then lysed with lysis solution (BioFlux). Chloroform (MREDA) was added for extraction. After oscillation and mixing, the cells were allowed to stand at room temperature for 2 to 3 minutes and centrifuged. The supernatant after stratification was transferred to a well plate and combined with the binding solution. A nucleic acid extractor was used to arrange the well plate in order according to the instructions of the kit (MagaBio plus total RNA purification kit II, manufacturer Bioer, batch number c692302005) and RNA was extracted using the BSC69 program.

[0051] (6) Preparation of qPCR system: Perform the reaction on ice. Add 1 μL One Step SYBR Green Mix (Novagen), 10 μL 2*One Step SYBR Green Mix (Novagen), 0.4 μL hCCL20-PF (or hNLRP3-PF, h0425-1PF, hGAPDH-5PF), and 0.4 μL hCCL20-PR (or hNLRP3-PR, h0425-1PR, hGAPDH-5PR) to each well. Dilute 80 ng RNA in 8.2 μL RNase ddH2O (Novagen) and add to the wells. Mix well and place in a qPCR instrument for reaction.

[0052] PCR reaction conditions: 50°C, 15 min pre-denaturation, 95°C, 1 min, 95°C annealing for 15 s, 60°C extension for 1 min, for 39 cycles.

[0053] PCR primers are as follows:

[0054] hCCL20-PF: NF01_050570, 5'-3': TTTCCGCAAGGTTCGATTTTCA (SEQ ID NO: 5);

[0055] hCCL20-PR: NF01_050571, 5'-3': GGCATCTGCGCTCTACCAT (SEQ ID NO: 6);

[0056] hNLRP3-PF: NF01_0505560, 5'-3': GATCTTCGCTGCGATCAACAG (SEQ ID NO: 7);

[0057] hNLRP3-PR: NF01_0505561, 5'-3': CGTGCATTATCTGAACCCCAC (SEQ ID NO: 8);

[0058] hGAPDH-5PF: NF01_050568, 5'-3': GGGGAGCCAAAAGGGTCATCATCT (SEQ ID NO: 9);

[0059] hGAPDH-5PR: NF01_050569, 5'-3': GAGGGGCCATCCACAGTCTTCT (SEQ ID NO: 10);

[0060] h0425-1PF: YJM3803, 5'-3': TGTCGCAATCTGCTGTCCTT (SEQ ID NO: 11);

[0061] h0425-1PR: YJM3804, 5'-3': GCTCTCCTCTGTTTGACCCC (SEQ ID NO: 12).

[0062] The results showed that after H2O2 stimulation, the expression of CCL20, NLRP3, and NOX1 in the negative control NC group was significantly upregulated compared with the blank group. Transfection of siNOX1-1 showed a significant inhibition of this upregulation effect, which had a positive effect on the treatment of PBC and PSC, and reduced the inflammation-mediated liver fibrosis process, as shown in Tables 1-3 and Figure 1-3 shown.

[0063] Table 1: Expression of CCL20 in each group of cells (x±s)

[0064]

[0065] Note: Compared with the blank control group, # P<0.05,## P<0.01; compared with the negative control group, * P<0.05, ** P<0.01.

[0066] Table 2: Expression of NLRP3 in cells of each group (x±s)

[0067]

[0068] Note: Compared with the blank control group, # P<0.05, ### P<0.001; compared with the negative control group, * P<0.05, *** P<0.001.

[0069] Table 3: Expression of NOX1 in cells of each group (x±s)

[0070]

[0071] Note: Compared with the blank control group, #### P<0.001; compared with the negative control group, **** P<0.001.

[0072] Embodiment 2:

[0073] Pharmacodynamic study of siNOX1-1 in the treatment of DDC-induced PSC model

[0074] 1. Experimental drugs and reagents

[0075] siNOX1-1, OCA (Batch No.: WX00125-137-P1A, Wuhan WuXi AppTec New Drug Development Co., Ltd.), 10% trehalose solution and DDC feed.

[0076] 2. Experimental methods:

[0077] (1) RNA drug preparation method

[0078] siNOX1-1 solution: Prepare the test substance freshly each time using enzyme-free sterile water and enzyme-free sterile tubes.

[0079] (2) OCA drug preparation method

[0080] OCA was prepared once a week by weighing an appropriate amount of OCA into a brown glass bottle, adding a calculated amount of 1% HPMC, stirring and ultrasonicating until a uniform suspension was obtained, and storing at 4°C for no more than 7 days.

[0081] (3) Experimental animal grouping and drug administration

[0082] After 12 days of adaptive feeding, male C57BL / 6J mice were randomly divided into blank control group (n=8), model control group (n=8), OCA group (n=8), and siNOX1-1 group (n=8) according to the principle of minimum difference between groups in body weight. Mice in the OCA group were intragastrically administered with drugs every day, mice in the blank control group and model control group were injected with 10% trehalose solution by tail vein twice a week, and mice in the siNOX1-1 group were injected with siNOX1-1 solution (0.5 mg / kg) by tail vein twice a week.

[0083] (4) Preparation of DDC-induced mouse PSC model

[0084] The mice in the blank control group were fed with normal feed for two weeks, and the mice in the other groups were fed with DDC feed for two weeks.

[0085] 3. Experimental results:

[0086] Treatment with siNOX1-1 can effectively reduce the area of ​​bile pigment deposition and fibrosis in the liver of DDC-induced PSC mice and improve the symptoms of liver fibrosis in mice, as shown in Tables 4-5 and Figure 4-5 , which shows that the therapeutic effect of using siNOX1-1 is better than that of using OCA, proving that the application of siNOX1-1 in the treatment of PSC is of great significance.

[0087] Table 4: Bile pigment positive area (μm2) (x±s)

[0088]

[0089]

[0090] Note: Compared with the blank control group, #### P<0.0001; compared with the model control group, **** P<0.0001.

[0091] Table 5: Liver fibrosis area (%) (x±s)

[0092]

[0093] Note: Compared with the blank control group, #### P<0.0001; compared with the model control group, *P<0.05, **P<0.01.

[0094] Embodiment 3:

[0095] Pharmacodynamic study of siNOX1-2 in the treatment of liver fibrosis caused by bile duct ligation

[0096] Cholestasis is induced by bile duct ligation. In the liver, obstruction of the extrahepatic biliary system can cause cholestasis and inflammation, leading to a strong fibrotic reaction in the area around the portal vein. Therefore, the therapeutic effect can be evaluated by auxiliary diagnostic indicators reflecting cholestasis diseases and liver fibrosis conditions.

[0097] 1. Experimental drugs and reagents

[0098] siNOX1-2 and invivo-jetPEI (polyplus catalog number: 0000000652)

[0099] 2. Experimental methods:

[0100] (1) RNA drug preparation method

[0101] 1) siNOX1-2 solution: prepare enzyme-free sterile water and 10% glucose solution containing siNOX1-2.

[0102] 2) PEI solution: Add 100 mM invivo-jet PEI solution into enzyme-free sterile water, vortex gently and centrifuge.

[0103] 3) Add the above 2) PEI solution dropwise into 1) siNOX1-2 solution, vortex gently and separate instantly.

[0104] 4) Incubate at room temperature for 15 minutes.

[0105] 5) Mark the sample name, preparation date and other information, seal the container lid with sealing film, and place it in a 4°C refrigerator for later use.

[0106] (2) Experimental animal grouping and drug administration

[0107] Male C57BL / 6 mice (8-10 weeks old, experiment started), weighing 20±1g. Feeding conditions: temperature 24-26℃, humidity 60%, light and dark 12h each. After one week of adaptive feeding, the experimental animals were randomly divided into sham operation control group (6), operation model group (10), and siNOX1-2 (0.5mg / kg) group (10). The day of operation or sham operation was recorded as D0. The siNOX1-2 (0.5mg / kg) group was injected with siNOX1-2 drug solution once in the tail vein in the first and second weeks respectively.

[0108] (3) Preparation of bile duct ligation mouse model

[0109] The mice were adaptively raised for 1 week before the experiment. All mice were fasted for 8 hours before surgery, and the room temperature was maintained at around 25°C during surgery. The mice were anesthetized by intraperitoneal injection of sodium pentobarbital (65 mg kg-1), and the skin was disinfected with ethanol. The model group mice underwent a midline incision of about 1.5 cm from the abdomen below the xiphoid process to expose the common bile duct, which was ligated in the upper half and the abdomen was sutured. Except for the ligation of the bile duct, the surgical procedures of the sham group mice were the same as those of the model group mice. The common bile duct is ligated in the upper half and not cut to allow the secretion of pancreatic juice to be unobstructed, otherwise it will lead to obstruction of pancreatic juice discharge.

[0110] (4) Blood biochemical test

[0111] The eyeballs are removed to collect blood, and the serum is separated for testing serum indicators.

[0112] (5) Pathological examination

[0113] Liver HE and Sirius red staining sections: The liver was taken from each experimental animal. The liver tissue was cut longitudinally, the middle lobe was taken, and the portal vein and other vascular systems were removed. It was fixed with 10 times the volume of 10% paraformaldehyde. After sufficient fixation, the sample was taken, routinely dehydrated, paraffin-embedded, and sliced. HE and Sirius red staining were performed, and pathology professionals read the slides under an optical microscope.

[0114] 3. Experimental results

[0115] Compared with the sham operation control group, the indicators of the operation model group were significantly increased. Figure 6-10 As shown in the results, after the application of siNOX1-2 drugs, the levels of alkaline phosphatase (ALP), glutamate aminotransferase (ALT), aspartate aminotransferase (AST) and total bilirubin (TBIL), as well as the NOX1 gene expression in each group were significantly improved.

[0116] Table 6: ALP (U / L)

[0117]

[0118] Note: Compared with the sham operation control group, ### P<0.001.

[0119] Table 7: ALT (U / L)

[0120]

[0121] Table 8: AST (U / L)

[0122]

[0123] Table 9: TBIL (μmol / L)

[0124]

[0125] Note: Compared with the sham operation control group, ## P<0.01.

[0126] Table 10: NOX1 expression in liver tissue of mice in each group

[0127]

[0128] Note: Compared with the sham operation control group, ### P<0.001.

[0129] like Figure 11-13 As shown in the figure, after the application of siNOX1-2, the degree of fibrosis in each group indicated by Sirius red histopathological staining was significantly improved compared with the surgical model group. Cholestasis can lead to increased ALP, which can cause inflammation, and more seriously lead to liver fibrosis. However, after the application of siNOX1-2, liver inflammation and liver fibrosis were significantly improved. Therefore, the application of siNOX1-2 in the treatment of PBC is of great significance.

[0130] The series of detailed descriptions listed above are only specific descriptions of feasible implementation methods of the present invention. They are not intended to limit the scope of protection of the present invention. Those skilled in the art can design many other modifications and implementation methods, which will fall within the scope and spirit of the principles disclosed in this application. More specifically, within the scope of the disclosure, drawings and claims of this application, various modifications and improvements can be made to the components and / or layout of the subject combination layout. In addition to the modifications and improvements made to the components and / or layout, other uses will also be obvious to those skilled in the art.

Claims

1. Use of a small interfering nucleic acid for inhibiting NOX1 gene expression in the preparation of a drug for primary biliary cholangitis and / or primary sclerosing cholangitis.

2. The use according to claim 1, characterized in that: The small interfering nucleic acid consists of its sense strand and its antisense strand, the sense strand and the antisense strand are completely or partially reverse complementary to form a double-stranded region, the antisense strand is reverse complementary to a segment on the target gene, the sense strand has a nucleotide sequence as shown in SEQ ID NO.1 and / or a sequence in which any nucleotide of the nucleotide sequence is modified, and the antisense strand has a nucleotide sequence as shown in SEQ ID NO.2 and / or a sequence in which any nucleotide of the nucleotide sequence is modified.

3. The use according to claim 2, characterized in that: The small interfering nucleic acid is modified with a sugar moiety at the 2' position.

4. The use according to claim 3, characterized in that: The modification of the sugar moiety is one or more of a 2'-O-methyl modification, a 2'-O-methoxyethyl modification, a 2'-O-aminopropyl modification, a 2'-deoxy modification, a T-deoxy-2'-fluoro modification, a 2'-O-aminopropyl modification, a 2'-O-dimethylaminoethyl modification, a 2'-O-dimethylaminopropyl modification, a T-dimethylaminoethoxyethyl modification or a 2'-ON-methylacetamido modification.

5. The use according to any one of claims 2 to 4, characterized in that: At least one phosphate group in the small interfering nucleic acid is a phosphate group containing a modified group, and the phosphate group containing a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom.

6. The use according to claim 5, characterized in that: The 3' end of the sense strand and / or antisense strand is connected with 1 to 4 additional nucleotides, and after complementary pairing of the sense strand and the antisense strand, at least one 3' overhang consisting of 1 to 4 nucleotides is formed.

7. The use according to any one of claims 1 or 6, characterized in that: The small interfering nucleic acid is at least one of the following two modified sequences: siNOX1-1: Justice Chain: 5'-mC-s-mU-s-mGmAmGmUmCmUmUmGfGmAfAmGTmGmGmAmUmCmCmUmUdTdT-3'; Antisense strand: 5'-mA-s-fA-s-mG-fG-fA-fU-mC-fCmAfCmUmUmCfCmAfAmGmAmCmUmCmAmGdTdT-3'; siNOX1-2: Sense strand: 5′-CsUsGAGUCUUGGAAGTmGmGmAmUmCmCmUmUdTdT-3′; Antisense strand: 5′-mA-s-mA-s-mGmGmAmUmCCACUUCCAAGACUCAGdTdT-3′; in: m means that the ribose group of the nucleotide on the right side of the letter is 2'-methoxyribose; s means that the phosphate groups between the ribonucleotides on both sides of the letter are thiophosphates; f means that the ribose group of the nucleotide on the left side of the letter is substituted by fluorine to form a 2'-fluororibose; d means that the nucleotide on the right side of the letter is a deoxyribonucleotide.

Images