Application of PD-L1 super enhancer 19 site in preparation of anti-tumor immune drugs

Abstract

The invention provides application of a No.19 site of a PD-L1 super enhancer in preparation of an anti-tumor immune drug, relates to the technical field of biomedicine, and provides application of the No.19 site of PD-L1L2-SE as a target in preparation of the anti-tumor immune drug, and the sequence of the No.19 site of PD-L1L2-SE is as shown in SEQ ID NO: 01. According to the application disclosed by the invention, an experiment proves that the No.19 site of the super enhancer PD-L1L2-SE is a key site for high expression of the PD-L1. After sgRNA-19 is edited, the expression of the PD-L1 can be obviously influenced. Compared with a control group sgV, the PD-L1L2-SE has the advantages that the PD-L1 expression can be reduced by editing the No.19 site of the PD-L1L2-SE, the immune escape of tumor cells can be reduced, and the killing effect of T cells on the PD-L1L2-SE is enhanced. Experimental results in the application show that the No.19 site of PD-L1L2-SE is a key site for high expression of PD-L1, and has great potential in preparation of antitumor drugs. The expression of the PD-L1 can be reduced and the immune escape ability of tumor cells can be eliminated by gene editing or intervening in the No.19 region of the PD-L1 super enhancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to an application of a PD-L1 super enhancer site 19 in the preparation of anti-tumor immune drugs. Background Art

[0002] Immune checkpoint blockade therapy has become the fifth major cancer treatment system after surgery, radiotherapy, chemotherapy, and molecular targeted therapy. Immune checkpoints are essential for maintaining immune homeostasis and preventing autoimmunity, and are usually activated to inhibit anti-tumor immune responses. To evade immune damage, many cancer cells express PD-1's receptor PD-L1 on their surface and limit the full activation of T cells. Although anti-PD-1 / PD-L1 drugs provide a new breakthrough treatment method with good long-term efficacy, their benefits in overall patients are still low due to low response rates and immune-related reactions. A factor that significantly affects the treatment effect of patients is drug resistance[6]. A deep understanding of the immunological basis of treatment and the regulatory process of immune checkpoint molecules is the theoretical basis for further improving immune checkpoint blockade therapy. In addition to the large differences in response rates among different tumors and the low overall response rate, immune checkpoint blockade therapy is also prone to more serious immune-related side effects. In summary, in-depth research on the regulatory mechanism of PD-L1 in tumors will help us better predict treatment effects, reduce treatment side effects, overcome drug resistance, and carry out combination therapy in a targeted manner.

[0003] In a healthy state, PD-L1 is mainly expressed in activated immune cells or antigen-presenting cells. In order to maintain immune homeostasis, the expression of PD-L1 is precisely regulated at multiple levels. In order to obtain the expression of PD-L1, tumor cells become abnormal at multiple levels and obtain high expression of PD-L1 through various pathways to produce immune escape. Different from the traditional understanding, recent studies have found that tumor cells can secrete PD-L1 through exosomes, and IFNγ produced by tumor cells can promote the secretion of exosomal PD-L1 to inhibit anti-tumor immunity [7,8]. Although tumor cells can enhance the expression of PD-L1 at multiple levels, the prerequisite for obtaining high expression of PD-L1 is the transcription of PD-L1. Therefore, a deep understanding of the transcriptional regulation of PD-L1 in tumor cells is the key to a comprehensive understanding of high expression of PD-L1. Summary of the invention

[0004] The purpose of the present invention is to solve the technical problems in the prior art.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] The use of site 19 of PD-L1L2-SE as a target in the preparation of anti-tumor immune drugs, the sequence of site 19 of PD-L1L2-SE is shown in SEQ ID NO:01.

[0007] Preferably, gene editing or intervention in region 19 of the PD-L1 super enhancer can reduce the expression of PD-L1 and eliminate the immune escape ability of tumor cells.

[0008] The present application also provides an anti-tumor immune drug, characterized in that: the drug uses region 19 of the PD-L1 super enhancer as a target.

[0009] The present application also provides a verification method for verifying the use of site 19 of PD-L1L2-SE as a target in the preparation of anti-tumor immune drugs, characterized in that it comprises the following steps:

[0010] S1: The stable cell line of sg19 was constructed in SUM159 cells, and the single clone sg19-6 cells were picked out;

[0011] S2: Immunoblotting, real-time fluorescence quantitative PCR, immunofluorescence and flow cytometry were used to verify the expression level of PD-L1 in sg19 and its monoclonal cell sg19-6.

[0012] This application proves through specific verification experiments that editing of site 19 of PD-L1L2-SE will reduce PD-L1 expression, reduce the immune escape of tumor cells, and enhance the killing effect of T cells on them. The experimental results of this application show that site 19 of PD-L1L2-SE is a key site for high expression of PD-L1 and has great potential in the preparation of anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a comparison diagram of PD-L1 expression in sg19 and its monoclonal cell sg19-6 detected by immunoblotting experiment in one embodiment of the present invention;

[0014] Figure 2 This is a comparison diagram of PD-L1 expression in sg19 and its monoclonal cell sg19-6 detected by real-time fluorescence quantitative PCR experiment in one embodiment of the present invention;

[0015] Figure 3 This is a comparison diagram of PD-L1 expression in sg19 and its monoclonal cell sg19-6 detected by immunofluorescence experiment in one embodiment of the present invention;

[0016] Figure 4This is a comparison diagram of PD-L1 expression in sg19 and its monoclonal cell sg19-6 detected by flow cytometry in one embodiment of the present invention;

[0017] Figure 5 This is a comparison diagram of the 30 bp DNA sequences around site 19 of the wild type and sg19 in one embodiment of the present invention. DETAILED DESCRIPTION

[0018] The present invention is further described in detail below in conjunction with specific embodiments.

[0019] The use of site 19 of PD-L1L2-SE as a target in the preparation of anti-tumor immune drugs, the sequence of site 19 of PD-L1L2-SE is shown in SEQ ID NO: 01.

[0020] Gene editing or intervention in region 19 of the PD-L1 super enhancer can reduce the expression of PD-L1 and eliminate the immune escape ability of tumor cells.

[0021] The present application also provides an anti-tumor immune drug, which targets region 19 of the PD-L1 super enhancer.

[0022] The present application also provides a verification method for verifying the use of site 19 of PD-L1L2-SE as a target in the preparation of anti-tumor immune drugs, comprising the following steps:

[0023] S1: The stable cell line of sg19 was constructed in SUM159 cells, and the single clone sg19-6 cells were picked out;

[0024] S2: Immunoblotting, real-time fluorescence quantitative PCR, immunofluorescence and flow cytometry were used to verify the expression level of PD-L1 in sg19 and its monoclonal cell sg19-6.

[0025] The following is an explanation of the above content in combination with specific verification experiments:

[0026] Cell culture:

[0027] The SUM159 cells used in the experiment were cultured in DMEM medium containing 10% fetal bovine serum and 1% double antibiotic (a mixture of penicillin and streptomycin), and 5% CO2 was given at a temperature of 37°C. The Jurkat cells used in the experiment were cultured in RPMI medium containing 10% fetal bovine serum and 1% double antibiotic (a mixture of penicillin and streptomycin), and 5% CO2 was given at a temperature of 37°C.

[0028] Cell transfection:

[0029] ① The gene editing vector constructed using sg19 plasmid as the starting vector has puromycin resistance and can be used for positive clone cell screening.

[0030] ② Determine the minimum lethal dose of puromycin for normal cells, inoculate SUM159 cells into 6-well plates with a cell density of about 70%, and culture them in serum-containing DMEM medium for 24 hours. Transfect the cells with the constructed gene editing vector at a transfection dose of 1 μg / mL, change the medium after 6 hours, and continue culturing. After 48 hours, replace the medium containing puromycin for culturing. Change the medium every 2-3 days, and gradually increase the concentration of puromycin contained in the medium until the minimum lethal dose for normal cells is reached. After about 2-3 weeks, the screening cell line is obtained.

[0031] Western blotting

[0032] ① Total cell protein extraction

[0033] Aspirate the culture medium and wash the cells with PBS; add an appropriate amount of cell lysis buffer to the cells and add PMSF proteasome inhibitor before use; scrape the cells with a cell scraper and collect them into a clean EP tube; shake at 200 rpm on ice for 45 min; centrifuge at 12000 rpm for 15 min at 4°C, take the supernatant and add 5× protein loading buffer, boil in a metal bath at 105°C for 5 min, and store in a -80°C refrigerator.

[0034] ② Gel electrophoresis and protein immunoassay

[0035] 1) Prepare glue: clean the glass plates, add ultrapure water between the glass plates, and observe whether the liquid level drops. If the liquid level does not drop, pour out the water and absorb the remaining water with filter paper; prepare separation glue first, add TEMED at the end and mix quickly, slowly add separation glue with a 1000μL pipette, be careful not to have bubbles, and add isopropanol to seal the glue; wait for about 30 minutes for gelation, pour out the isopropanol, rinse with ultrapure water until it is odorless, and absorb the remaining water with filter paper; prepare concentrated glue, fill the remaining space, and insert a comb; wait for gelation, and remove the glue and the plate together.

[0036] 2) Electrophoresis: Clamp the gel plate and add electrophoresis solution to check for leaks; place it in the electrophoresis tank, unplug the comb, add marker and sample, pour electrophoresis solution into the outer box, covering the bottom to form a current path; select a suitable cover, connect the power supply, and keep the voltage at 80V; observe every 10-15 minutes, and when the marker is found to run away, change the voltage to 120V and continue.

[0037] 3) Transfer: The glue, PVDF membrane and filter paper should be kept moist, and there should be no bubbles on the glue. The PVDF membrane should be placed in methanol first, then in ultrapure water, and finally in the transfer solution in the order of cotton pad, filter paper, glue strip, PVDF membrane, filter paper and cotton pad; place the transfer clip in the transfer tank, black against black, and place the entire transfer box in ice water. The transfer conditions are set to a constant current of 300mA and 70min.

[0038] 4) Blocking: Prepare 5% skim milk powder with TBST. After the transfer, place the PVDF membrane in 5% skim milk powder for blocking. Shake at 50-60 rpm for 2 hours.

[0039] 5) Antibody incubation: discard the blocking solution, wash the membrane with TBST 90 for 5 min × 3 times; incubate with the corresponding primary antibody, shake at 50-60 rpm at 4°C overnight; recover the primary antibody, wash the membrane with TBST 90 for 5 min × 3 times; incubate with the corresponding secondary antibody, shake at 50-60 rpm for 2 h; wash with TBST 20 min × 3 times.

[0040] 6) Development: Prepare ECL developer and use it immediately. Develop the membrane on a chemiluminescence imager.

[0041] Quantitative RT-PCR

[0042] ① Total RNA extraction from cells

[0043] 1) After trypsin digestion of cells, transfer to RNase-free EP tube, centrifuge at 1000 rpm for 5 min, discard the supernatant, collect the cell pellet, add 1 mL Trizol and mix by pipetting repeatedly.

[0044] 2) The homogenized sample was placed at room temperature for 5 minutes to completely separate the nucleic acid-protein complex; 0.2 mL of chloroform was added to every 1 mL of Trizol lysis buffer, and the mixture was shaken vigorously for 15 seconds and placed at room temperature for 3 minutes.

[0045] 3) Centrifuge at 12,000 rpm for 15 min at 4°C and layer the sample; transfer the supernatant to a new EP tube, add an equal amount of isopropanol to precipitate RNA, and leave at room temperature for 10 min.

[0046] 4) Centrifuge at 12,000 rpm for 10 min at 4°C. After centrifugation, a gelatinous precipitate will appear on the sides and bottom of the tube. Remove the supernatant.

[0047] 5) Wash the RNA precipitate with 1 mL of 75% ethanol, centrifuge at 7500 rpm for 5 min at 4°C, remove the supernatant, and repeat this step twice.

[0048] 6) Leave the dried RNA precipitate at room temperature for about 5-10 minutes, add 20-100 mL of RNase-free ultrapure water, pipette several times, place at 55-60℃ for 10 minutes to dissolve the RNA, and store at -80℃.

[0049] ②Reverse transcription of RNA into cDNA

[0050] in accordance with II Reverse Transcriptase Instructions Reverse transcription of RNA to synthesize cDNA. The reaction system is as follows:

[0051]

[0052] ③RT-PCR

[0053] qRT-PCR amplification was performed according to the instructions of the AceQ qRT-PCR SYBR Green MasterMix Kit:

[0054] 1) Place the eight-tube strip on ice, then add 5 μL of SYBR Green reagent, 0.2 μL of each upstream and downstream primer, 2.6 μL of RNase-free ddH2O, and 2 μL of template cDNA, and mix thoroughly.

[0055] 2) Place the mixed reaction system into the qRT-PCR instrument and enter the corresponding reaction parameters: 95℃15min, 95℃15sec, 60℃60sec, 40 cycles. Record and analyze the data. -△△ The Ct method was used to calculate gene expression.

[0056] 3) Primers

[0057] Table 1 RT-PCR primers for PD-L1 and sgRNA primers for establishing locus 19 defective cells

[0058]

[0059] Flow cytometry:

[0060] ① Digest with 200 μL of trypsin (observe under a microscope, the cells are completely rounded), terminate the digestion with 500 μL of DMEM containing 10% FBS, collect the cells by centrifugation, and ensure that the amount of cells in each tube is similar, about the amount of cells in a six-well plate.

[0061] ② Resuspend and wash once with 500μL PBS (to prevent cells from being sucked away, some liquid can be retained).

[0062] ③ Prepare the staining MIX in advance: (100μL PBS+0.25μL Ab)X(n+2) system and wrap it with tin foil.

[0063] ④Add mix to resuspend cells, wrap in tin foil and shake on ice for 30 minutes to avoid light.

[0064] ⑤ Resuspend and wash the cells once with 500 μL PBS, centrifuge, and keep the cell pellet (to prevent the cells from being sucked away, some liquid can be retained).

[0065] ⑥Add 300μL PBS, resuspend the cells, and test on the machine.

[0066] Immunofluorescence:

[0067] Prepare in advance: round coverslip, small tweezers, 24-well plate

[0068] 4% PFD (paraformaldehyde): Na2HPO4·12H2O 73g, NaH2PO4·2H2O 3.85g, add 1000mL ddH2O, and heat to dissolve.

[0069] 0.2% Triton X-100: 10mL PBS+20μL Triton X-100

[0070] 1% BSA: 10 mL PBS + 0.1 g BSA

[0071] ① Use tweezers to place the round glass slide into a 24-well plate (the round cover glass has been disinfected with 75% alcohol), wash the round glass slide with PBS, and then inoculate the cells into the 24-well plate to a seeding density of 60%, and treat the cells with drugs for 24 hours.

[0072] ② Wash the cells three times with 500 μL of PBS in each well, each time for 5 min.

[0073] ③ Remove PBS, add 200 μL 4% paraformaldehyde to each well, and fix at room temperature for 15 minutes.

[0074] ④ Remove paraformaldehyde and wash the cells three times with 500 μL PBS per well, each time for 5 min; add 500 μL 1% BSA to each well and block at room temperature for 2 h.

[0075] ⑤ Remove the blocking solution, add 200 μL primary antibody (BSA dilution ratio is 1:200) to each well, and store in a 4°C refrigerator overnight.

[0076] ⑥ Recover antibodies, wash each well with 500 μL PBS for 5 min × 3 times, add 200 μL fluorescent secondary antibody, incubate at room temperature for 2 h, and protect from light.

[0077] ⑦ Remove the secondary antibody, wash each well with 500 μL PBS for 5 min × 3 times, add Hochest (1:200 PBS dilution), incubate at room temperature for 10 min, and avoid light.

[0078] ⑧ Remove Hochest and wash the cells 3 times with 500μL PBS, 5 min each time; drop a small drop of anti-fading agent on the slide, take the cover slip out of the well, and cover it face down on the anti-fading agent, making it lightly touch the slide (be careful of bubbles), and protect it from light.

[0079] ⑨ Place the slide in a dark place for 15 minutes, let it dry, and observe the fluorescence intensity and distribution under a fluorescence microscope.

[0080] Statistical analysis

[0081] All experiments were repeated at least three times, and all data were expressed as mean ± standard deviation. The variance analysis method was used to reflect the significant difference between the experimental group and the control group. SPSS21.0 software was used for analysis, and P < 0.05 indicated that the difference was statistically significant.

[0082] Based on the above experimental steps, the present application constructed a stable cell line of sg19 in SUM159 cells, and selected the monoclonal cell sg19-6 cells. Figure 1 ), real-time fluorescence quantitative PCR experiment ( Figure 2 ), immunofluorescence assay ( Figure 3 ) and flow cytometry experiments ( Figure 4 ) showed that the expression of PD-L1 in sg19 and its monoclonal cell sg19-6 was significantly decreased. In this application, the 30bp DNA sequence around the 19th site of the wild type and sg19 was further sequenced and analyzed ( Figure 5 ).

[0083] That is, editing of site 19 of PD-L1L2-SE will reduce the expression of PD-L1, reduce the immune escape of tumor cells, and enhance the killing effect of T cells on them. The experimental results of this application show that site 19 of PD-L1L2-SE is a key site for high expression of PD-L1 and has great potential in the preparation of anti-tumor drugs.

[0084] In summary, the experimental results of this application show that site 19 of the super enhancer PD-L1L2-SE (TAGGAGGGGCCTCATAGATTGGCTGGTGACATA; chr9:5,499,552-5,499,584) is a key site for high expression of PD-L1. This application has demonstrated through verification experiments that sgRNA-19 editing can significantly affect the expression of PD-L1. Compared with the control group sgV, editing of site 19 of PD-L1L2-SE will reduce the expression of PD-L1, reduce the immune escape of tumor cells, and enhance the killing effect of T cells on them. The experimental results in this application show that site 19 of PD-L1L2-SE is a key site for high expression of PD-L1, and has great potential in the preparation of anti-tumor drugs. Gene editing or intervention in region 19 (chr9:5,499,552-5,499,584) of the PD-L1 super enhancer can reduce the expression of PD-L1 and eliminate the immune escape ability of tumor cells.

Claims

1. The use of site 19 of PD-L1L2-SE as a target in the preparation of anti-tumor immune drugs, characterized in that: The sequence of site 19 of the PD-L1L2-SE is shown in SEQ ID NO:

01.

2. The use of site 19 of PD-L1L2-SE according to claim 1 as a target in the preparation of anti-tumor immune drugs, characterized in that: Gene editing or intervention in region 19 of the PD-L1 super enhancer can reduce the expression of PD-L1 and eliminate the immune escape ability of tumor cells.

3. An anti-tumor immune drug, characterized in that: The drug targets region 19 of the PD-L1 super enhancer.

4. A verification method for verifying the use of site 19 of PD-L1L2-SE as a target in the preparation of anti-tumor immune drugs, characterized in that: The following steps are involved: S1: The stable cell line of sg19 was constructed in SUM159 cells, and the single clone sg19-6 cells were picked out; S2: Immunoblotting, real-time fluorescence quantitative PCR, immunofluorescence and flow cytometry were used to verify the expression level of PD-L1 in sg19 and its monoclonal cell sg19-6.

Images