Application of miR-34b-5p inhibitor in preparation of medicine for treating gastrointestinal diseases

Abstract

The invention discloses application of a miR-34b-5p inhibitor in preparation of a medicine for treating gastrointestinal diseases, and belongs to the technical field of biological medicines. The miR-34b-5p inhibitor disclosed by the invention is derived from exosome derived from gastric juice of a gastroesophageal reflux patient. The polypeptide can be used for regulating the influence of the gastric juice exosome of a gastroesophageal reflux patient on an epithelial cell barrier, so that symptoms are improved, inflammatory response is relieved, a new target spot and scheme are provided for treating gastroesophageal reflux diseases, and the polypeptide has important clinical value and good clinical application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of a miR-34b-5p inhibitor in the preparation of a drug for treating gastrointestinal diseases. Background Art

[0002] Gastroesophageal reflux disease (GERD) is a series of diseases in which gastric contents reflux into the esophagus, causing symptoms or complications [1]. GERD seriously affects people's health and quality of life, and also places a huge burden on social medical resources. However, due to its complex pathogenesis, the mechanism of GERD has not been fully elucidated, resulting in poor treatment results.

[0003] Currently, proton pump inhibitors (PPIs) remain the drug of choice for gastroesophageal reflux disease. Although the PPI test is used as a diagnostic test for patients with typical symptoms of heartburn and reflux, the sensitivity of this method is only 80% and the specificity is 74%. In addition, up to 45% of patients treated with PPIs may continue to experience side effects. Long-term use of PPIs may cause certain adverse reactions, such as small intestinal bacterial overgrowth, opportunistic infections, osteoporosis-related fractures, chronic kidney disease, certain vitamin and mineral deficiencies, and dementia. Therefore, for some patients who may not be effective or tolerate drug treatment, surgical treatment needs to be considered. However, surgical treatment may have certain risks, such as surgical complications, esophageal stenosis, etc. Therefore, studying the mechanism of GERD and accurately administering the drug is a major challenge in the treatment of GERD.

[0004] The gastrointestinal epithelial barrier is the key to triggering the body's immune response and maintaining gastrointestinal homeostasis. Tight junctions (TJs) are the most important components of the barrier formed by epithelial cells, and they regulate the permeability of the barrier by tightly sealing cell-cell junctions. TJ proteins are represented by claudin, occludin, junctional adhesion molecules, and occludin scaffold protein zona occlusus, which directly bind to the scaffold protein zona occlusus (ZOs). Among these TJ proteins, claudin is the main component of TJ and is responsible for the barrier and polarity of epithelial cells. Gastrointestinal diseases including reflux esophagitis, inflammatory bowel disease, functional gastrointestinal diseases, and cancer may be regulated by these molecules, and the disruption of their functions leads to chronic inflammation and chronic or progressive diseases. Regulating the barrier function of epithelial cells by regulating the expression and localization of TJ proteins is a potential new target for the treatment of GERD. If the generation of symptoms and immune dysfunction are regulated by improving mucosal barrier function, the treatment strategies of these diseases may be greatly changed. However, no drugs targeting gastrointestinal barrier dysfunction have entered the clinic so far. miRNAs are a group of small, noncoding, endogenous RNAs that negatively regulate target genes, usually by pairing with imperfectly complementary sequences in the 3' untranslated region (UTR) of the target gene, resulting in mRNA cleavage and translational repression. Evidence for the regulation of GERD by altered miRNAs is increasing, and studies have found that miRNAs can inhibit the proliferation, migration, and invasion of Barrett's esophageal cells.

[0005] Studies have shown that miRNAs in gastric juice are stable and can be used as new biomarkers for GC. Extracellular vesicles (EVs) are double-membrane vesicle structures released by cells into the extracellular matrix. They are currently divided into three main types: exosomes (less than 150 nm in diameter), microvesicles / shedding particles, and apoptotic bodies (all considered to have a diameter greater than 100 nm). Exosomes can carry many cellular components, including DNA, RNA, proteins, and lipids, which are essential for cell communication and material exchange. Therefore, the study of gastric fluid exosomal miRNAs on the epithelial barrier is of great significance for a deeper understanding of the pathogenesis, clinical manifestations, and pathological characteristics of gastroesophageal reflux disease. Summary of the invention

[0006] In order to solve the above problems, the present invention proposes the use of a miR-34b-5p inhibitor in the preparation of a drug for treating gastrointestinal diseases.

[0007] On the one hand, a miR-34b-5p inhibitor is proposed for use in the preparation of drugs for treating gastrointestinal diseases, mainly for gastrointestinal disease drugs including drugs for preventing and / or treating esophageal reflux, drugs for inhibiting epithelial barrier damage and drugs for treating gastrointestinal inflammatory processes.

[0008] Furthermore, the miR-34b-5p is derived from exosomes, especially exosomes derived from gastric fluid of patients with gastroesophageal reflux. The miR-34b-5p inhibitor is AAV, derived from the recombinant expression plasmid TuD (mmu-miR-34b-5p).

[0009] Furthermore, the nucleotide sequence fragment of the recombinant expression plasmid TuD (mmu-miR-34b-5p) is: GGTGGCGCTAGGATCATCAACACAATCAGCTAATATCTTACACTGCCTCAAGTATTCTGGTCACAGAA TACAACACAATCAGCTAATATCTTACACTGCCTCAAGATGATCCTAGCGCCACCTTTTTT.

[0010] Furthermore, the forward sequencing primer of the recombinant expression plasmid TuD (mmu-miR-34b-5p) is: pAKD-FTCATCAACCCGCTCCAAGGAAT; the reverse sequencing primer is: pAKD-RCAAGCTCGAAATTAACCCTCA C.

[0011] Furthermore, the miR-34b-5p inhibitor is a product that inhibits the expression or activity of miR-34b-5p.

[0012] Furthermore, the product includes miRNA mimics capable of inhibiting the expression of miR-34b-5p, and / or a plasmid vector for overexpression of miR-34b-5p, and / or an adeno-associated virus vector for blocking miR-34b-5p.

[0013] The miR-34b-5p inhibitor (AAV miR-34b-5p-TuD ) comprises the following steps:

[0014] (1) The recombinant expression plasmid TuD (mmu-miR-34b-5p) was co-transfected with pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging). Recombinant AAV was assembled in the packaging cells 2-3 days after transfection;

[0015] (2) Collect infected AAV-293 cells, lyse and release AAV-miR-34b-5p-TuD particles; concentrate and purify the collected viral supernatant by density gradient centrifugation and ultrafiltration; and determine the titer of the obtained virus by quantitative PCR.

[0016] Furthermore, the individual administration amount of the miR-34b-5p inhibitor is 1.0E+11 v.g.-1.0E+13 v.g.

[0017] The use of the miR-34b-5p inhibitor of the present invention in the preparation of drugs for treating gastrointestinal diseases has the beneficial effect that the miR-34b-5p inhibitor of the present invention can be used to regulate the effect of gastric fluid exosomes of patients with gastroesophageal reflux on the epithelial cell barrier, thereby improving symptoms and reducing inflammatory responses, providing a new target and scheme for the treatment of gastroesophageal reflux disease, and having important clinical value and good clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the implementation mode of the present invention or the technical solution in the prior art, the drawings required for the implementation mode or the prior art description are briefly introduced below. Obviously, the drawings described below are only exemplary. For ordinary technicians in this field, other implementation drawings can be derived from the provided drawings without creative work. The structure, proportion, size, etc. illustrated in this specification are only used to match the content disclosed in the specification for people familiar with this technology to understand and read, and are not used to limit the limiting conditions that the present invention can be implemented, so it has no technical substantive significance. Any structural modification, change in proportional relationship or adjustment of size, without affecting the effect that the present invention can produce and the purpose that can be achieved, should still fall within the scope that the technical content disclosed by the present invention can cover.

[0019] Figure 1 The results of identification of exosomes from healthy subjects and GERD patients are shown in Figure 2. Figure 1 A shows the morphology and size of exosomes identified by electron microscopy and NTA; Figure 1 B is immunoblotting to detect exosome surface marker proteins; Figure 1 C is a schematic diagram of HEEC cells and MKN45 cells phagocytosing exosomes observed under a fluorescence microscope.

[0020] Figure 2 It is the result of gastric exosomes from patients with gastroesophageal reflux destroying the gastric and esophageal epithelial barriers in vitro; Figure 2 A is the TEER change diagram detected by RTCA; Figure 2 B is the fluorescein isothiocyanate-dextran 4 (FITC-Dextran 4, FD4) permeation experiment; Figure 2 C, Figure 2 D, Figure 2 E: Western blotting, qPCR, and immunofluorescence detection of tight junction protein ZO-1.

[0021] Figure 3This is a schematic diagram of the damage of gastric exosomes from gastroesophageal reflux patients to the gastroesophageal epithelial barrier in vivo; compared with the PBS group, N-exo group, and GERD-supernatant group, gavage of C57 mice in the GERD-exo group can cause gastric and esophageal inflammation; Figure 3 A is the general outline of the stomach and esophagus; Figure 3 B is HE staining of stomach; Figure 3 C is HE staining of esophagus; Figure 3 D is immunohistochemical staining of INOS in the stomach; Figure 3 E is immunohistochemical staining of INOS in the esophagus; Figure 3 F is the injury score statistic of the general body; Figure 3 G is the pathological scoring statistics of the stomach and esophagus; Figure 3 H is the penetration experiment of fluorescein isothiocyanate-dextran 4 (FITC-Dextran 4, FD4) in mice; Figure 3 I is the colloidal gold method for detecting mouse serum barrier-related indicators such as diamine oxidase, D-lactate, and bacterial endotoxin.

[0022] Figure 4 Schematic diagram of differential miRNA-mediated gastric and esophageal barrier dysfunction for sequencing and analysis of transcriptome of gastric exosomes in healthy subjects and GERD patients; Figure 4 A is the Venn diagram, volcano diagram and functional bubble diagram of transcriptomic sequencing analysis. The miRNAs (miR-1293, miR-34c-3p, miR-556-5p, miR-34b-5p) with significant differential expression in gastric exosomes were screened out from the volcano diagram. Figure 4 B is the effect of several miRNAs on barrier proteins after transfection of MKN45 cells; Figure 4 C is the change of barrier protein zo-1 and occludin-1 after transfection of miR-556-5p and miR-34b-5p into MKN45 and HEEC. Figure 4 D is qPCR detection of the changes in barrier protein zo-1 after MKN45 and HEEC were transfected with miR-556-5p and miR-34b-5p.

[0023] Figure 5 Overeating HFD-alcohol gastroesophageal reflux disease model in mice; Figure 5 A is the scheme for model establishment; Figure 5 B. Gastroesophageal macroscopy; Figure 5 C is HE staining of stomach. Figure 5 D is HE staining of esophagus; Figure 5E is histochemical iNOS staining of the stomach; Figure 5 F is histochemical iNOS staining of esophagus; Figure 5 G is the penetration experiment of fluorescein isothiocyanate-dextran 4 (FITC-Dextran 4, FD4) in mice; Figure 5 H is the colloidal gold method for detecting mouse serum barrier-related indicators such as diamine oxidase, D-lactate, and bacterial endotoxin.

[0024] Figure 6 The miR-34b-5p inhibitor of the present invention (AAV miR-34b-5p-TuD ) for treating an animal model of gastroesophageal reflux disease; wherein Figure 6 A is the general outline of the stomach and esophagus; Figure 6 B is HE staining of stomach; Figure 6 C is HE staining of esophagus; Figure 6 D is histochemical iNOS staining of the stomach; Figure 6 E is histochemical iNOS staining of esophagus; Figure 6 F is the serum barrier related index detected by colloidal gold method. DETAILED DESCRIPTION

[0025] The present invention will be further described in detail below with reference to specific embodiments.

[0026] Example 1

[0027] The extraction of gastric exosomes of the present invention comprises the following steps:

[0028] (1) Collection of gastric juice specimens from patients with gastroesophageal reflux disease (GERD) and healthy subjects:

[0029] Patients with GERD symptoms such as heartburn and acid reflux were selected. All patients were given the GerdQ (gastroesophageal reflux disease questionnaire, GerdQ) questionnaire, signed informed consent, and underwent upper gastrointestinal endoscopy, high-resolution esophageal manometry, esophageal 24 pH monitoring and other examinations to assess whether they met the diagnostic criteria for gastroesophageal reflux disease (and its subtypes); gastroesophageal reflux disease was based on the diagnostic criteria for gastroesophageal reflux disease and referred to the "2020 Chinese Gastroesophageal Reflux Disease Expert Consensus"; at the same time, gastric juice from healthy normal subjects was extracted as a specimen for collection and standby;

[0030] (2) Extraction of gastric exosomes from patients with gastroesophageal reflux disease (GERD) and healthy subjects

[0031] The ultra-high speed differential centrifugation method is used to extract gastric fluid exosomes from the gastric fluid specimens of healthy normal patients in step (1), and the specific steps are as follows: dissolve the gastric fluid at room temperature, add the same volume of phosphate buffer to dilute, and centrifuge at 4°C and 800×g for 10 min; take the supernatant after centrifugation, centrifuge at 4°C and 3000×g for 30 min; take the supernatant after centrifugation, centrifuge at 4°C and 10000×g for 60 min, and filter the supernatant with a 0.22 μm needle filter; the filtered solution is subjected to ultracentrifugation at 4°C and 100000×g for 70 min to obtain exosome precipitate; then add an appropriate amount of phosphate buffer and ultracentrifuge at 4°C and 100000×g for 60 min for washing, and the washed exosome precipitate is resuspended in 200 μL phosphate buffer to obtain the final gastric fluid exosomes.

[0032] Identification of gastric exosomes

[0033] Identification method 1: Observe the morphology of exosomes by TEM; detect the particle size distribution, movement and concentration of exosomes by nanoparticle technology ( Figure 1 A);

[0034] Identification method 2: Western blot was used to detect the expression of gastric exosome surface marker proteins Alix and TSG101 ( Figure 1 B).

[0035] Identification method 3: HEEC and MKN45 cells take up gastric fluid exosomes: After separation from HEEC and MKN45 culture medium, exosomes were labeled with Dil fluorescent dye. 10 μg of Dil-stained exosome solution or control solution was added to DMEM and co-cultured with HEEC and MKN45 slides for 24 hours, washed and fixed with 4% formaldehyde solution for 15 minutes, the slides were washed with PBS, and the nuclei were stained with 4',6-dibutyl-2-phenylethylene extended gold anti-fading reagent (DAPI), covered with a lid, and observed under a confocal microscope ( Figure 1 C).

[0036] Example 2

[0037] Verification of the exosomes of the present invention on gastroesophageal epithelial barrier damage in vitro

[0038] Exosome treatment groups: PBS group; exosomes derived from gastric juice of healthy normal people group (N-exo); supernatant of gastric juice of gastroesophageal reflux disease patients without exosomes group (GERD-supernatant); exosomes derived from gastric juice of gastroesophageal reflux disease patients (GERD-exo).

[0039] 2.1. Detection of transmembrane electrical resistance (TEER)

[0040] HEEC and MKN45 cells in logarithmic growth phase were cultured at 5×103 100 cells / well were inoculated in a 96-well plate supporting RTCA, and the growth curve was about to reach the plateau phase. After the cells differentiated into a dense layer structure, PBS buffer, N-exo, GERD-supernatant, GERD-exo were co-cultured with epithelial cells to detect the changes in transmembrane resistance within 48 hours. The results were as follows Figure 2 As shown in A.

[0041] from Figure 2 The results of A showed that GERD-exo could enhance the permeability of gastric epithelial cells (MKN45) and esophageal epithelial cells (HEEC), thereby destroying the gastric and esophageal epithelial barriers.

[0042] 2.2 Barrier permeability test

[0043] HEEC and MKN45 cells in logarithmic growth phase were cultured at 5×10 4 Each well was inoculated into a transwell plate and cultured for 21 days. After the cells differentiated into a dense layer structure, PBS, N-exo, and GERD-supernatant, GERD-exo were co-cultured with epithelial cells for 24 hours, and then 1 mg / mL of fluorescein isothiocyanate-dextran (FITC-Dextran4000, FD4) was added to the transwell plate, and PBS was added to the lower chamber. After incubation at 37°C for two hours, the liquid in the lower chamber was aspirated into a 25×96-well plate, with three wells for each sample. The fluorescence was detected using an ELISA reader at an excitation wavelength of 492 nm and an emission wavelength of 520 nm. The results were as follows: Figure 2 As shown in B, the results showed that GERD-exo can increase the permeability of gastroesophageal epithelium ( Figure 2 B).

[0044] 2.3 Effects of exosomes on gastroesophageal barrier damage

[0045] Using immunoblotting, HEEC and MKN45 cells in logarithmic growth phase were cultured at 5×10 3100 cells / well were inoculated in a 96-well plate supporting RTCA, and the growth curve was about to reach the plateau phase. After the cells differentiated into a dense layer structure, PBS buffer, N-exo, GERD-supernatant, GERD-exo were co-cultured with epithelial cells for 24 hours. Then the cells were rinsed with pre-cooled PBS to remove residual culture medium and cell debris. The cells were lysed for 20 minutes with 1×RIPA lysis buffer without EDTA and containing protease inhibitors. The whole process was operated on ice. The cell lysate was collected in an EP tube, placed in a 4°C centrifuge, and centrifuged at 12000rpm / min for 10 minutes. The precipitate was discarded and the supernatant was collected, transferred to a new EP tube, and the protein concentration was quantitatively determined using QuickStartTM Bradford 1×Dye Reagent. Then 5 times the loading buffer was added to fully wrap the protein solution, and the protein was denatured by a 95°C metal bath for 10 minutes.

[0046] Add 30 μg of protein to a 10% polyacrylamide gel electrophoresis tank. After loading, run the electrophoresis at 80V for 30 minutes to flatten the sample, and then adjust the voltage to 120V for electrophoresis. After the electrophoresis, transfer the protein to a PVDF membrane, transfer the membrane at 250 mA and transfer medium for 2.5 hours, and then block it with 10% skim milk powder at room temperature for 1 hour. After blocking, rinse the remaining milk with TBST, then add the primary antibody ZO-1, and incubate the membrane with the primary antibody at 4°C overnight. Recover the primary antibody and wash the membrane three times with TBST for 5 minutes each time. Then add the HRP-conjugated secondary antibody and incubate at room temperature for 1 hour. Use UltraSignalTMECL protein blotting development reagent for imaging and detect it with the Bio-Rad ChemiDoc MP all-purpose imaging system, such as Figure 2 As shown in C.

[0047] 2.4 Effects of exosomes on gastroesophageal barrier damage

[0048] qPCR was used to detect the HEEC and MKN45 cells in the logarithmic growth phase. 31000 μL of chloroform was added to the 96-well plate provided with RTCA, and the growth curve was about to reach the plateau phase. After the cells differentiated into a dense layer structure, PBS buffer, N-exo, GERD-supernatant, and GERD-exo were co-cultured with epithelial cells for 24 hours. The cells were then rinsed with pre-cooled PBS to remove residual culture medium and cell debris. 600ul Trizol was added for homogenization, and the solution was repeatedly blown until it became transparent. 200 microliters of chloroform was added to the EP tube, and it was shaken vigorously for 15 seconds. After standing at room temperature for 3 minutes, it was centrifuged at 4°C and 12000rpm for 10 minutes. The sample will be divided into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 0.5ml. The aqueous phase was transferred to a new tube, an equal volume of isopropanol was added, and it was vortexed and allowed to stand for five minutes, and then centrifuged at 4°C and 12000rpm for 10 minutes. The supernatant was discarded, 500 μL of anhydrous ethanol was added, and the precipitate was collected by centrifugation at 4°C and 12000 rpm for 10 min after washing. After the liquid evaporated, enzyme-free water was added to dissolve the precipitate to obtain miRNA. Then, the reverse transcription kit ChamQ Universal SYBR qPCR MasterMix was used to reverse transcribe into cDNA, and primers were designed and qPCR experiments were performed to detect the expression of ZO-1 in tissues. The results were as follows: Figure 2 As shown in D.

[0049] 2.5 Effect of exosomes on the tightness of protein junctions between gastroesophageal epithelial cells

[0050] Immunofluorescence was used for detection. HEEC and MKN45 cells in logarithmic growth phase were plated at 5×10 5The density of cells / well was inoculated on the pretreated coverslips in the six-well plate. The coverslips were pre-soaked in acid (potassium dichromate and sulfuric acid) for 12 hours, washed with ultrapure water, and then soaked in 95% ethanol. When using, tweezers and needles were used to help pick up the slides, and the ethanol was burned in the flame, and then placed in the six-well plate. After cooling, the cell suspension was added. After the cells adhered to the wall, PBS, N-exo, GERD-supernatant, GERD-exo were intervened until the cells crawled on the slide. After 24 hours, the supernatant was discarded, and the cells were washed with TBS and fixed with 4% paraformaldehyde (Paraformaldehyde, PFA) for 15 minutes at room temperature. TBS was soaked three times for three minutes each time, and TBS was dried with absorbent paper. Normal goat serum was added to the slides and blocked at room temperature for 30 minutes. The blocking solution was absorbed with absorbent paper, and no washing was done. A sufficient amount of diluted primary antibody (ZO-1) was added to each slide and placed in a wet box and incubated overnight at 4°C. DAPI was added and incubated in the dark for 5 minutes to stain the nucleus of the specimen. The excess DAPI was washed off with TBS for 5 minutes × 4 times. The coverslip was washed three times with TBS, taken out and dried in the air, and sealed with FluorSaveTM anti-fluorescence quenching sealing agent. The results are as follows: Figure 2 As shown in E.

[0051] The results of immunoblotting, immunofluorescence and qPCR experiments showed that GERD-exo could reduce the tight junction protein ZO-1 in the gastroesophageal epithelium, while GERD-supernatant had no significant damage to the barrier.

[0052] Example 3

[0053] Validation of miR-34b-5p overexpression and inhibition on gastroesophageal epithelial cell barrier damage in vitro

[0054] Groups: miRNA overexpression control group (minic control); miRNA inhibition control group (inhibitorcontrol); miR-556-5p overexpression group (miR-556-5p minic); miR-34b-5p overexpression group (miR-34b-5pminic); miR-556-5p inhibition group (miR-556-5p inhibitor); miR-34b-5p inhibition group (miR-34b-5pinhibitor).

[0055] By using high-throughput sequencing technology and other methods, the types and expression differences of miRNAs in the gastric juice of GERD patients and healthy people were analyzed, and miRNAs closely related to the pathogenesis of the disease were identified (see Figure 4 A). Through in vitro experiments, these miRNAs were transfected into epithelial cell lines to observe their effects on epithelial cell barrier function (see Figure 4 B), miRNAs with significantly changed expression levels in gastric fluid exosomes were screened as miR-34b-5p and miR-556-5p, and further functional studies were performed. The above groups were transfected into HEEC cells and MKN45 cells, respectively, and tight junction proteins were detected according to the immunoblotting and q-PCR techniques in Examples 2.3 and 2.4. The results showed that miR-34b-5p significantly enhanced the permeability of gastric and esophageal epithelial cells and reduced the expression of tight junction proteins, thereby destroying the gastric and esophageal epithelial barriers and causing gastric and esophageal inflammation; while the inhibitor of miR-34b-5p blocked the barrier-destroying effect of GERD exosomes, thereby improving symptoms and reducing inflammatory responses.

[0056] Example 4

[0057] The effect of the exosomes of the present invention on gastroesophageal barrier damage in mice was experimentally verified.

[0058] Groups: PBS; exosomes derived from gastric juice of healthy normal people (N-exo); supernatant of gastric juice of gastroesophageal reflux disease patients without exosomes (GERD-supernatant); exosomes derived from gastric juice of gastroesophageal reflux disease patients (GERD-exo).

[0059] C57 mice were gavaged daily according to the grouping method for 30 days. The body weight was measured and the esophageal volume was recorded.

[0060] 4.1. Hematoxylin-eosin staining (HE) to observe the effects of gastric exosomes on the gastroesophageal tract of mice

[0061] Mice were killed by cervical dislocation, and gastroesophageal tissues were collected. After fixation with 4% paraformaldehyde for 24 hours, the sections were dehydrated, embedded and sliced. The sections were then dewaxed to water and stained with hematoxylin for 5 minutes. Washed with water for 5 minutes × 3 times, differentiated with 5% acetic acid for 1 minute, and then rinsed with running water. Stained with eosin for 1 minute, rinsed with running water, and dehydrated with 70%, 80%, 90%, and 100% alcohol for 10 seconds each. Finally, dewaxed with xylene, air-dried, dripped with neutral gum, and sealed for observation under a microscope. The severity of inflammation was scored based on macroscopic and microscopic findings. Inflammation score: normal luminous mucosa (score 0); edema mucosa with focal hemorrhagic spots (score 1); multiple eroded blood spots (score 2); linear ulcers with yellow exudate (score 3); bleeding combined with ulcers (score 4). At 8 weeks of the experiment, the GERD-exo group showed discoloration of the esophageal tissue and slight bulges on the esophageal surface, while the other groups did not (see Figure 3 A), the gross scores were significantly different from those of other groups (see Figure 3 F). In the GERD-exo group, inflammatory cell infiltration was observed in the stomach and esophagus near the gastroesophageal junction, and some cells were edematous (see Figure 3B, Figure 3 C), the inflammation score was significantly different from the other three groups (see Figure 3 F).

[0062] 4.2. Observation of iNOS expression by immunohistochemistry (IHC)

[0063] After the slices are dewaxed and hydrated at room temperature, heat antigen repair is performed. Prepare antigen repair solution (one pack of sodium citrate powder is prepared into 2 liters of PBS solution), and heat and boil in an iron lunch box or pot. The temperature is controlled at 96-98 degrees. Then put the slices in the hot pot for 15 minutes, and finally cool to room temperature naturally. Add 3% hydrogen peroxide and incubate at room temperature for 10 minutes. Shake off the blocking solution, add the primary antibody iNOS to cover the tissue, and then put it in a wet box at 4 degrees Celsius overnight. The next day, take out the wet box from the 4-degree refrigerator and rewarm it at room temperature for 30 minutes. Add secondary antibody and incubate at room temperature for 10 minutes. Wash three times with PBS for three minutes. Add substrate enhancement solution to each slide, incubate at room temperature for 10 minutes, and wash three times with PBS for three minutes. Add two drops or 100 microliters of DAB solution to each slide and observe under a microscope for 3-10 minutes. Stop staining when the staining is appropriate and rinse with tap water. Hematoxylin counterstaining was performed for 1-2 minutes. The cell nucleus turned blue and the staining was terminated. The blue staining was reversed by washing with tap water or PBS (0.5% ammonia water can be used for reverse blue staining). After dehydration and cooling, the slides were sealed with an appropriate amount of neutral gum and photographed under a microscope. Compared with the other three groups, the GERD-exo group showed obvious positive iNOS in the stomach and esophagus (see Figure 3 D).

[0064] 4.3. Detection of biochemical indexes of gastroesophageal barrier function

[0065] After the administration, blood was collected from the eyeball, and 1.5 mg / mL sodium heparin (prepared with normal saline, stored at 4°C away from light at 25°C) was added to the EP tube in advance for rinsing, and the capillary tube and blood collection tube were also soaked in advance. Immediately after blood collection, centrifuge at 4°C, 3000 rpm / min for 10 min, collect the upper plasma, and then take out the kit from 4°C, equilibrate to room temperature for use, and insert the ID card into the instrument. Tear off the aluminum box packaging, take out the reaction device, add 20 μL of serum to the back of each reaction well, and the instrument automatically incubate for 30 minutes. After the end, insert the reaction tank with the front side facing up for testing, and the intestinal barrier function biochemical index analyzer (Beijing Zhongsheng Jinyu) automatically reads the data. The test results showed that the plasma diamine oxidase, D-lactic acid, and bacterial endotoxin in the GERD-exo group were significantly different from those in the other three groups (see Figure 3 I).

[0066] 4.4 In vivo fluorescein isothiocyanate-dextran (FITC-Dextran 4000, FD4) experiment

[0067] Mice were given FITC-labeled dextran by oral gavage. After a period of time (usually 4 hours), blood samples were collected for fluorescence intensity analysis. The test results showed that the FD4 fluorescence value in the plasma of the GERD-exo group was significantly different from that of the other three groups (see Figure 3 H).

[0068] Example 5

[0069] The miR-34b-5p inhibitor of the present invention (AAV miR-34b-5p-TuD ) comprises the following steps:

[0070] (1) The recombinant expression plasmid TuD (mmu-miR-34b-5p) was co-transfected with pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) into AAV-293 cells (providing trans-acting factors required for AAV replication and packaging). Recombinant AAV was assembled in the packaging cells 2-3 days after transfection;

[0071] (2) Collecting infected AAV-293 cells, lysing and releasing AAV-miR-34b-5p-TuD particles; concentrating and purifying the collected viral supernatant by density gradient centrifugation and ultrafiltration; determining the titer of the obtained virus by quantitative PCR to obtain the miR-34b-5p inhibitor AAV of the present invention; miR-34b-5p-TuD .

[0072] Example 6

[0073] The miR-34b-5p inhibitor in this example is the adeno-associated virus obtained in Example 5 that blocks miR-34b-5p.

[0074] The experimental verification of the miR-34b-5p inhibitor of the present invention for treating barrier damage and inflammation of GERD comprises the following steps:

[0075] Step 1: Construction of mouse GERD model

[0076] Group: A. Standard diet and drinking water ad libitum (NC)

[0077] B. Overeating HFD for 56 consecutive days

[0078] C. Mice were alternately fed and fasted on HFD and alcohol for 56 consecutive days (Overeating HFD-alcohol)

[0079] After one week of adaptation, C57BL / 6 male mice were fed and fasted alternately for 56 consecutive days to induce GERD. The mice were fed a high-fat diet. During the first two weeks, the mice were given 5% alcohol every two days to allow them to adapt. During the third to eighth weeks, the mice were given 10% alcohol (see Figure 5 A). After 8 weeks of induction of overeating, the mice were killed, and the esophagus and stomach were longitudinally dissected, fixed with pins and photographed, and then formalin-fixed and paraffin-embedded tissue samples were sliced ​​(4 μm). Based on the macroscopic and microscopic findings, the mice were treated according to 4.1 in Example 4. The results showed that the Overeating HFD-alcohol group showed discoloration of the esophageal tissue and slight bulges on the esophageal surface, while the Overeating HFD group had some slight discoloration of the esophageal tissue and no bulges on the esophageal surface (see Figure 5 B). In the Overeating HFD-alcohol group, inflammatory cell infiltration was observed in the stomach and esophagus near the gastroesophageal junction, and some cells were edematous (see Figure 5 C, Figure 5 D). According to 4.2 of Example 4, the stomach and esophagus of the three groups of mice were subjected to iNOS immunohistochemical staining. The results showed that the stomach and esophagus of the Overeating HFD-alcohol group showed significant positive iNOS compared with the other groups (see Figure 5 E, 5F). The treatment was carried out according to 4.3 of Example 4. The results showed that FD4 of the Overeating HFD-alcohol group was significantly different from that of the other three groups (see Figure 5 G); the concentrations of endotoxin, D-lactic acid and diamine oxidase in plasma were processed and tested according to 4.2 of Example 4. The test results showed that the plasma diamine oxidase, D-lactic acid and bacterial endotoxin in the Overeating HFD-alcohol group were significantly different from those in the NC and Overeating HFD groups (see Figure 5 H);

[0080] Step 2 miR-34b-5p inhibitor (AAV miR-34b-5p-TuD ) Treating gastroesophageal reflux disease (GERD)

[0081] The mice were randomly divided into control group (GERD-AAV -NC) and AVV-treated group (GERD-AAV miR-34b-5p-TuD ), the AAV solution was injected into mice by gavage, and the two groups of mice were subjected to the model of step 1. After 8 weeks of induction of overeating, the mice were killed, and the esophagus and stomach were longitudinally cut open, fixed with pins and photographed, and formalin-fixed, paraffin-embedded tissue sample sections (4 μm). The results showed that GERD-AVV miR-34b-5p-TuD The group had slight discoloration and no bulge on the esophageal surface (see Figure 6 A), decreased inflammatory cell infiltration (see Figure 6 B, Figure 6 C) Therefore, GERD-AVV miR-34b-5p-TuD Group comparison GERD-AVV NC The inflammation was significantly improved. According to 4.2 of Example 4, the gastroesophageal iNOS immunohistochemical staining of the two groups of mice showed that GERD-AVV miR-34b-5p-TuD Group comparison GERD-AVV NC The positive expression of iNOS in the stomach and esophagus of the group was significantly reduced (see Figure 6 D, 5E) were treated according to 4.2 in Example 4, and the test results showed that GERD-AVV miR-34b-5p-TuD Plasma diamine oxidase, D-lactic acid, bacterial endotoxins in the two groups compared with GERD-AVV NC There was a significant difference between the two groups (see Figure 6 F) AVV miR-34b-5p-TuD It can significantly reduce the degree of damage to the epithelial cell barrier and alleviate symptoms and inflammatory responses.

[0082] The AVV of the present invention interacts with proteins, DNA and RNA, wherein the AVV interacts with RNA to form TuD RNA, which is a sequence containing two miRNA complementary sequences (MBS). After transcription, the sequence forms a relatively stable stem-loop structure and is transported to the cytoplasm. The function of the target miRNA is blocked by a sequence complementary to the target miRNA, and the expression of miR-34b-5p is reduced, thereby reducing the degree of damage to the epithelial cell barrier and alleviating symptoms and inflammatory responses.

[0083] The technical solutions provided by the embodiments of the present invention are introduced in detail above. Specific examples are used herein to illustrate the principles and implementation methods of the embodiments of the present invention. The description of the above embodiments is only applicable to help understand the principles of the embodiments of the present invention. At the same time, for those skilled in the art, according to the embodiments of the present invention, there will be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. Application of a miR-34b-5p inhibitor in the preparation of drugs for treating gastrointestinal diseases.

2. The use of the miR-34b-5p inhibitor according to claim 1 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The miR-34b-5p is derived from exosomes, and the miR-34b-5p inhibitor is derived from the recombinant expression plasmid TuD (mmu-miR-34b-5p).

3. The use of the miR-34b-5p inhibitor according to claim 2 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The nucleotide sequence fragment of the recombinant expression plasmid TuD (mmu-miR-34b-5p) is: GGTGGCGCTAGGATCATCAACACAATCAGCTAATATCTTACACTGCCTCAAGTATTCTGGTCA CAGAATACAACACAATCAGCTAATATCTTACACTGCCTCAAGATGATCCTAGCGCCACCTTTTTT.

4. The use of the miR-34b-5p inhibitor according to claim 2 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The forward sequencing primer of the recombinant expression plasmid TuD (mmu-miR-34b-5p) is: pAKD-FTCATCAACCCGCTCCAAGGAAT; the reverse sequencing primer is: pAKD-R CAAGCTCGAAATTAACCC TCAC.

5. Use of the miR-34b-5p inhibitor according to any of claims 1 to 4 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The gastrointestinal disease drugs include drugs for preventing and / or treating esophageal reflux, drugs for inhibiting epithelial barrier damage and drugs for treating gastrointestinal inflammatory processes.

6. Use of the miR-34b-5p inhibitor according to claim 5 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The miR-34b-5p inhibitor is a product that inhibits the expression or activity of miR-34b-5p.

7. Use of the miR-34b-5p inhibitor according to claim 6 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The product includes miRNA mimics capable of inhibiting the expression of miR-34b-5p, and / or a plasmid vector for overexpression of miR-34b-5p, and / or an adeno-associated virus vector for blocking miR-34b-5p.

8. The use of the miR-34b-5p inhibitor according to claim 6 in the preparation of a drug for treating gastrointestinal diseases, characterized in that: The individual administration amount of the miR-34b-5p inhibitor is 1.0E+11 v.g.-1.0E+13 v.g.

Images