Laurenus estuary pseudomonas YX05 and application thereof in degradation of organic pollutants

Abstract

The invention discloses a Laurenus estuary pseudomonas YX05 and application thereof in degradation of organic pollutants, the Laurenus estuary pseudomonas YX05 provided by the invention is taken from sludge of a sewage plant, has an efficient degradation effect on the organic pollutants such as 3-chloropropionic acid, can relatively completely convert the pollutants into harmless substances such as CO2, H2O and the like, and has a good application prospect. Therefore, the method has a wide application prospect in biological purification of industrial waste gas and wastewater.

Description

(I) Technical field

[0001] The invention relates to Pseudomonas laurentiana YX05 and application of the same in degrading organic pollutants such as 3-chloropropionic acid. (II) Background technology

[0002] 3-Chloropropionic acid, also known as β-chloropropionic acid, is an important organic synthetic raw material. It is a white crystalline powder that is soluble in water, ethanol, ether, and chloroform. It is an intermediate for pesticides, medicines, and dyes. It can be used to synthesize β-butyl propionate, used in the production of anti-epileptic drugs, and also used to make the pesticide fluazifop-butyl, and as a synthetic reagent, such as for synthesizing the silk dye intermediate 3-chloropropionyl chloride. The main synthetic methods of 3-chloropropionic acid include acrylonitrile addition chlorination hydrolysis method, propionic acid photochlorination method, acrolein chlorination addition oxidation method, 3-chloropropanol oxidation method, and acrylic acid chlorination addition method.

[0003] Halogenated aliphatic compounds are widely used in agriculture and industry. These compounds are produced in large quantities and are an important class of environmental pollutants due to their widespread use as herbicides, fungicides, pesticides, solvents, etc. Although 3-chloropropionic acid is of low toxicity, it is easily inhaled and absorbed through the skin, and is irritating to the skin, mucous membranes, and eyes. 3-chloropropionic acid can burn in the presence of open flames, high heat, and oxidants, and emits toxic gases and is corrosive.

[0004] The degradation methods of 3-chloropropionic acid mainly include biological degradation, chemical degradation and physical degradation. Biological degradation is the use of microorganisms (such as bacteria and fungi) to degrade 3-chloropropionic acid. Some microorganisms can metabolize such compounds and convert them into harmless substances, but there are no reports of efficient degradation bacteria degrading 3-chloropropionic acid. The use of indigenous microbial communities to treat 3-chloropropionic acid not only has a slow treatment rate, lasting for weeks or even months, but also has an incomplete degradation effect; chemical degradation is the use of oxidants for chemical oxidation or degradation of 3-chloropropionic acid through hydrolysis reactions. The defects of this method are that the reaction conditions need to be strictly controlled, the equipment requirements are high, the operation is complicated, and the cost is high; physical degradation is the removal of 3-chloropropionic acid through physical methods such as pyrolysis, evaporation or adsorption. The defects of this method are low efficiency and inability to completely degrade pollutants, resulting in the existence of residues.

[0005] Therefore, the efficient degradation of 3-MCPA in the research environment is crucial to human health and the ecological environment. Through literature search, no reports were found about the efficient degradation of Pseudomonas spp. in the Lawrence River estuary using 3-MCPA as the sole carbon source. (III) Summary of the invention

[0006] The present invention aims to provide a Lawrence estuarine Pseudomonas YX05 and its application in degrading organic pollutants, which can achieve efficient degradation with 3-chloropropionic acid and other organic pollutants as the only carbon source, has strong degradation ability, mild growth environment, and is easy to expand and cultivate. The discovery of the degradation bacteria is of great significance for the efficient purification of halogenated aliphatic pollutants in industrial wastewater and waste gas.

[0007] The technical solution adopted by the present invention is:

[0008] The present invention provides a strain of 3-chloropropionic acid and other organic pollutant degradation bacteria - Pseudomonas laurentiana YX05, which is deposited in China Center for Type Culture Collection, with a deposit number of CCTCC NO:M 20241960, a deposit date of September 11, 2024, and an address of Wuhan University, Wuhan, China, 430072.

[0009] The basic characteristics of the Lawrence estuarine Pseudomonas YX05 of the present invention are: the colony surface is smooth and opaque, milky white or light yellow; the center is convex, the edges are neat, easy to pick, short rod-shaped under the microscope, and no spores; the bacterial lawn grows along the streak; and Gram staining is negative.

[0010] The present invention also provides an application of the Lawrence Estuarine Pseudomonas YX05 in degrading organic pollutants. The application is to add resting cells obtained by expanding the culture of the Lawrence Estuarine Pseudomonas YX05 to an inorganic salt culture solution with a pH of 4-9 and containing organic pollutants, and culture them at 25-35°C to achieve degradation of organic pollutants.

[0011] Furthermore, the organic pollutant is 3-chloropropionic acid.

[0012] Furthermore, in the inorganic salt culture solution, the amount of resting cells added is 30-100 mg / L, preferably 50 mg / L, based on the dry weight of the bacteria.

[0013] Furthermore, the initial concentration of organic pollutants in the inorganic salt culture solution is 50-250 mg / L.

[0014] Further, the inorganic salt culture solution is composed of: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, (NH4)2SO4 1.208g / L, MgSO4 0.120g / L, Ca(NO3)2 0.012g / L, Fe(NO3)3·9H2O0.040g / L, trace element mother solution 5ml / L, the solvent is deionized water, pH 7.0; wherein the trace element mother solution is composed of: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, and the solvent is deionized water.

[0015] Further, the resting cells of Pseudomonas spp. YX05 are prepared according to the following steps:

[0016] (1) Slant culture:

[0017] The Lawrence Estuarine Pseudomonas YX05 was inoculated into a slant LB solid culture medium and cultured at 30°C for 24-36 hours to obtain slant bacteria; the final concentration of the LB solid culture medium was: NaCl 10g / L, tryptone 10g / L, yeast powder 5g / L, agar 18-20g / L, the solvent was deionized water, and the pH value was natural;

[0018] (2) Expanding training

[0019] Use an inoculation loop to pick the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Incubate at 30°C for 24-36 hours to obtain the OD 600 =0.1-0.2 bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt culture solution, and obtain resting cells of Pseudomonas spp. YX05 of Lawrence Estuary; the final concentration of the LB liquid culture medium is: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent is deionized water, and the pH value is natural.

[0020] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0021] The Lawrence Estuary Pseudomonas YX05 provided by the present invention is taken from sewage plant sludge, has a highly efficient degradation effect on organic pollutants such as 3-chloropropionic acid, and can relatively completely convert pollutants into harmless substances such as CO2 and H2O, so it has broad application prospects in the biological purification of industrial waste gas and wastewater.

[0022] The Lawrence Estuarine Pseudomonas YX05 described in the present invention can completely degrade 3-chloropropionic acid into inorganic matter (CO2, H2O) and cell biomass, achieve complete mineralization, and has a high removal rate for 3-chloropropionic acid within 200 mg / L. (IV) Description of the drawings

[0023] Figure 1 This is a photo of the colony morphology of strain YX05 on LB medium.

[0024] Figure 2 This is a transmission electron micrograph of strain YX05.

[0025] Figure 3 This is the phylogenetic tree of strain YX05.

[0026] Figure 4 This is the degradation curve of Pseudomonas laurentianaYX05 for different concentrations of 3-chloropropionic acid.

[0027] Figure 5 The degradation curves of Pseudomonas laurentiana YX05 for 100 mg / L 3-chloropropionic acid at different pH values.

[0028] Figure 6 The degradation rate of Pseudomonas laurentianaYX05 for 100 mg / L 3-chloropropionic acid at different pH values ​​at 18 h. (V) Specific implementation methods

[0029] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0030] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0031] The inorganic salt culture medium composition is: K2HPO4·3H2O 0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, (NH4)2SO4 1.208g / L, MgSO4 0.120g / L, Ca(NO3)2 0.012g / L, Fe(NO3)3·9H2O 0.040g / L, trace element mother solution 5ml / L, solvent is deionized water, pH 7.0; the trace element mother solution composition is: CuSO4·5H2O0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O 0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O 0.10g / L, and the solvent is deionized water.

[0032] The final concentration composition of LB solid medium is: NaCl 10g / L, tryptone 10g / L, yeast powder 5g / L, agar 18-20g / L, the solvent is deionized water, and the pH value is natural.

[0033] The final concentration composition of LB liquid culture medium is: NaCl 10g / L, peptone 10g / L, yeast powder 5g / L, the solvent is deionized water, and the pH value is natural.

[0034] Example 1: Isolation, purification and identification of strain YX05

[0035] 1. Isolation and purification of strain YX05.

[0036] Strain YX05 is a Gram-negative bacterium domesticated and isolated from activated sludge in a sewage treatment plant. The specific steps are as follows:

[0037] Add 50mL of inorganic salt culture medium to a 300mL shaking flask, add 10mL of activated sludge and 30mg / L of 3-chloropropionic acid for enrichment culture. When the concentration of 3-chloropropionic acid is 50% of the initial concentration, take out 5mL of enrichment solution and add it to 50mL of fresh inorganic salt culture medium. Add the same concentration of 3-chloropropionic acid. Repeat the above enrichment process 5 times, then apply gradient dilution of the last enrichment solution to LB solid medium, select single colonies to separate the plate and draw lines for purification ( Figure 1 ), the candidate bacteria were added into inorganic salt culture medium, and 3-chloropropionic acid was added as the only carbon source and energy source for verification, and the target strain YX05 was screened and its morphology was determined by transmission electron microscopy ( Figure 2 ).

[0038] 2. Identification of strain YX05

[0039] (1) Characteristics of strain YX05:

[0040] Strain YX05 was inoculated into slant LB solid medium and cultured at 30℃ for 36h. The surface of the colony was smooth and opaque, milky white or light yellow, with a raised center, neat edges, disc-shaped, and easy to pick. Under transmission electron microscopy, the bacteria were short rod-shaped, with flagella, no spores, and a size of 4608×3456nm. Gram staining was negative.

[0041] (2) 16S rRNA sequence analysis

[0042] DNA of strain YX05 was extracted and purified using Ezup column bacterial genomic DNA extraction kit and stored at 4°C. Purified DNA was amplified by PCR using universal bacterial primers, 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), and the PCR reaction program was set to 94°C pre-denaturation for 4 min, then 94°C denaturation for 45 s, 55°C annealing for 45 s, 72°C extension for 1 min, 30 cycles, and finally 72°C repair extension for 10 min. The PCR product was purified and recovered and sequenced (Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The sequencing results of 16S rRNA (SEQ ID NO.1) were uploaded to NCBI and obtained the accession number PP968120. At the same time, the sequence was compared with the gene sequence in the NCBI database by Blast. It was found to belong to the genus Pseudomonas and had 99% homology with Pseudomonas putida DOT-T1E and Pseudomonas putida strain PP1. Ten representative strains of Pseudomonas were selected from the results, and a phylogenetic tree was constructed using MEGA11.0 software based on the homology of 16S rRNA gene sequences, as shown in Figure 3 Through genetic distance and 16S rRNA sequence comparison, it was identified as Pseudomonas laurentiana.

[0043] (3) The ability of strain YX05 to utilize 47 carbon sources on the BioMérieux GN card

[0044] The strains were investigated for their metabolism of 47 different carbon sources using the Mérieux fully automatic identification instrument (entrusted to Zhejiang Tianke High-tech Development Co., Ltd. (formerly Zhejiang Institute of Microbiology)). The identification results are shown in Table 1. According to the biochemical reaction of the Mérieux fully automatic identification instrument VITEK, strain YX05 can strongly utilize 14 carbon sources, but cannot utilize the other 33 carbon sources.

[0045] Table 1 Biochemical reaction results of strain YX05 using the Mérieux fully automatic identification instrument VITEK (GN card)

[0046]

[0047]

[0048] Note: +, positive reaction; -, negative reaction

[0049] The strain was identified as Pseudomonas laurentiana through colony morphological characteristics, 16S rRNA sequence analysis and physiological and biochemical experiments, and was named Pseudomonas laurentiana YX05. It was deposited in the China Center for Type Culture Collection with the deposit number: CCTCC M 20241960.

[0050] Example 2: Obtaining resting cells of Pseudomonas estuarineis YX05

[0051] 1. Slant culture:

[0052] The Lawrence Estuarine Pseudomonas YX05 was inoculated into LB liquid culture medium and cultured at 15°C, 160rpm for 24-36h. The activated bacteria were then streaked on solid LB plates and cultured in a 30°C incubator. Single colonies were taken and continued to be streaked on the plates to detect the purity of the bacteria, and the LB test tube slants were stored in a conventional manner (4°C).

[0053] 2. Expand training

[0054] Inoculate the slant cells in step 1 into LB liquid medium and culture at 15°C, 160 rpm for 24-36 h to obtain the OD 600 = 0.1-0.2 of the bacterial liquid, centrifuge, collect the wet bacteria, wash with inorganic salt culture solution, and obtain the Lawrence estuarine Pseudomonas YX05 resting cells.

[0055] Example 3: Degradation performance test of Pseudomonas spp. YX05 on different concentrations of 3-chloropropionic acid

[0056] The inorganic salt culture solution was divided into 300 mL shake flasks, 100 mL in each flask, and sterilized at 110°C for 40 min. After sterilization, it was placed at room temperature for 2 days to ensure that no foreign bacteria grew. The resting cells obtained by the method of Example 2 were added to a final concentration of 50 mg / L (based on cell dry weight), and then 3-chloropropionic acid was added as the sole carbon source to a final concentration of 50, 100, 150, 200, and 250 mg / L, respectively. After the shake flask was sealed, it was cultured in a shaker at 15°C and 160 rpm, and a blank control without adding bacteria was performed. The residual 3-chloropropionic acid concentration in the shake flask was measured regularly, and the removal rate curve of the strain with different initial concentrations of 3-chloropropionic acid over time was plotted. The results are shown in Table 2. Figure 4The results showed that when the concentration of 3-chloropropionic acid was lower than 200 mg / L, strain YX05 could degrade the added substrate more quickly.

[0057] Detection method of 3-chloropropionic acid: Dionex ICS-2100 ion chromatograph (Dionex, USA) was used to quantitatively analyze the chloride ion concentration. The detector was a DS6 conductivity detector, equipped with an ASRS300 suppressor and an IonpacAS19 chromatographic column (250㎜×4.0㎜, 5.0μm). The working conditions were: detector temperature 30℃, suppressor current 75mA, eluent KOH concentration set to 20mM isocratic concentration, and injection time was 9min. The sample was pretreated before ion detection: the sample was filtered using a 0.22μm nylon membrane filter to filter out bacteria in the sample. The total organic carbon concentration was qualitatively analyzed using the Shanghai Yuanxi TOC-5000 total organic carbon analyzer. The TOC-5000 used a carrier gas of 180mL / min to circulate in a combustion tube pre-filled with an oxidation catalyst. The injection system injected the sample into the combustion tube, and the TC in the sample was burned and decomposed into carbon dioxide. The injection time was about 30min. The samples were pre-treated before TOC-5000 detection: the samples were filtered through a 0.22 μm nylon membrane filter to filter out bacteria in the samples.

[0058] Example 4: Degradation performance test of 100 mg / L 3-chloropropionic acid by Pseudomonas spp. YX05 at different initial pH environments

[0059] The inorganic salt culture solution was adjusted to different pH values ​​(4.0, 5.0, 6.0, 7.0, 8.0, 9.0) with 1 mol / L NaOH aqueous solution or 1 mol / L H2SO4 aqueous solution, and the bacterial solution prepared by the method of Example 2 was inoculated under the condition that the initial 3-chloropropionic acid concentration was 100 mg / L, so that the initial bacterial solution concentration in each parallel sample was OD 600 The sample was shaken and cultured in a constant temperature shaker at 15°C and 160rpm, and a blank control without bacteria was made. The residual 3-chloropropionic acid concentration in the shake flask was measured regularly, and the removal rate curve of 3-chloropropionic acid under different pH environments of the strain over time and the degradation rate of 100 mg / L 3-chloropropionic acid under different pH at 18h were plotted. The results are shown in Figure 5 and Figure 6 The results showed that Pseudomonas spp. YX05 from Lawrence River Estuary could degrade 3-chloropropionic acid at pH 6, 7 and 8, and the degradation effect of 3-chloropropionic acid was the best at pH 6 and 7.

[0060] Although the present invention has been disclosed as above by the embodiments, it is not intended to limit the protection scope of the present invention. Any changes and modifications made by any technician familiar with the technology without departing from the concept and scope of the present invention should fall within the protection scope of the present invention.

Claims

1. Pseudomonas laurentiana YX05, deposited in China Center for Type Culture Collection, deposit number: CCTCC NO:M 20241960, deposit date: September 11, 2024, address: Wuhan University, Wuhan 430072, China.

2. Use of the Lawrence Estuarine Pseudomonas YX05 described in claim 1 in degrading organic pollutants.

3. The use according to claim 2, characterized in that The application is to add the resting cells obtained by expanding the culture of Pseudomonas spp. YX05 of Lawrence River Estuary into an inorganic salt culture solution with a pH of 4-9 and containing organic pollutants, and culture them at 25-35°C to achieve the degradation of organic pollutants.

4. The use according to claim 3, characterized in that The organic pollutant is 3-chloropropionic acid.

5. The use according to claim 3, characterized in that In the inorganic salt culture solution, the amount of resting cells added is 30-100 mg / L based on the dry weight of the bacteria.

6. The use according to claim 3, characterized in that The initial concentration of organic pollutants in the inorganic salt culture solution is 50-250 mg / L.

7. The use according to claim 3, characterized in that The inorganic salt culture solution is composed of: K2HPO4·3H2O0.942g / L, KH2PO4 0.234g / L, NaNO3 1.7g / L, (NH4)2SO4 1.208g / L, MgSO4 0.120g / L, Ca(NO3)2 0.012g / L, Fe(NO3)3·9H2O 0.040g / L, trace element mother solution 5ml / L, solvent is deionized water, pH 7.0; wherein the trace element mother solution Composition: CuSO4·5H2O 0.02g / L, FeSO4·7H2O 1.0g / L, MnSO4·4H2O0.1g / L, NaMoO4·2H2O 0.02g / L, CoCl2·6H2O 0.02g / L, H3BO3 0.014g / L, ZnSO4·7H2O0.10g / L, the solvent is deionized water.

8. The use according to claim 3, characterized in that The resting cells are prepared according to the following steps: (1) Slant culture: Pseudomonas spp. YX05 was inoculated into a slant LB solid medium and cultured at 30°C for 24-36 h to obtain slant cells; (2) Expansion culture: Use an inoculation loop to pick up the slant bacteria obtained in step (1) and inoculate them into LB liquid culture medium. Cultivate at 30°C for 24-36 hours and obtain the OD 600 = 0.1-0.2 of bacterial liquid, centrifuge, collect wet bacteria, wash with inorganic salt culture medium, and obtain resting cells.

Images