Promoter specifically expressed in retinal rod cells and application thereof

Abstract

The invention discloses a promoter for specific expression in retinal rod cells and application of the promoter, and belongs to the field of biological medicine. The nucleic acid of the promoter has a length of less than 1 kb, and comprises a sequence of SEQ ID NO.5 or a functional variant thereof having at least 80% identity with SEQ ID NO.5, or consists of a sequence of SEQ ID NO.5 or a functional variant thereof having at least 80% identity with SEQ ID NO.5. The promoter has good specificity, high safety and high transduction activity, and can significantly improve gene therapy and other effects.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a promoter specifically expressed in retinal rod photoreceptor cells and an application thereof. Background Art

[0002] Inherited retinal diseases are a class of diseases that are caused by gene mutations and affect retinal function. These diseases usually lead to the degeneration or dysfunction of photoreceptor cells in the retina (including rods and cones), eventually leading to vision loss or blindness. Common inherited retinal diseases include: Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), Cone-Rod Dystrophy (CRD), Stargardt Disease, and photoreceptor dysfunction caused by mutations in rods and cones.

[0003] Currently, the use of gene therapy to treat inherited retinal diseases has gradually become a new research hotspot. Gene therapy is to restore or replace the function of mutant genes by introducing normal genes into the patient's retinal cells. This therapy usually requires the construction of a recombinant plasmid and its delivery to the host through a viral vector, such as adeno-associated virus (AAV), to achieve the purpose of expressing the target gene in the host. However, the vector capacity of AAV is usually only 4.7 to 4.9 kilobases (kb), which makes the delivery of larger fragments of genes a major challenge.

[0004] The main defects and shortcomings of currently used promoters include:

[0005] 1. Lack of specificity: The most common promoters are the major immediate early promoter of human and mouse cytomegalovirus (CMV), the SV40 immediate early promoter, etc. These promoters are pan-promoters that can efficiently initiate gene expression in a variety of mammalian cells. These promoters have poor specificity and cannot express target genes in specific cells.

[0006] 2. Low promoter activity: The cellular environment in the retina may not support the efficient activity of certain promoters. Retinal cells may lack specific transcription factors or cofactors required by the promoter, thus affecting the function of the promoter.

[0007] 3. Low expression efficiency of target gene: Currently commonly used pan-promoters do not originate from retinal cells. However, the anatomical structure of the retina and the blood-retinal barrier may limit the activity of exogenous promoters and the effective delivery of genes, thereby reducing the expression efficiency of target genes.

[0008] 4. Capacity limitation of AAV vector: The vector capacity of AAV is usually only 4.7 to 4.9 kilobases (kb). Existing retina-specific promoters all have the problem of large base number, which makes the delivery of larger gene fragments a major challenge.

[0009] 5. Low safety: Currently commonly used promoters (such as CMV promoter, SV40 promoter, etc.) have certain immunogenicity. These promoters may be recognized by the immune system in the human retina and trigger an immune response, resulting in a decrease in the safety of gene therapy.

[0010] Therefore, one object of the present invention is to obtain novel sequences suitable for expressing recombinant genes at high expression levels and in a cell type specific manner in rod photoreceptor cells in the mammalian retina. Summary of the invention

[0011] In order to solve the above technical problems, the present invention provides the following technical solutions.

[0012] In a first aspect, the present invention provides a promoter that is specifically expressed in retinal rod photoreceptor cells.

[0013] A promoter specifically expressed in retinal rod photoreceptor cells, wherein the nucleic acid of the promoter has a length of less than 1 kb and comprises the sequence of SEQ ID NO.5 or a functional variant thereof having at least 80% identity with SEQ ID NO.5, or is composed of the sequence of SEQ ID NO.5 or a functional variant thereof having at least 80% identity with SEQ ID NO.5.

[0014] In some embodiments, the nucleic acid of the promoter has a length of less than 0.9 kb. In some embodiments, the nucleic acid of the promoter has a length of less than 0.8 kb. In some embodiments, the nucleic acid of the promoter has a length of less than 0.7 kb. In some embodiments, the nucleic acid of the promoter has a length of less than 0.6 kb. In some embodiments, the nucleic acid of the promoter has a length of less than 0.55 kb.

[0015] In some embodiments, the functional variant has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with SEQ ID NO.4.

[0016] In some embodiments, the functional variant has a sequence comprising at least 100-526 consecutive nucleotides of SEQ ID NO. 5. In some embodiments, the functional variant has a sequence comprising at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 510, at least 515, at least 516, at least 517, at least 518, at least 519, at least 520, at least 521, at least 521, at least 521, at least 524, at least 525, or at least 526 consecutive nucleotides of SEQ ID NO. 5.

[0017] In a second aspect, the present invention provides an expression cassette.

[0018] An expression cassette comprising: the nucleic acid of the promoter, the target nucleic acid and the nucleic acid of the transcription terminator described in the first aspect; the target nucleic acid is operably connected to the nucleic acid of the promoter and the nucleic acid of the transcription terminator described in the first aspect.

[0019] In some embodiments, the target nucleic acid includes at least one of the RHO gene (Gene ID: 6010), GNAT1 gene (Gene ID: 2779), PDE6A gene (Gene ID: 5145), PDE6B gene (Gene ID: 5158), CNGB1 gene (Gene ID: 1258), CNGA1 gene (Gene ID: 1259), NRL gene (Gene ID: 4901), CRX gene (Gene ID: 1406), RPE65 gene (Gene ID: 6121), SAG gene (Gene ID: 6295), RDH12 gene (Gene ID: 145226), ROM1 gene (Gene ID: 6094), or encodes a RHO protein (the structure of the RHO protein may be the same as that encoded by the RHO gene (Gene ID: 6010)), a GNAT1 protein (the structure of the GNAT1 protein may be the same as that encoded by the GNAT1 gene (Gene ID: 1 The proteins encoded by the genes include protein coded by PDE6A gene (Gene ID: 2779) and protein coded by PDE6A gene (Gene ID: 5145). The proteins encoded by PDE6B gene (Gene ID: 5158) and protein coded by CNGB1 gene (Gene ID: 1258). The proteins encoded by CNGA1 gene (Gene ID: 1259) and protein coded by NRL gene (Gene ID: 4901) and protein coded by CRX gene (Gene ID: 1406) and protein coded by RPE65 gene (Gene ID: 1407) and protein coded by RPE65 gene (Gene ID: 1410) and protein coded by RPE65 gene (Gene ID: 1411). The invention relates to a gene encoding at least one of a protein selected from the group consisting of a protein encoded by the SAG gene (Gene ID: 6121), a protein encoded by the SAG gene (the structure of the SAG protein may be the same as that encoded by the SAG gene (Gene ID: 6295)), a protein encoded by the RDH12 gene (the structure of the RDH12 protein may be the same as that encoded by the RDH12 gene (Gene ID: 145226)), and a protein encoded by the ROM1 gene (the structure of the ROM1 protein may be the same as that encoded by the ROM1 gene (Gene ID: 6094)).

[0020] In some embodiments, the transcription terminator comprises SV40 pA, β-globin pA, or CMV terminator.

[0021] In some embodiments, the nucleotide sequence of the SV40 pA is SEQ ID No.8.

[0022] In a third aspect, the present invention provides a vector.

[0023] A vector comprising the expression cassette according to the second aspect.

[0024] In some embodiments, the vector is a plasmid or a viral vector.

[0025] In some embodiments, the viral vector is a retroviral vector. In some embodiments, the viral vector is a lentiviral vector or a non-pathogenic parvovirus.

[0026] In some embodiments, the vector is a lentiviral vector.

[0027] In some embodiments, the vector is an adeno-associated virus (AAV) vector.

[0028] In a fourth aspect, the present invention provides a use of the aforementioned promoter, expression cassette, and vector.

[0029] Use of the promoter of the first aspect, the expression cassette of the second aspect or the vector of the third aspect in the preparation of a drug for expressing a target nucleic acid in retinal rod photoreceptor cells.

[0030] In some embodiments, the retinal rod photoreceptor cells are mammalian retinal rod photoreceptor cells.

[0031] In some embodiments, the retinal rod photoreceptor cells are rodent retinal rod photoreceptor cells or human retinal rod photoreceptor cells.

[0032] In a fifth aspect, the present invention provides an in vitro method for expressing genes in retinal rod photoreceptor cells.

[0033] An in vitro method for expressing a gene in retinal rod photoreceptors, comprising transfecting a cell line or a cell population with the expression cassette of the second aspect or the vector of the third aspect, wherein the cell line or the cell population comprises retinal rod photoreceptors.

[0034] In some embodiments, the retinal rod photoreceptor cells are mammalian retinal rod photoreceptor cells.

[0035] In some embodiments, the retinal rod photoreceptor cells are rodent retinal rod photoreceptor cells or human retinal rod photoreceptor cells.

[0036] In a sixth aspect, the present invention provides an isolated cell.

[0037] An isolated cell comprising the expression cassette of the second aspect or the vector of the third aspect.

[0038] In some embodiments, the isolated cell is a retinal rod photoreceptor cell.

[0039] In a seventh aspect, the present invention provides a pharmaceutical composition.

[0040] A pharmaceutical composition comprising the expression cassette of the second aspect, the vector of the third aspect or the isolated cell of the sixth aspect.

[0041] In some embodiments, the pharmaceutical composition is formulated for administration to the eye, particularly by intraocular injection, such as by subretinal and / or intravitreal administration. Thus, the composition may be combined with a pharmaceutically acceptable excipient such as saline, Ringer's balanced salt solution (pH 7.4), and the like.

[0042] In some embodiments, the pharmaceutical compositions may be packaged in single unit dose or multiple dose form.

[0043] In an eighth aspect, the present invention provides a use of the aforementioned expression cassette, isolated cell or pharmaceutical composition.

[0044] A use of the expression cassette of the second aspect, the vector of the third aspect, the isolated cell of the sixth aspect, or the pharmaceutical composition of the seventh aspect in the preparation of a medicament for treating a disease in which at least one of the RHO gene, GNAT1 gene, PDE6A gene, PDE6B gene, CNGB1 gene, CNGA1 gene, NRL gene, CRX gene, RPE65 gene, SAG gene, RDH12 gene, and ROM1 gene is mutated or defective.

[0045] In some embodiments, the disease includes at least one of Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), Cone-Rod Dystrophy (CRD), Stargardt Disease, Nyctalopia, Congenital Stationary Night Blindness (CSNB), Achromatopsia, Usher Syndrome, Bardet-Biedl Syndrome (BBS), Stargardt Disease, Fundus Albipunctatus, X-linked Retinoschisis, and photoreceptor cell dysfunction caused by rod and cone mutations.

[0046] Beneficial Effects

[0047] Compared with the prior art, a certain embodiment of the present invention has at least one of the following beneficial effects:

[0048] (1) The promoter provided by the present invention is short in length, which is conducive to the construction of the vector. In addition, the promoter provided by the present invention is short in length, which not only improves its application efficiency in gene therapy, but also provides more space for the use of AAV (adeno-associated virus) vectors to carry larger or more therapeutic genes, which greatly expands the scope of application and application prospects of gene therapy.

[0049] (2) The promoter provided by the present invention is a specific promoter isolated from rod photoreceptors, and its characteristics enable it to precisely regulate the expression of target genes in rod photoreceptors. This specific expression is crucial for treating inherited retinal diseases caused by rod photoreceptor dysfunction, because it ensures that the therapeutic gene can be activated in the required cell type, thereby maximizing the therapeutic effect while reducing the side effects and unnecessary gene exposure caused by expression in non-target cells.

[0050] (3) The promoter provided by the present invention has strong specificity, which can ensure efficient and specific expression of the target gene in rod photoreceptor cells, reduce the impact on other cell types, avoid unnecessary side effects, and help improve the effect of gene therapy.

[0051] (4) The promoter provided by the present invention is derived from the rod cells of the human retina, which makes it highly biocompatible in retinal tissue. Due to its endogenous properties, the Gnat1 promoter can be naturally recognized and accepted by the host retinal cells, thereby significantly reducing the risk of immune response that may be induced by exogenous promoters.

[0052] (5) The promoter provided by the present invention has high transduction efficiency and extremely high activity of specific expression in retinal rod cells. This high specific expression activity ensures that the target gene can be expressed to the greatest extent in rod cells, significantly improving the effect of gene therapy.

[0053] Terminology

[0054] In the description of the present invention, the term "room temperature" means ambient temperature, which refers to a temperature of about 10°C to about 30°C, or about 20°C to 30°C, or about 25°C.

[0055] The term "wt%" means percent by mass.

[0056] The term "W / W" means mass ratio.

[0057] The term "kb" means kilobase pairs.

[0058] The "Gene ID" number described herein (eg, Gene ID: 6010) is a number provided by the gene-specific database of the National Center for Biotechnology Information (URL: https: / / www.ncbi.nlm.nih.gov / ).

[0059] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0060] In the following, all numbers disclosed herein are approximate, regardless of whether the word "about" or "approximately" is used. The value of each number may vary by 1%, 2%, 5%, 7%, 8%, 10%, 15% or 20%. Whenever a number with a value of N is disclosed, any number with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15% or N+ / -20% will be explicitly disclosed, where "+ / -" means plus or minus.

[0061] When used in this article, the term "nucleic acid" or "polynucleotide" refers to the polymeric form of nucleotides of any length, and the nucleotides can be ribonucleotides or deoxyribonucleotides. Therefore, the term includes but is not limited to single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers comprising non-natural or derived nucleotide bases of purine and pyrimidine bases or other natural, chemical or biochemical modifications. The backbone of the polynucleotide can include sugar and phosphate groups (as can be usually present in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can include synthetic subunits such as polymers of phosphoramidates, and therefore can be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. Nucleic acid of the present invention can be prepared by any technology well known to those skilled in the art, including chemical synthesis, reorganization and mutation. In a preferred embodiment, nucleic acid of the present invention is a DNA molecule, which is preferably synthesized by recombinant methods well known to those skilled in the art.

[0062] The term "promoter" refers to a regulatory element that directs the transcription of a nucleic acid to which it is operably linked. A promoter can regulate both the transcription rate and efficiency of an operably linked nucleic acid. A promoter can also be operably linked to other regulatory elements that enhance ("enhancer") or repress ("repressor") the promoter-dependent transcription of a nucleic acid.

[0063] The term "promoter activity" refers to the ability of a promoter to initiate transcription of a nucleic acid to which it is operably linked. Promoter activity can be measured using procedures known in the art or described in the Examples. For example, promoter activity can be measured as the amount of transcribed mRNA using, for example, Northern blots or polymerase chain reaction (PCR). Alternatively, promoter activity can be measured as the amount of translated protein product, for example, by Western blots, ELISA, colorimetric assays, and various activity assays, including reporter gene assays and other procedures known in the art or described in the Examples.

[0064] The term "operably linked" as used herein refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when the promoter is capable of affecting the expression of the coding sequence, i.e., the coding sequence is under the transcriptional control of the promoter.

[0065] The terms "polypeptide" and "protein" are used interchangeably and refer to polymers of amino acid residues, and are not limited to a minimum length. These polymers of amino acid residues may contain natural or non-natural amino acid residues, and include, but are not limited to, dimers, trimers and polymers of peptides, oligopeptides, amino acid residues. Both full-length proteins and fragments thereof are encompassed by this definition. The term also includes post-translational modifications of polypeptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In addition, for the purposes of the present invention, "polypeptide" may refer to proteins including modifications such as deletions, additions and substitutions (usually conservative in nature) to the native sequence, as long as the protein maintains the desired activity. These modifications may be carefully designed by site-directed mutagenesis, or may be accidental, such as by mutations of the host producing the protein or errors caused by PCR amplification.

[0066] As used herein, the term "sequence identity" or "identity" refers to the number (%) of position matches (same nucleic acid residues) obtained from the comparison of two polynucleotide sequences. Sequence identity is determined by comparing the sequences when aligned to maximize overlap and identity and simultaneously minimize sequence gaps. In particular, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) that optimally aligns the sequences over the entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., Smith and Waterman algorithm (Smith and Waterman, 1981) or Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005)). Comparison for determining the nucleotide sequence identity percentage purpose can be realized in various different ways within the art, for example, using the publicly available computer software that can be obtained on the Internet website, for example, http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . Those skilled in the art can determine the suitable parameters for measuring the comparison, including any algorithm required for obtaining maximum comparison within the full length of the sequence compared. For purposes of the present invention, the nucleotide sequence identity percentage value refers to the value produced using the paired sequence alignment program EMBOSS Needle, which uses the Needleman-Wunsch algorithm to produce the best global comparison of two sequences, wherein all search parameters are set to default values, i.e., scoring matrix=BLOSUM62, gap opening=10, gap extension=0.5, end gap penalty=error, end gap opening=10, end gap extension=0.5.

[0067] The term "subject" or "patient" refers to an animal having a retina, preferably a mammal, and even more preferably a human, including an adult, a child, and a human in the prenatal stage.

[0068] As used herein, the term "variant" refers to a nucleotide sequence that is different from the original sequence but retains its essential properties. In general, a variant is closely similar to the original polynucleotide overall and is consistent in many regions. The sequence of a variant may differ in nucleotide substitutions, deletions or insertions of one or more nucleotides in the sequence that do not impair the promoter activity. A variant may have the same length as the original sequence, or may be shorter or longer.

[0069] The term "functional variant" refers to a variant that exhibits the activity of the corresponding nucleotide sequence, for example, a functional variant of SEQ ID NO. 5 is a variant that specifically expresses the promoter activity of SEQ ID NO: 5 in retinal rod photoreceptors.

[0070] The term "expression cassette" refers to a nucleic acid construct comprising a coding sequence and one or more control sequences required for the expression of the coding sequence. In particular, one of these control sequences is a promoter of the present invention. Typically, the expression cassette comprises a coding sequence required for expressing a selected gene product and regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. Therefore, the expression cassette typically comprises a promoter sequence, a coding sequence, and a 3' non-translated region that typically contains a polyadenylation site and / or a transcription terminator. The expression cassette may also comprise other regulatory elements, such as an enhancer sequence, a polylinker sequence and / or a splicing signal sequence that facilitates the insertion of a DNA fragment in a vector. The expression cassette is typically contained in a vector for ease of cloning and transformation.

[0071] The term "vector" refers to a nucleic acid molecule used as a vehicle to transfer genetic material in vitro or in vivo, particularly to deliver nucleic acids into a host cell. Vectors include, but are not limited to, plasmids, phasmids, cosmids, transposable elements, viruses, and artificial chromosomes (e.g., YACs).

[0072] The human parvovirus adeno-associated virus (AAV) is a dependent virus that is naturally defective with respect to replication and is able to integrate into the genome of infected cells to establish a latent infection. The last property appears to be unique among mammalian viruses, as the integration occurs at a specific site in the human genome located on chromosome 19 called AAVS1 (19q13.3-qter). Therefore, AAV has aroused considerable interest as a potential vector for human gene therapy. The favorable properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the ability to infect a wide range of cell lines derived from different tissues.

[0073] The promoter or expression cassette of the present invention can be introduced into the vector by any method known to the skilled person.

[0074] The expression cassette or vector of the present invention can be transferred into a host cell using any known technique, including but not limited to calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipofection or viral infection, and the expression cassette or vector of the present invention can be maintained in the host cell in an ectopic form, or can be integrated into the genome.

[0075] These compositions comprise a therapeutically effective amount of a therapeutic agent (an expression cassette, vector, virion or cell of the invention) and a pharmaceutically acceptable excipient. As used herein, the term "pharmaceutically acceptable" means approved for use in animals and / or humans by a regulatory agency or a recognized pharmacopoeia such as the European Pharmacopoeia. The term "excipient" refers to a diluent, adjuvant, carrier or vehicle with which a therapeutic agent is administered.

[0076] As is well known in the art, pharmaceutically acceptable excipients are relatively inert substances that facilitate the administration of pharmacologically effective substances, and can be provided as liquid solutions or suspensions, emulsions, or solid forms suitable for dissolving or suspending in liquids before use. For example, excipients can provide shape or consistency, or act as diluents. Suitable excipients include, but are not limited to, stabilizers, wetting and emulsifying agents, salts for changing osmotic pressure, encapsulating agents, pH buffer substances, and buffers. Suitable excipients include any medicament suitable for direct delivery to the eye, which can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, any of sorbitol, various tween compounds, and liquids such as water, saline, glycerol, and ethanol. Pharmaceutically acceptable salts may be included, such as inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc., and salts of organic acids such as acetates, propionates, malonates, benzoates, etc. A full discussion of pharmaceutically acceptable excipients can be obtained in the 15th edition of Remington's Pharmaceutical Sciences. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 It is a structural diagram of the vector genome of pCAG-GFP, pGnat1-NO.1-GFP, pGnat1-NO.2-GFP, pGnat1-NO.3-GFP, and pRho-DsRed in Example 1; from top to bottom, it is a structural diagram of the vector genome of pCAG-GFP, pGnat1-NO.1-GFP, pGnat1-NO.2-GFP, pGnat1-NO.3-GFP, and pRho-DsRed;

[0078] Figure 2 The figures are the in vitro transfection result diagrams of Example 3; the figures in the first row are the in vitro transfection result diagrams of 24h, 48h and 72h after transfection with Gnat1 NO.1 in Example 3; the figures in the second row are the in vitro transfection result diagrams of 24h, 48h and 72h after transfection with Gnat1 NO.2 in Example 3; the figures in the second row are the in vitro transfection result diagrams of 24h, 48h and 72h after transfection with Gnat1 NO.3 in Example 3;

[0079] Figure 3This is a flow chart of retinal electroporation in Example 4;

[0080] Figure 4A The figures are microscopic observations of the retina after electroporation in Example 5; the figures in the first row are GFP fluorescence microscopic observations of the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid; the figures in the second row are DsRed fluorescence microscopic observations of the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid;

[0081] Figure 4B The figures in the first column are immunofluorescence images of step 4 in Example 5, respectively, using the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid in step 4 of Example 5; the figures in the second column are GFP immunofluorescence images of step 4 in Example 5, respectively, using the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid; the figures in the third column are GFP immunofluorescence images of step 4 in Example 5, respectively, using the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid; The figures in the first column are respectively DAPI immunofluorescence imaging images of the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid in step 4 of Example 5; the figures in the fourth column are respectively superimposed images of DsRed immunofluorescence imaging, GFP immunofluorescence imaging and DAPI immunofluorescence imaging of the expression plasmid of pGnat1-NO.1-GFP as the test plasmid, the expression plasmid of pGnat1-NO.2-GFP as the test plasmid, and the expression plasmid of pGnat1-NO.3-GFP as the test plasmid in step 4 of Example 5. DETAILED DESCRIPTION

[0082] In order to enable those skilled in the art to better understand the technical solution of the present invention, some non-limiting embodiments are further disclosed below to further describe the present invention in detail.

[0083] The reagents used in the present invention can be purchased from the market or prepared by the method described in the present invention.

[0084] The manufacturers of some reagents used in the present invention are:

[0085] 2×Hieff Canace PCR Master Mix: Shanghai Yisheng, China;

[0086] BsmBI: New England Biolabs, United States;

[0087] 10× green buffer: New England Biolabs, USA;

[0088] SphI: New England Biolabs, United States;

[0089] Not1: New England Biolabs, United States;

[0090] pCAG-GFP vector: purchased from https: / / www.addgene.org / , Catalog: 11150;

[0091] pRho-DsRed: purchased from https: / / www.addgene.org / , Catalog: 11156;

[0092] 0.1% green buffer: New England Biolabs, USA.

[0093] OCT solution: Sakura brand, Japan.

[0094] Example 1: Nucleic acid vector of the present invention

[0095] The present invention provides a vector containing an expression cassette.

[0096] In this exemplary embodiment, the pCAG-GFP vector is a vector carrying cDNA of enhanced green fluorescence (eGFP). The eGFP cDNA is expressed under the control of a pan-promoter (CAG) or a specific promoter (Gnat1-NO.1, Gnat1-NO.2 or Gnat1-NO.3).

[0097] A vector containing an expression cassette, wherein the expression cassette comprises the following elements:

[0098] 1. Promoter

[0099] CAG promoter (nucleotide sequence: SEQ ID No. 1): about 1.67 Kb; or

[0100] Rho promoter (nucleotide sequence: SEQ ID No. 2): about 2.2 Kb; or

[0101] Gnat1-NO.1 promoter (Gnat1-NO.1, nucleotide sequence: SEQ ID No.3): about 2 Kb; or

[0102] Gnat1-NO.2 promoter (Gnat1-NO.2, nucleotide sequence: SEQ ID No.4): about 1.5 Kb; or

[0103] Gnat1-NO.3 promoter (Gnat1-NO.3, nucleotide sequence: SEQ ID No.5;): about 0.5 Kb.

[0104] 2. Reporter Gene

[0105] Enhanced green fluorescence eGFP (nucleotide sequence: SEQ ID No. 6): about 0.72 Kb; or

[0106] Red fluorescence DsRed (nucleotide sequence: SEQ ID No. 7): about 0.67 Kb.

[0107] 3. Transcription terminator

[0108] The polyadenylation signal of simulated virus No. 40 (SV40) (SV40 pA, nucleotide sequence: SEQ ID No. 8; taagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgct ttatttgtaaccattataagctgcaataaacaagtt): about 0.1 Kb.

[0109] The following vectors were purchased or prepared according to conventional means in the art or according to the preparation method of Example 2: pCAG-GFP vector (commercially available), pGnat1-NO.1-GFP (a plasmid containing Gnat1-NO.1 promoter + enhanced green fluorescence eGFP + SV40 pA), pGnat1-NO.2-GFP (a plasmid containing Gnat1-NO.2 promoter + enhanced green fluorescence eGFP + SV40 pA), pGnat1-NO.3-GFP (a plasmid containing Gnat1-NO.3 promoter + enhanced green fluorescence eGFP + SV40 pA), and pRho-DsRed (a plasmid containing Rho promoter + red fluorescence DsRed + SV40 pA). The structure of the genome of each vector is depicted in Figure 1 middle.

[0110] Example 2: Plasmid construction

[0111] This embodiment involves constructing a plasmid and a promoter specifically expressed in a cell. The construction of the plasmid involves multiple steps, as described below.

[0112] 1. Extract genomic fragments from the retina of C57 mice and amplify the Gnat1 promoter sequence by PCR. The amplification system is shown in Table 1 and the amplification procedure is shown in Table 2.

[0113] The Gnat1 promoter sequence is from the NCBI database, and the sequence number is: NC_000075.7.

[0114] The primer sequences are as follows:

[0115] Gnat1-NO.1 forward primer 1 (SEQ ID No.9):

[0116] ATATAACTAGTCAGGTGACGGGTGTAACTAG;

[0117] Gnat1-NO.1 reverse primer 1 (SEQ ID No.10):

[0118] ATATACGTCTCACCATGGTCCCAGCAGCAGGAAAG;

[0119] Gnat1-NO.2 forward primer 2 (SEQ ID No.11):

[0120] ATATAACTAGTCTATCTTTAGGGACAATTCTATGCTTG;

[0121] Gnat1-NO.2 reverse primer 2 (SEQ ID No.12):

[0122] ATATACGTCTCACCATGGTCCCAGCAGCAGGAAAG;

[0123] Gnat1-NO.3 forward primer 3 (SEQ ID No.13):

[0124] ATATAACTAGTGAGCCTCTTCTAATCGGTAA;

[0125] Gnat1-NO.3 reverse primer 3 (SEQ ID No.14):

[0126] ATATACGTCTCACCATGGTCCCAGCAGCAGGAAAG.

[0127] Table 1: Amplification system

[0128] Components Dosage stencil 500ng Forward primer and reverse primer 4μl each 2×Hieff Canace PCR Master Mix 50μl <![CDATA[H2O]]> Make up to 100 μl

[0129] Table 2: Amplification Procedure

[0130]

[0131] 2. The fragments amplified in step 1 were used as templates for enzyme digestion to obtain the Gnat1-NO.1 sequence after enzyme digestion, the Gnat1-NO.2 sequence after enzyme digestion and the Gnat1-NO.3 sequence after enzyme digestion. The enzyme digestion system is shown in Table 3.

[0132] Table 3: Enzyme digestion system

[0133] Components Dosage template 3000ng BbI 1.5μl 10×green buffer 5μl <![CDATA[H2O]]> Make up to 50ul

[0134] 3. The plasmid pCAG-GFP vector was used as a template for restriction digestion to obtain the plasmid pCAG-GFP vector after restriction digestion. The restriction digestion system is shown in Table 4.

[0135] Table 4: Enzyme digestion system

[0136] Components Dosage template 3000ng S i 2μl Not1 2μl 10×green buffer 5μl <![CDATA[H2O]]> Make up to 50ul

[0137] 4. Insert the Gnat1-NO.1 sequence, Gnat1-NO.2 sequence and Gnat1-NO.3 sequence after restriction digestion in step 2 into the backbone pCAG-GFP (the plasmid pCAG-GFP vector after restriction digestion obtained in step 3) through T4 ligase to construct an expression plasmid of pGnat1-NO.1-GFP, an expression plasmid of pGnat1-NO.2-GFP or an expression plasmid of pGnat1-NO.3-GFP.

[0138] Example 3: Cell culture and transfection

[0139] This example involves the culture and transfection process of HEK293T.

[0140] Cell culture: HEK293T cells were cultured in DMEM supplemented with 10% FBS (fetal bovine serum, Gibco) and 1% penicillin / streptomycin solution (Gibco). The cells were cultured at 37°C in a humidified atmosphere of 5% CO2.

[0141] Cell seeding: HEK293T cells were seeded on 24-well plates (Corning) and cultured for 18-24 hours to allow the cells to reach a confluence of approximately 60%.

[0142] Plasmid transfection: 1 μg of plasmid per well was transfected into cells using Lipofectamine 3000 (Life Technologies) according to the manufacturer's protocol (product instructions).

[0143] Culture and harvesting: After transfection, cells were cultured for 3 days before being harvested and genomic DNA was extracted.

[0144] After verification, the target expression plasmids were obtained respectively.

[0145] like Figure 2 As shown, Gnat1 NO.3 exhibited better GFP transduction efficiency than Gnat1 NO.1 and Gnat1 NO.2, and since the transduction was performed in HEK293T, the pan-promoter CAG exhibited stronger promoter properties.

[0146] Example 4: Subretinal injection

[0147] Ethical Statement of Experimental Animals: The use of all experimental animals in this project was in accordance with the Animal Use Statement of the Society for Research in Vision and Ophthalmology. CD1 mice were purchased from Alpha Biotech Co., Ltd. The experimental mice lived in an environment with a room temperature of 22-25°C, a relative humidity of 40%-70%, a 12-h light cycle, and clean water and food. All animal experimental equipment and materials were approved and evaluated by the Animal Ethics Committee of Wuhan University of Science and Technology, and the treatment of mice during the experiment was in accordance with animal ethics standards.

[0148] After anesthetization of CD1 mice born on P2 (day 2), subretinal injection was performed under a surgical microscope. A sterile 30-gauge bevel needle was used to make an incision through the cornea on the nasal side. Subretinal injection was performed using a microinjector with a 32-gauge blunt-end needle, which passed through the retina to reach the injection site while avoiding the lens. To compare the specific promoter activity, pRho-DsRed was added as a control, and 1 μl of plasmid was injected into each eye (total amount (total amount of pRho-DsRed and the plasmid to be tested) 6 μg, of which pRho-DsRed and the plasmid to be tested (selected from the expression plasmid of pGnat1-NO.1-GFP, the expression plasmid of pGnat1-NO.2-GFP, or the expression plasmid of pGnat1-NO.3-GFP) were each 3 ug), and 0.1% green buffer was added to the plasmid mixture to facilitate observation during injection. After the injection, electrical stimulation was given, and the plasmid perforated into the retinal cells. Apply an appropriate amount of erythromycin ointment to the wound; place the mouse on a heat blanket, and return it to the cage after it fully wakes up and continue to be raised normally for 18 days. Figure 3 shown.

[0149] Example 5: Immunohistochemistry and imaging

[0150] This embodiment relates to methods of immunohistochemistry and imaging, as described below.

[0151] 1. Anesthesia and fixation of mice: After anesthesia, the mice raised normally (normally raised for 20 days in total) in Example 4 were perfused and fixed with 4% paraformaldehyde, and then the eyeballs were removed. The retina was carefully separated with forceps and examined under a microscope. The results are shown in Figure 4A , and put it into a 30wt% sucrose aqueous solution for dehydration.

[0152] 2. Embedding and sectioning: The dehydrated retina in step 1 was transferred to OCT (Optimal Cutting Temperature medium) solution for embedding, and the embedded retina was cut into 20 μm thick frozen sections in Leica CM1950.

[0153] 3. Antibody treatment and staining: The sections were washed in PBS and then incubated in blocking buffer in PBS containing 5% normal donkey serum (Jackson ImmunoResearch), 0.1% Triton X-100 and 0.1% NaN3 for 1 hour at room temperature. After overnight incubation with the primary antibody at 4°C, the sections were washed three times with PBS and then incubated with the secondary antibody for 2 hours in a wet dark box. The nuclei were stained with DAPI (Sigma-Aldrich) and then the sections were mounted with FluoromountG (SouthernBiotech).

[0154] 4. Immunofluorescence imaging: Use an Olympus FV3000 microscope to obtain confocal images. Ensure that all images are acquired under non-saturated conditions. Images to be compared need to be acquired using the same settings. See the results. Figure 4B .

[0155] Results: Figure 4A As shown, the Gnat1 promoter successfully drives GFP expression in the retina; Figure 4B As shown, the Gnat1 promoter exhibited good promoter activity and was specific for rod photoreceptors, GFP was only expressed in photoreceptor cells, and Gnat1 NO.3 showed better GFP transduction efficiency than Gnat1 NO.1 and Gnat1 NO.2, with unexpected technical effects.

[0156] The method of the present invention has been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein within the content, spirit and scope of the present invention to implement and apply the technology of the present invention. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention.

Claims

1. A promoter specifically expressed in retinal rod photoreceptor cells, characterized in that: The promoter nucleic acid has a length of less than 1 kb and comprises a sequence of SEQ ID NO.5 or a functional variant thereof having at least 80% identity with SEQ ID NO.5, or is composed of a sequence of SEQ ID NO.5 or a functional variant thereof having at least 80% identity with SEQ ID NO.5; Optionally, the functional variant has a sequence comprising at least 100-526 consecutive nucleotides of SEQ ID NO.

5.

2. An expression cassette, characterized in that The invention comprises: the nucleic acid of the promoter according to claim 1, the target nucleic acid and the nucleic acid of the transcription terminator; the target nucleic acid is operably connected to the nucleic acid of the promoter according to claim 1 and the nucleic acid of the transcription terminator.

3. The expression cassette according to claim 2, wherein the target nucleic acid comprises at least one of RHO gene (Gene ID: 6010), GNAT1 gene (Gene ID: 2779), PDE6A gene (Gene ID: 5145), PDE6B gene (Gene ID: 5158), CNGB1 gene (Gene ID: 1258), CNGA1 gene (Gene ID: 1259), NRL gene (Gene ID: 4901), CRX gene (Gene ID: 1406), RPE65 gene (Gene ID: 6121), SAG gene (Gene ID: 6295), RDH12 gene (Gene ID: 145226), and ROM1 gene (Gene ID: 6094), or a gene encoding at least one of RHO protein, GNAT1 protein, PDE6A protein, PDE6B protein, CNGB1 protein, CNGA1 protein, NRL protein, CRX protein, RPE65 protein, SAG protein, RDH12 protein, and ROM1 protein; and / or The transcription terminator comprises SV40 pA, β-globin pA or CMV terminator; and / or The nucleotide sequence of the SV40 pA is SEQ ID No.

8.

4. A carrier, characterized in that Comprising the expression cassette according to any one of claims 2 to 3; Optionally, the vector is a plasmid or a viral vector; Optionally, the viral vector is a retroviral vector, or a lentiviral vector or a non-pathogenic parvovirus. Optionally, the vector is a lentiviral vector; Optionally, the vector is an adeno-associated virus (AAV) vector.

5. Use of the promoter according to claim 1, the expression cassette according to any one of claims 2 to 3, or the vector according to claim 4 in the preparation of a drug for expressing a target nucleic acid in retinal rod photoreceptor cells.

6. An in vitro method for expressing a gene in retinal rod photoreceptor cells, characterized in that: The method comprises transfecting a cell line or a cell population with the expression cassette according to any one of claims 2 to 3 or the vector according to claim 4, wherein the cell line or the cell population comprises retinal rod photoreceptors.

7. An isolated cell, characterized in that The isolated cell comprises the expression cassette of any one of claims 2-3 or the vector of claim 4; Optionally, the isolated cells are retinal rod photoreceptor cells.

8. A pharmaceutical composition, characterized in that Comprising the expression cassette of any one of claims 2-3, the vector of claim 4 or the isolated cell of claim 7.

9. The use according to claim 5 or the in vitro method according to claim 6, wherein the retinal rod photoreceptor cells are mammalian retinal rod photoreceptor cells; Optionally, the retinal rod photoreceptor cells are rodent retinal rod photoreceptor cells or human retinal rod photoreceptor cells.

10. Use of the expression cassette according to any one of claims 2 to 3, the vector according to claim 4, the isolated cell according to claim 7, or the pharmaceutical composition according to claim 8 in the preparation of a medicament for treating a disease in which at least one of the RHO gene, GNAT1 gene, PDE6A gene, PDE6B gene, CNGB1 gene, CNGA1 gene, NRL gene, CRX gene, RPE65 gene, SAG gene, RDH12 gene, and ROM1 gene is mutated or defective; Optionally, the disease includes at least one of Retinitis Pigmentosa (RP), Leber Congenital Amaurosis (LCA), Cone-Rod Dystrophy (CRD), Stargardt Disease, Nyctalopia, Congenital Stationary Night Blindness (CSNB), Achromatopsia, Usher Syndrome, Bardet-Biedl Syndrome (BBS), Stargardt Disease, Fundus Albipunctatus, X-Linked Retinoschisis, and photoreceptor cell dysfunction caused by mutations in rods and cones.

Images