Pseudomonas reinovorans and application thereof in degradation of aliphatic ester pollutants

Abstract

The invention discloses resinophagous pseudomonas and application of the resinophagous pseudomonas in degradation of aliphatic ester pollutants, the resinophagous pseudomonas xxh provided by the invention is taken from sludge of a sewage plant, has an efficient degradation effect on the aliphatic ester pollutants, can relatively completely convert the pollutants into harmless substances such as CO2, H2O and the like, and has a good application prospect. And the environment adaptability is high. Therefore, the method has a wide application prospect in biological purification of industrial waste gas and waste water, and can be used for repairing pollution of aliphatic ester pollutants in environmental media such as polluted water and polluted soil.

Description

(I) Technical field

[0001] The invention relates to a resin-eating Pseudomonas resinovorans xxh and application thereof in degrading aliphatic ester pollutants. (II) Background technology

[0002] Methyl paraben, also known as methyl paraben or methyl hydroxybenzoate, is an organic substance with the chemical formula C8H8O3, white crystalline powder or colorless crystals, easily soluble in alcohol, ether and acetone, very slightly soluble in water, with a boiling point of 270-280°C. It is mainly used as a bactericidal preservative in organic synthesis, food, cosmetics, and medicine, and is also used as a feed preservative. Because it has a phenolic hydroxyl structure, its antibacterial properties are stronger than those of benzoic acid and sorbic acid. Its mechanism of action is: destroying the cell membrane of microorganisms, denaturing proteins in cells, and inhibiting the activity of respiratory enzymes and electron transfer enzymes in microbial cells.

[0003] Methyl paraben is a new generation of highly effective and low-toxic bactericidal preservatives. It is currently widely used in food, beverages, personal care products and medicines because of its strong antibacterial ability, wide pH adaptability and low toxicity. Some recent studies have shown that long-term exposure to parabens in body deodorants may cause breast cancer. Paraben preservatives have been shown to have estrogenic activity. Once entering the environment, they may cause adverse effects and are very easy to react with residual chlorine in chlorinated tap water to mainly produce monochloro or dichloro, brominated derivatives. These byproducts show higher acute toxicity than the original organic matter in large algae detection, which has a negative impact on the environment and organisms; ingestion of about 5g can be fatal to humans.

[0004] Therefore, it is necessary to study the efficient degradation of methyl paraben in the environment for human health. Through literature search, no reports were found about the efficient degradation of methyl paraben by Pseudomonas resinophilus using methyl paraben as the sole carbon source. (III) Summary of the invention

[0005] The present invention aims to provide a resin-eating Pseudomonas and its application in degrading aliphatic ester pollutants. The resin-eating Pseudomonas resinovorans xxh of the present invention can grow with aliphatic ester pollutants such as methyl paraben as the only carbon source, realizes efficient and powerful degradation of aliphatic ester pollutants, and has a mild growth environment and is easy to expand and culture. The discovery of the degradation bacteria is of great significance for the efficient purification of aliphatic ester pollutants in industrial wastewater and waste gas.

[0006] The technical solution adopted by the present invention is:

[0007] The present invention provides a new aliphatic ester pollutant-degrading bacterium, Pseudomonas resinovorans xxh, which is deposited in China Center for Type Culture Collection, with a deposit number of CCTCC NO:M 20241002, a deposit date of May 20, 2024, and an address of Wuhan University, Wuhan, China, 430072.

[0008] The basic characteristics of the resin-eating Pseudomonas xxh of the present invention are: the colonies are pink and white, disc-shaped, spore-free, and have a single flagellum; the edges are neat, opaque, easy to pick, and the bacterial lawn grows along the streaks; it is aerobic and Gram-negative.

[0009] The present invention also provides an application of the resin-eating Pseudomonas in degrading aliphatic ester pollutants. The specific application is: adding the resting cells obtained by expanding the culture of the resin-eating Pseudomonas xxh to an inorganic culture solution with a pH of 4-9 and containing aliphatic ester pollutants, and culturing them under the conditions of 10-20°C and 100-200rpm (preferably 15°C and 160rpm) to achieve degradation of the pollutants.

[0010] Furthermore, the fatty ester dyes include methyl paraben.

[0011] Furthermore, in the inorganic salt culture solution, the amount of resting cells added is 30-80 mg / L, preferably 50 mg / L, based on the dry weight of the bacteria.

[0012] Furthermore, the initial concentration of pollutants in the inorganic salt culture solution is 35-120 mg / L.

[0013] Further, the inorganic salt culture solution is composed of: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl30.0162g / L, trace element mother solution 5mL / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution is composed of: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, and the solvent is deionized water.

[0014] Furthermore, the culture conditions were: pH 7.0, 15°C, and 160 rpm.

[0015] Furthermore, the resting cells of Pseudomonas resinovorans are prepared according to the following steps:

[0016] (1) Slant culture:

[0017] The resin-eating Pseudomonas resiniferus xxh was inoculated into a slant LB solid culture medium and cultured at 25-35° C. for 24 to 36 hours to obtain a slant bacterial cell; the final concentration of the LB solid culture medium was as follows: NaCl 10 g / L, tryptone 10 g / L, yeast powder 5 g / L, agar 18 to 20 g / L, the solvent was deionized water, and the pH value was natural.

[0018] (2) Expanding training

[0019] Use an inoculation loop to pick the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Cultivate at 10-20°C and 100-200 rpm for 24-36 hours to obtain the OD 600 = 0.1-0.2 bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt medium, and obtain resting cells of Pseudomonas resinophilus xxh; the final concentration of the LB liquid medium is: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent is deionized water, and the pH value is natural.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The resin-eating Pseudomonas xxh provided by the present invention is obtained from sewage plant sludge, has a highly efficient degradation effect on aliphatic ester pollutants, can relatively completely convert pollutants into harmless substances such as CO2 and H2O, and has strong environmental adaptability. Therefore, it has broad application prospects in the biological purification of industrial waste gas and wastewater, and can be used to repair aliphatic ester pollutants in environmental media such as polluted water and polluted soil.

[0022] The resin-eating Pseudomonas sp. described in the present invention can completely degrade methyl parahydroxybenzoate into inorganic matter (CO2, H2O) and cell biomass, realize complete mineralization, and under the conditions of pH 7.0 and temperature 10-20°C, the removal rate of methyl parahydroxybenzoate within 120 mg / L is as high as 100%. (IV) Description of the drawings

[0023] Figure 1 This is a photo of the colony morphology of a single colony streaked on LB medium during the initial screening process.

[0024] Figure 2 This is a transmission electron micrograph of Pseudomonas resinovorans xxh.

[0025] Figure 3Phylogenetic tree of Pseudomonas resinovorans xxh.

[0026] Figure 4 This is the degradation curve of Pseudomonas resinovorans xxh for different concentrations of methyl p-hydroxybenzoate.

[0027] Figure 5 The degradation curves of Pseudomonas resinovorans xxh for 50 mg / L methyl p-hydroxybenzoate at different pH values.

[0028] Figure 6 The degradation rate of 50 mg / L methyl p-hydroxybenzoate by Pseudomonas resinovorans xxh at different pH values ​​at 22 h. (V) Specific implementation methods

[0029] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] The composition of the inorganic salt culture medium is: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, NH4Cl 0.98g / L, MgCl2·6H2O 0.2033g / L, CaCl2·2H2O 0.011g / L, FeCl3 0.0162g / L, trace element mother solution 5mL / L, the solvent is deionized water, pH 7.0; the trace element mother solution composition is: CuSO4·5H2O0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, and the solvent is deionized water.

[0032] The final concentration composition of LB solid culture medium is: NaCl 10g / L, tryptone 10g / L, yeast powder 5g / L, agar 18-20g / L, the solvent is deionized water, and the pH value is natural.

[0033] The final concentration composition of LB liquid culture medium is: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent is deionized water, and the pH value is natural.

[0034] Example 1: Isolation, purification and identification of Pseudomonas resinovorans xxh.

[0035] 1. Isolation and purification of Pseudomonas resinovorans xxh.

[0036] Pseudomonas resinovorans xxh is a Gram-negative bacterium domesticated and isolated from activated sludge from a sewage treatment plant. The specific steps are as follows:

[0037] (1) Enrichment culture: Add 100 mL of inorganic salt culture medium, 10 mL of activated sludge and 50 mg / L of methyl p-hydroxybenzoate to a 300 mL shaking flask, and perform enrichment culture at 10-20°C. When the concentration of methyl p-hydroxybenzoate is 50% of the initial concentration, take out 5 mL of the enrichment solution and add it to 50 mL of fresh inorganic salt culture medium. Add the same amount of methyl p-hydroxybenzoate, and repeat the above enrichment process 5 times.

[0038] (2) Primary screening: The last enrichment solution was diluted with inorganic salt culture medium and coated on LB solid medium. The solution was cultured at 25-35°C for 5 days. Single colonies were selected and purified by drawing lines on LB solid medium. Figure 1 ).

[0039] (3) Rescreening: Add the candidate bacteria obtained from the initial screening to an inorganic salt culture medium, and add 50 mg / L methyl p-hydroxybenzoate as the only carbon source and energy source, culture at 10-20°C and 100-200 rpm for 48 hours, take samples to test the degradation rate of methyl p-hydroxybenzoate, and screen out the strain xxh with a degradation rate of 100%.

[0040] 2. Identification of strain xxh

[0041] (1) Characteristics of strain xxh: strain xxh was inoculated into LB solid medium and cultured at 25-35°C for 24 h. The colonies were pink and disc-shaped with neat edges, opaque, and easy to pick.

[0042] The morphology was observed by transmission electron microscopy ( Figure 2 ), an ellipsoid bacterium with a flagellum, a size of 6000×10000nm, and Gram-negative.

[0043] (2) 16S rRNA sequence analysis

[0044] The DNA of strain xxh was extracted and purified using the Ezup column bacterial genomic DNA extraction kit and stored at 4°C. The purified DNA was amplified by PCR using universal bacterial primers, 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), and the PCR reaction program was set to 94°C pre-denaturation for 4 min, then 94°C denaturation for 45 s, 55°C annealing for 45 s, 72°C extension for 1 min, 30 cycles, and finally 72°C repair extension for 10 min. The PCR product was purified and recovered for sequencing (Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)), and the 16S rRNA sequencing results were uploaded to NCBI, obtaining the accession number PP940009, and the sequence was compared with the gene sequence in the NCBI database by Blast. It was found to belong to the genus Pseudomonas and had 99% homology with Pseudomonas sp.BAB-5154, Pseudomonas sp. and Pseudomonas sp.2000-6. Ten representative strains of Pseudomonas were selected from the results and a phylogenetic tree was constructed using MEGA7.0 software based on the homology of 16S rRNA gene sequences. Figure 3 Through genetic distance and 16S rRNA sequence comparison, strain xxh was identified as Pseudomonas resinovorans.

[0045] (3) The ability of strain xxh to utilize 47 carbon sources on the Mérieux GN card.

[0046] The strains were investigated for their metabolism of 47 different carbon sources using the Mérieux fully automatic identification instrument (entrusted to Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. According to the biochemical reaction of the Mérieux fully automatic identification instrument VITEK, the strain xxh can strongly utilize 11 carbon sources, but cannot utilize the other 36 carbon sources.

[0047] Table 1 Biochemical reaction results of strain xxh BioMerieux automatic identification instrument VITEK (GN card)

[0048]

[0049]

[0050] Note: +, positive reaction; -: negative reaction

[0051] Through colony morphology, 16S rRNA sequence analysis and physiological and biochemical experiments, the strain xxh was determined to be Pseudomonas resinovorans, named Pseudomonas resinovorans xxh, and deposited in the China Center for Type Culture Collection, with the deposit number: CCTCC NO:M 20241002, the deposit date: May 20, 2024, address: Wuhan University, Wuhan, 430072, China.

[0052] Example 2. Obtaining resting cells of Pseudomonas resinophilus xxh

[0053] 1. Slant culture:

[0054] Inoculate resin-eating Pseudomonas resiniferus xxh into LB liquid culture medium, culture at 10-20°C, 100-200rpm for 24-36h, then draw lines on solid LB plates and culture in a 30°C incubator, take single colonies and continue to draw lines on the plates to detect the purity of the bacteria, and store them in LB test tube slants as usual (4°C).

[0055] 2. Expand training

[0056] Inoculate the slant cells in step 1 into LB liquid medium and culture at 10-20°C and 100-200 rpm for 24-36 hours until the OD 600 =0.1~0.2, obtain the expanded culture medium, centrifuge, collect the wet bacteria, wash with inorganic salt culture medium, and obtain the resin-eating Pseudomonas xxh resting cells.

[0057] Example 3: Degradation performance test of Pseudomonas resinophilus xxh on methyl paraben at different concentrations.

[0058] The inorganic salt culture solution was divided into 300 mL shaking flasks, 100 mL per flask, and sterilized at 110°C for 40 min. After sterilization, it was placed at room temperature for 2 days to confirm that no bacteria grew. The resting cells obtained by the method of Example 2 were added to a final concentration of 50 mg / L (based on cell dry weight), and then methyl parahydroxybenzoate was added as the sole carbon source to a final concentration of 35, 50, 60, 80, and 120 mg / L, respectively. After the shaking flask was sealed, it was cultured on a shaking table at 15°C and 160 rpm for 30 h, and a blank control without bacteria was performed. Samples were taken at 0, 3, 9, 18, and 30 hours, and the concentration of residual methyl p-hydroxybenzoate in the shake flask was determined by high performance liquid chromatography. The chromatographic column was ZORBAX SB-C18 (25 μm, 4.6 × 250 mm), the mobile phase was methanol-1% glacial acetic acid (60:40), the flow rate was 1.0 mL / min, the injection volume was 20 μL, the UV detection wavelength was 254 nm, and the column temperature was 25 °C. The removal rate curve of the strain for different initial concentrations of methyl p-hydroxybenzoate over time was drawn, and the results are shown in Figure 4 The results showed that when the concentration of methyl paraben was lower than 120 mg / L, strain xxh could quickly degrade all added substrates within 18 h.

[0059] Example 4: Degradation performance of Pseudomonas resinophilus xxh on 50 mg / L methyl p-hydroxybenzoate under different initial pH environments.

[0060] The inorganic salt culture solution was adjusted to different pH values ​​(4.0, 5.0, 6.0, 7.0, 8.0, 9.0) with 1 mol / L NaOH aqueous solution or 1 mol / L H2SO4 aqueous solution, and the bacterial solution prepared by the method of Example 2 was inoculated under the condition of 50 mg / L methyl paraben concentration, so that the initial bacterial solution concentration in each parallel sample was OD 600 The sample was shaken and cultured in a constant temperature shaker at 15°C and 160rpm, and a blank control without bacteria was performed. Samples were taken at 0, 4, 8, 12, 22, 30, and 50 hours, and the concentration of methyl parahydroxybenzoate remaining in the shake flask was determined by the method of Example 3. The removal rate curve of methyl parahydroxybenzoate under different pH environments of the strain over time and the degradation rate of 50 mg / L methyl parahydroxybenzoate after 22 hours of culture at different pH were plotted. The results are shown in Figure 5 and Figure 6 The results showed that Pseudomonas resinophilus xxh could degrade methyl paraben at all pH values, and the degradation effect was the best at pH=7, reaching 100%.

[0061] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the protection scope of the present invention. Any changes and modifications made by any technician familiar with the technology without departing from the concept and scope of the present invention should fall within the protection scope of the present invention.

Claims

1. Pseudomonas resinovorans xxh, deposited in China Center for Type Culture Collection, deposit number: CCTCC NO:M 20241002, deposit date: May 20, 2024, address: Wuhan University, Wuhan 430072, China.

2. A use of the resin-eating Pseudomonas xxh according to claim 1 in degrading aliphatic ester pollutants.

3. The use according to claim 2, characterized in that The application is: adding the resting cells obtained by expanding the culture of Pseudomonas resinophilus xxh into an inorganic culture solution with a pH of 4-9 and containing aliphatic ester pollutants, and culturing them at 10-20°C and 100-200rpm to achieve the degradation of pollutants.

4. The use according to claim 3, characterized in that The fatty ester dyes include methyl paraben.

5. The use according to claim 3, characterized in that In the inorganic salt culture solution, the amount of resting cells added is 30-80 mg / L based on the dry weight of the bacteria.

6. The use according to claim 3, characterized in that The initial concentration of pollutants in the inorganic salt culture solution is 35-120 mg / L.

7. The use according to claim 3, characterized in that The inorganic salt culture solution is composed of: K2HPO4·3H2O 0.942 g / L, KH2PO4 0.234 g / L, NaNO3 1.7 g / L, NH4Cl 0.98 g / L, MgCl2·6H2O 0.2033 g / L, CaCl2·2H2O 0.011 g / L, FeCl3 0.0162 g / L, trace element mother solution 5 mL / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution Composition: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, the solvent is deionized water.

8. The use according to claim 3, characterized in that The culture conditions were: pH 7.0, 15°C, 160 rpm.

9. The use according to claim 3, characterized in that The resting cells are prepared according to the following steps: (1) Slant culture: Inoculate the resin-eating Pseudomonas aeruginosa xxh into a slant LB solid medium and culture at 25-35°C for 24-36 hours to obtain slant cells; (2) Expansion culture: Use an inoculation loop to pick up the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Cultivate at 10-20°C and 100-200 rpm for 24-36 hours to obtain the OD 600 = 0.1-0.2 of bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt medium, and obtain resting cells.

Images