Paddy rice promoter induced by acupuncture injury as well as expression vector and application of paddy rice promoter

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to two promoters with inducible expression characteristics and a plant expression vector containing the promoters, and the two promoters P1 and P2 with the inducible expression characteristics are obtained through screening. The two gene promoters are respectively connected with a GUS (glucuronidase) gene and a rice brown planthopper resistance gene OsLecRK1 * optimized by a codon, and rice is transformed by an agrobacterium-mediated method to obtain a transgenic plant. The embodiment of the invention shows that the promoter can effectively drive the expression of the insect-resistant gene OsLecRK1 * and improve the resistance of a transgenic plant to brown planthopper.

Description

Technical Field

[0001] The invention belongs to the technical field of plant gene engineering, and in particular relates to a promoter induced to express by mechanical damage, an expression vector and an application thereof. Background Art

[0002] Rice, as an important food crop in my country, is attacked by a variety of piercing-sucking pests. Common ones include brown planthopper, white-backed planthopper, leafhopper and rice thrips. Brown planthopper is a migratory pest widely distributed in Asia, especially in the rice-growing areas in southern my country. White-backed planthopper mainly occurs in the Yangtze River Basin and the areas south of it, causing great harm to rice. Leafhopper and rice thrips feed on rice in the form of adults and larvae respectively, causing rice growth to be stunted.

[0003] Plant defense responses to piercing-sucking pests are mainly divided into two types: one is a broad-spectrum plant response to the physical damage caused by piercing-sucking insects; the other is the specific recognition of elicitor compounds in the saliva of specific piercing-sucking pests to stimulate specific induced defense responses. Therefore, in theory, the same crop should respond similarly to the physical damage signals of the stings of different piercing-sucking insects, but it has different induced defense responses to different piercing-sucking pests and different elicitors.

[0004] Specific inducible promoters are a type of promoter that can induce gene expression under specific environmental conditions. In transgenic breeding, specific inducible promoters can be used to regulate the expression of insect-resistant genes, allowing them to play a role when attacked by pests, thereby improving the insect resistance of crops. More promoters are needed in this field to regulate the expression of insect-resistant genes and further cultivate insect-resistant rice varieties. Summary of the invention

[0005] The purpose of the present invention is to provide a promoter with inducible expression characteristics, which can not only effectively drive the expression of the insect-resistant gene OsLecRK1*, but also improve the resistance of transgenic plants to brown planthoppers.

[0006] The present invention provides a promoter, the nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing.

[0007] Preferably, the promoter is a promoter whose expression is induced by mechanical damage.

[0008] The present invention also provides an expression vector, which comprises the above promoter and a foreign gene.

[0009] Preferably, the exogenous gene is a reporter gene or a resistance gene.

[0010] More preferably, the resistance gene is the rice brown planthopper resistance gene OsLecRK1*.

[0011] The present invention also provides a host cell containing the above expression vector.

[0012] Preferably, the host cell is derived from rice variety ZH11.

[0013] The present invention also provides an application of a promoter in driving the expression of an insect-resistant gene, wherein the nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence table.

[0014] Preferably, the insect-resistant gene is the rice OsLecRK1* gene.

[0015] The present invention also provides a promoter for use in improving transgenic plants' resistance to brown planthoppers. The nucleotide sequence of the promoter is shown in the sequence table SEQ ID NO: 1 or SEQ ID NO: 2. The promoter is connected to the rice brown planthopper resistance gene OsLecRK1*.

[0016] Beneficial effects:

[0017] The present invention screened out two promoters P1 and P2 with inducible expression characteristics. The expression vector containing the promoter can effectively drive the expression of the insect-resistant gene OsLecRK1* and improve the resistance of transgenic plants to brown planthoppers. This provides potential candidate genes and promoter resources for the development of insect-resistant transgenic crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0019] Figure 1 It is the expression vector of GUS reporter gene;

[0020] Figure 2 OsLecRK1* gene expression vector;

[0021] Figure 3 Construction of Gus gene driven by 35S promoter, P1 and P2

[0022] Figure 4 The results of RT-PCR. The numbers represent different parts and treatments: 1: leaf; 2: leaf sheath; 3: root; 4: stem; 5: stem after brown planthoppers have fed for 24 hours;

[0023] Figure 5 The staining results of Gus gene driven by different promoters;

[0024] Figure 6 is an expression vector containing the OsLecRK1* gene driven by candidate promoters P1 and P2;

[0025] Figure 7 The expression of OsLecRK1* gene after infection by brown planthopper;

[0026] Figure 8 The effect of brown planthopper on plants one week after infection; DETAILED DESCRIPTION

[0027] The present invention compares the transcriptome changes of two rice varieties, insect-resistant variety RH and insect-susceptible variety TN1, under acupuncture injury, explores their response differences to mechanical damage, and obtains two promoters P1 and P2 induced by mechanical damage from the two rice varieties.

[0028]

[0029]

[0030] The present invention uses the genome of rice variety ZH11 as a template to amplify P1 and P2 promoters, connects the two gene promoters to the GUS gene and the rice brown planthopper resistance gene OsLecRK1* after codon optimization, and successfully constructs a promoter vector and a brown planthopper resistance vector. The two vectors are transformed into rice callus tissue by Agrobacterium transformation method, and tissue culture and genetic transformation are performed. Preferably, the Agrobacterium is Agrobacterium EHA105, and preferably, the rice variety is Zhonghua 11.

[0031] Through GUS analysis of transgenic plants, the expression of OsLecRK1* gene was significantly increased under brown planthopper infestation conditions, and showed a higher expression level when infected by brown planthoppers. The resistance identification results further verified the function of OsLecRK1* gene. Under brown planthopper infestation conditions, transgenic plants showed significant resistance and good growth.

[0032] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] The other production processes, experimental methods or detection methods involved in the embodiments of the present invention, unless otherwise specified, are conventional methods in the prior art, and their names and / or abbreviations are conventional names in the art. The Transzols reagent of the present invention was purchased from Quanshijin Biotechnology Co., Ltd., China.

[0034] Example 1 Acquisition of promoter

[0035] According to the Nipponbare reference genome information published by the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), the promoter sequences of LOC_Os04g33920 and LOC_Os12g25090 were cloned, which were 1626 bp and 1959 bp, respectively. Primers P1-F, P1-R, P2-F and P2-R were designed, and PCR amplification was performed using the genomic DNA of rice variety ZH11 as a template.

[0036] P1-F:CTACACGAGCAGACCACT(SEQ ID NO: 3)

[0037] P1-R: AGCATCGTAAGATGGTTCAA (SEQ ID NO: 4)

[0038] P2-F:TACCACCGTGTGGCACTA (SEQ ID NO: 5)

[0039] P2-R:GAGTTCCAGAGGCAGGTT (SEQ ID NO: 6)

[0040] The reaction system of PCR was as follows: DNA template (50 ng / μL) 2 μL, 2× KOD Buffer 10 μL, 10 μM PF 0.2 μL, 10 μM PR 0.2 μL, KOD (Toyobo) 0.2 μL, 10 mM dNTPs 0.4 μL, ddH 2 0 7 μL;

[0041] The PCR amplification program for obtaining the full-length ORF sequence of the LOC_Os04g33920 and LOC_Os12g25090 gene promoters was: 98℃3min; 98℃20s, 54℃30s, 68℃1min30s, 32 cycles; 68℃7min; 25℃1s. If the PCR products were sequenced correctly, the LOC_Os04g33920 and LOC_Os12g25090 gene promoters were obtained and named P1 and P2.

[0042] Example 2 Construction of the expression vector of GUS reporter gene:

[0043] The two gene promoters are connected to the GUS gene respectively to construct an expression vector containing the GUS reporter gene. Construction of the expression vector of the GUS reporter gene: The vector for Gus expression is as follows Figure 1 shown.

[0044] Promoters P1 and P2 were amplified by P1 and P2 primers, respectively, and then double-digested with Pst 1 and BamH 1 to connect to vector DX2181. A reporter gene expression vector driven by promoters P1 and P2 was obtained. The primers used were the primer pairs used in Example 1, wherein the restriction site of P1-F was ctgcag, represented by P1-Fe; the restriction site of P1-R was aagtcc, represented by P1-Re; the restriction site of P2-F was ctgcag, represented by P2-Fe; the restriction site of P2-R was aagtcc, represented by P2-Re.

[0045] P1-Fe:ctgcagCTACACGAGCAGACCACT (SEQ ID NO: 7)

[0046] P1-Re:aagtccAGCATCGTAAGATGGTTCAA (SEQ ID NO: 8)

[0047] P2-Fe:ctgcagTACCACCGTGTGGCACTA (SEQ ID NO: 9)

[0048] P2-Re:aagtccGAGTTCCAGAGGCAGGTT (SEQ ID NO: 10)

[0049] Example 3 Construction process of OsLecRK1* gene expression vector

[0050] The rice major gene Bph3 for brown planthopper resistance is a gene cluster composed of three plasma membrane lectin receptor kinase genes, namely OsLecRK1, OsLecRK2 and OsLecRK3. Among them, OsLecRK1 has the greatest effect on brown planthopper resistance. Two expression vectors containing OsLecRK1* genes were constructed, driven by candidate promoters P1 and P2 respectively. The construction process of OsLecRK1* gene expression vector is as follows Figure 2 As shown:

[0051] (1) P1 and P2 primers were used to amplify P1 and P2 respectively, and then double-digested with Pst 1 and BamH 1 and ligated to the plant cell vector PC1300. The primer pair of P1 and P2 used was the same as the primer pair used in Example 2.

[0052] (2) OsLecRK1* was amplified using OsLecRK1* primers, and then double-digested with BamH 1 and Kpn1 and ligated to the plant cell vector PC1300. The OsLecRK1* primers used were as follows, where the restriction site of OsLecRK1*-F was aagtcc, and the restriction site of OsLecRK1*-R was ggtacc.

[0053] OsLecRK1*-F:aagtccATGGTGGCCCTCCTGCTCTT (SEQ ID NO: 11)

[0054] OsLecRK1*-R:ggtaccCTACGGGAGAGAGCTGAT (SEQ ID NO: 12)

[0055] (3) The Nos terminator was amplified using TNOS primers, and then double-digested with Kpn 1 and EcoR 1 and ligated to the plant cell vector PC1300. The TNOS primers used are as follows, where the restriction site of TNOS-F is aatacc and the restriction site of TNOS-R is gaattc.

[0056] TNOS-F:aataccGATCGTTCAAACATTTGGC (SEQ ID NO: 13)

[0057] TNOS-R:gaattcGATCTAGTAACATAGATG (SEQ ID NO: 14)

[0058] Example 3 GUS analysis

[0059] 3.1 GUS expression level detection

[0060] To verify the functions of the two candidate promoters (P1 and P2), the 35S promoter was used as a positive control. The expression characteristics of these promoters in transgenic plants were evaluated by RT-PCR.

[0061] Using Agrobacterium-mediated transformation, three expression vectors, P35S::GUS, P1::GUS and P2::GUS, all containing the Hygromycin Phosphotransferase gene (HPT) as a selection marker, were transformed into callus tissue of rice variety Zhonghua 11. The GUS gene in each vector is driven by the 35S promoter, P1 and P2 respectively. Figure 3 As shown. Through genetic transformation technology, transgenic plants carrying different vectors were obtained, and transgenic plants were confirmed by resistance screening and PCR identification. RT-PCR experiments were also performed to detect the expression level of the GUS gene in transgenic plants with different vectors. The primers used are as follows:

[0062] q-p1-F:GACAAGATGGCGCTGAAG (SEQ ID NO: 15)

[0063] q-p1-R:TCATGGCAGAGTGTAATCTC (SEQ ID NO: 16)

[0064] q-p2-F:ACCTGCGTCAATGTAATGTTCTG (SEQ ID NO: 17)

[0065] q-p2-R:TCATGGCAGAGTGTAATCTC (SEQ ID NO: 18)

[0066] Gus-F:ACCTGCGTCAATGTAATGTTCTG (SEQ ID NO: 19)

[0067] Gus-R:TTCGGTGATGATAATCGGCTGAT (SEQ ID NO: 20)

[0068] HPT-F: ACACTACATGGCGTGATTTCAT (SEQ ID NO: 21)

[0069] HPT-R:TCCACTATCGGCGAGTACTTCT (SEQ ID NO: 22)

[0070] The results are as follows Figure 4 As shown in the figure, the expression of GUS gene can be detected in all transgenic plants. Under normal circumstances, the expression level of endogenous genes and GUS gene driven by P1 and P2 promoters is relatively low, but after being infected by brown planthoppers, the expression level of GUS gene is significantly upregulated, showing inducible characteristics.

[0071] 3.2 GUS staining analysis

[0072] Rice tissues such as leaves, leaf sheaths, roots and stems of plants fed by brown planthoppers and untreated plants were separated and placed in a staining buffer at 37°C overnight. GUS staining buffer was prepared according to the method of Jefferson et al. (Jefferson, et al. 1987), and the obtained rice tissues were decolorized with 75% and 95% ethanol in an incubator at 37°C, each decolorization was repeated 3 to 5 times for 3 hours. The decolorized tissues were stored in 75% ethanol, observed under a Leica MZFLШ dissecting microscope, and photographed with a Nikon E5400.

[0073] The results are as follows Figure 5 As shown in the figure, the GUS gene driven by the 35S promoter is widely expressed in various tissues of the plant with high staining intensity. However, the GUS genes driven by the P1 and P2 promoters are expressed at low levels in different tissues, and the staining intensity of the stems is significantly enhanced after brown planthopper infection, indicating that their expression shows brown planthopper-induced characteristics. This shows that the promoter has strong local low-level expression and induction ability, and has good application potential in insect-resistant breeding.

[0074] Example 5: RNA extraction, reverse transcription and expression level detection in rice tissue

[0075] Rice tissue samples were immediately stored in liquid nitrogen. Total RNA was extracted using Transzols reagent. 2-3 μg of total RNA was reverse transcribed and DNA contamination was removed using a DNase1 (Invitrogen, Carlsbad, California, USA) kit without oxygen ribonuclease. The first-strand cDNA was obtained using the M-MLV (Invitrogen, Carlsbad, California, USA) reverse transcriptase kit.

[0076] The rice actin gene (Actin) was used as an internal reference gene, and cDNA was amplified by PCR using KOD enzyme, followed by RT-PCR gel electrophoresis detection.

[0077] qRT-PCR experiments were performed using the FastStar Universal SYBR Green Master Kit (Roche, Basel, Switzerland) on an ABI 7500 system (Applied Biosystems, California, USA). The rice actin gene (Actin) was used as an internal reference gene. The primers used in the qRT-PCR experiment are as follows:

[0078] Actin-F:TGGCATCTCTCAGCACATTCC (SEQ ID NO: 23)

[0079] Actin-R:TGCACAATGGATGGGCCAGA (SEQ ID NO: 24)

[0080] Example 7 qRT-PCR expression detection and resistance identification experiment

[0081] To evaluate the effects of these promoters in driving OsLecRK1* gene expression and improving plant resistance, qRT-PCR expression detection and resistance identification experiments were performed. The primers used in the qRT-PCR experiment are as follows:

[0082] q-OsLecRK1*-F:TACCCGAAGAAGGCAAATGC (SEQ ID NO: 25)

[0083] q-OsLecRK1*R:GAAGCAGTCGATCACGCACA (SEQ ID NO: 26)

[0084] like Figure 6 As shown, the expression vector containing OsLecRK1* gene driven by candidate promoters P1 and P2. qRT-PCR results showed that Figure 7 As shown in the figure, the expression of OsLecRK1* gene was significantly increased under the condition of brown planthopper infestation, and showed a higher expression level when infected by brown planthopper. This indicates that both candidate promoters can effectively induce the expression of OsLecRK1* gene.

[0085] Experiment on identification of resistance of transgenic plants to brown planthoppers at the seedling stage:

[0086] The material to be identified was sown in a culture box. When the rice reached the two-leaf stage, 7 to 8 2- to 3-year-old brown planthopper nymphs were added to each plant. When more than 90% of the control ZH11-WT died, each rice plant was scored according to the established 1 to 9 grading standard, and the average value was selected as the resistance value of the corresponding material. The evaluation criteria for rice brown planthopper resistance are shown in Table 1.

[0087] Table 1: Evaluation criteria for rice brown planthopper resistance

[0088] Grade / resistance level Damage degree (plant symptoms) 0 (Immune) No obvious injuries 1(High resistance) The first leaf turns yellow 3(Anti-insect) The second and third leaves are partially yellowing 5 (moderate resistance to moderate feeling) The plant is obviously yellowing or stunted 7 (sense) The plant has only one leaf that has not died and is severely stunted. 9 (High Sensitivity) All leaves of the plant wilt or die

[0089] The results of resistance identification are as follows Figure 8 As shown, the function of OsLecRK1* gene was further verified. Under the condition of brown planthopper infestation, ZH11-WT showed obvious growth inhibition and leaf yellowing, with a resistance level of 7; while the transgenic plants showed significant resistance, with a resistance level of 0-1 and good growth status. This shows that P1 and P2 promoters have good potential in driving OsLecRK1* gene expression and enhancing rice brown planthopper resistance.

[0090] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A promoter, characterized in that The nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing.

2. The promoter according to claim 1, characterized in that The promoter is a promoter whose expression is induced by mechanical damage.

3. An expression vector, characterized in that: The expression vector comprises the promoter and the foreign gene described in claim 1.

4. The expression vector according to claim 3, characterized in that The exogenous gene is a reporter gene or a resistance gene.

5. The expression vector according to claim 4, characterized in that The resistance gene is the rice brown planthopper resistance gene OsLecRK1*.

6. A host cell containing the expression vector according to any one of claims 3 to 4.

7. The host cell according to claim 6, characterized in that The host cell is derived from rice variety ZH11.

8. Use of a promoter in driving the expression of an insect-resistant gene, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence listing.

9. The use according to claim 8, characterized in that: The insect-resistant gene is the rice OsLecRK1* gene.

10. Use of a promoter in improving the resistance of transgenic plants to brown planthoppers, characterized in that: The nucleotide sequence of the promoter is shown in SEQ ID NO: 1 or SEQ ID NO: 2 in the sequence list; the promoter is connected to the rice brown planthopper resistance gene OsLecRK1*.

Images