Wheat gene TaXTH-2D and application of expression cassette and expression vector of wheat gene TaXTH-2D in pre-harvest sprouting resistance and yield regulation and control

Abstract

The invention discloses a wheat gene TaXTH-2D and application of an expression cassette and an expression vector of the wheat gene TaXTH-2D in pre-harvest sprouting resistance and yield regulation, and aims to solve the technical problems that the current wheat pre-harvest sprouting resistance gene research is insufficient and the understanding on a seed pre-harvest sprouting resistance genetic regulation mechanism is not deep. According to the application, a TaXTH-2D gene overexpression strain and a gene editing strain in which TaXTH-2A, TaXTH-2B and TaXTH-2D genes are knocked out at the same time are created, and the two strains are subjected to single-plant yield and thousand seed weight determination and pre-harvest germination resistance identification, so that the regulation effect of the TaXTH-2D gene on wheat pre-harvest germination resistance is confirmed; the method has wide application prospects in the aspects of improving the pre-harvest sprouting resistance of plants, cultivating pre-harvest sprouting resistant plant varieties and the like.

Description

Technical Field

[0001] The present invention relates to the field of biological genetic engineering technology, specifically wheat gene TaXTH-2D , and the application of its expression cassette and expression vector in ear sprout resistance and yield regulation. Background Art

[0002] Seed dormancy and germination are two biological characteristics of mature seeds that are both interrelated and contradictory. As a protective strategy given to plants by nature, the dormancy mechanism can effectively prevent seeds from germinating prematurely under unsuitable environmental conditions, thus greatly promoting the survival of plants in the course of evolution. Triticum aestivum ) is one of the most widely planted food crops in the world. Its yield is directly related to the stability of human food supply and accounts for about 20% of human carbohydrate intake. During the domestication of wheat, weak dormancy characteristics were selected and retained to ensure that seeds can germinate consistently. However, weak dormancy characteristics can easily lead to pre-harvest germination of wheat (ear sprouting, that is, premature germination of seeds before harvest), which is particularly common when high humidity weather occurs during the harvest season, leading to a decrease in wheat yield and quality. Due to the intensification of global climate change and the frequent occurrence of extreme weather events, ear sprouting is becoming increasingly common in wheat-growing areas, causing economic losses of more than one billion US dollars each year, posing a serious threat to global food security. Therefore, understanding the genetic mechanisms that regulate wheat germination and dormancy, and breeding new varieties with stable germination rates and resistance to ear sprouting are crucial to ensuring wheat yield and quality.

[0003] It is becoming increasingly difficult to complete urgent breeding tasks by relying on traditional breeding methods. Transgenic breeding is considered to be the future development direction of agriculture and has broad application prospects. Transgenic is the use of bioengineering technology to introduce foreign genes with certain functions into the genome of the target organism, so as to achieve the purpose of improving the traits of the target organism. Many studies have found that there are quantitative trait loci (QTLs) controlling dormancy and ear sprout resistance on each chromosome of wheat. However, only a few candidate genes have been identified at these loci, and the genetic regulatory mechanism of seed dormancy and ear sprout resistance is still unclear.

[0004] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0005] Xyloglucan endotransglucosylase / hydrolase (XTH) is an important enzyme involved in cell wall remodeling. Many studies have shown that this family of genes plays an important role in plant growth and development and adaptation to stress. TaXTH-7A Overexpression of the gene in Arabidopsis thaliana improves drought tolerance in plants, suggesting that XTH family members may play an important role in wheat drought tolerance. TaXTH-7A Transgenic expression in wheat and its effect on wheat drought tolerance. TaXTH-2D It plays an important role in regulating wheat drought tolerance (see CN117327716A). TaXTH-2D Function in the regulation of drought tolerance in wheat, creating overexpression TaXTH-2D Transgenic wheat materials and simultaneous knockout TaXTH-2A, TaXTH-2B and TaXTH-2D CRISPR-Cas9 gene editing materials for gene, examination TaXTH-2D The yield per plant and 1000-grain weight of the overexpression and gene-edited genetic materials were studied. It was found that there was no significant difference in the yield per plant and 1000-grain weight of the overexpression and gene-edited genetic materials compared with the recipient control plants. However, after copying the wheat materials harvested in 2023 that had severe ear sprouting, it was unexpectedly found that TaXTH-2D The yield per plant and 1000-grain weight of the overexpression lines were higher than those of the receptor control. TaXTH The yield per plant and 1000-grain weight of the gene-edited lines were lower than those of the recipient control, which indicates that TaXTH-2D May affect ear sprout resistance.

[0006] Based on this, the present application discloses wheat gene TaXTH-2D , containing wheat genes TaXTH-2D Gene expression cassette or containing wheat gene TaXTH-2D Application of expression vector in the regulation of ear sprout resistance.

[0007] In some embodiments of the present disclosure, the wheat gene TaXTH-2D Overexpression in plants.

[0008] The second aspect disclosed in the present application provides a wheat gene TaXTH-2D , containing wheat genes TaXTH-2D Gene expression cassette or containing wheat gene TaXTH-2D Application of the expression vector in the preparation of spike sprouting resistance regulating reagents.

[0009] The third aspect disclosed in the present application provides a wheat gene TaXTH-2D , containing wheat genes TaXTH-2D Gene expression cassette or containing wheat geneTaXTH-2D Application of the expression vector in breeding / identifying plant varieties / lines with ear sprout resistance.

[0010] The fourth aspect disclosed in the present application provides a wheat gene TaXTH-2D , containing wheat genes TaXTH-2D Gene expression cassette or containing wheat gene TaXTH-2D The use of the expression vector in the preparation of reagents for breeding / identification of ear sprout resistance.

[0011] The fifth aspect disclosed in the present application provides a wheat gene TaXTH-2D , containing wheat genes TaXTH-2D Gene expression cassette or containing wheat gene TaXTH-2D The invention relates to the use of the expression vector in constructing or breeding transgenic plants with ear sprout resistance.

[0012] The sixth aspect disclosed in the present application provides a wheat gene TaXTH-2D , containing wheat genes TaXTH-2D Gene expression cassette or containing wheat gene TaXTH-2D Application of the expression vector in increasing single plant yield and / or thousand-grain weight.

[0013] In some embodiments of the present disclosure, the gene expression cassette contains an Actin promoter and a Nos terminator.

[0014] In some embodiments of the present disclosure, the wheat gene TaXTH-2D The DNA sequence is shown in SEQ ID NO.1.

[0015] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: This application confirms TaXTH-2D The gene regulates the plant's ear sprout resistance. For example, under the regulation of this gene, the yield per plant and the thousand-grain weight of wheat are both increased. The analysis and utilization of the gene function will help understand the genetic mechanism of wheat ear sprout resistance, provide important gene resources and related germplasm resources for breeding ear sprout-resistant plant varieties, and provide important technical support for molecular breeding to improve plant ear sprout resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The single plant yield and thousand-grain weight of wheat materials with severe ear sprouting harvested in 2023 in one embodiment of the present application; A: TaXTH-2D Single plant yield and 1000-grain weight of gene overexpression materials, KN199 is the receptor control, OE1, OE2, OE3 and OE4 are overexpression lines; B: TaXTHSingle plant yield and 1000-grain weight of gene-edited materials. Fielder is the receptor control, and KO1, KO2, KO3 and KO4 are gene-edited lines.

[0017] Figure 2 In one embodiment of this application TaXTH-2D Identification of ear sprouting resistance of gene overexpression materials; A: Visible ear germination of overexpression lines (OE1 and OE3) and control materials; B: The ratio of visible ear germinated grains (PVSK) of overexpression lines (OE1 and OE3) and control materials; C: Germination of whole ear grains of overexpression lines (OE1 and OE3) and control materials; D: Seed germination rate of overexpression lines (OE1 and OE3) and control materials (the rupture of the epidermis of the grain embryo was used as the germination standard).

[0018] Figure 3 In one embodiment of this application TaXTH-2D Identification of ear sprouting resistance of gene-edited materials; A: Visible ear germination of gene-edited lines (KO1 and KO3) and control materials; B: The ratio of visible ear germinated grains (PVSK) of gene-edited lines (KO1 and KO3) and control materials; C: Germination of whole ear grains of gene-edited lines (KO1 and KO3) and control materials; D: Seed germination rate of gene-edited lines (KO1 and KO3) and control materials (the rupture of the epidermis of the grain embryo is used as the germination standard). DETAILED DESCRIPTION

[0019] The specific implementation methods of the present invention are described below in conjunction with examples, but the following examples are only used to illustrate the present application in detail and do not limit the scope of the present application in any way.

[0020] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents and materials involved are all conventional commercial products unless otherwise specified; the tests and detection methods involved are all conventional methods unless otherwise specified.

[0021] Embodiment 1 TaXTH-2D Creation of gene overexpression materials and gene editing materials In this case, the pActin-TaXTH-2D vector constructed in the previous stage was used as a template to obtain the gene containing TaXTH-2D The expression cassette fragment was amplified by PCR using the pActin-bar vector as a template to obtain the screening marker Bar The gene expression cassette fragment was inserted into TaXTH-2D The expression cassette containing the Bar gene was co-transformed into the wheat variety Kenong 199 to obtain TaXTH-2D In this case, BarThe gene expression cassette provides herbicide resistance and is used to select transgenic plants.

[0022] SP6 primer: 5′-ATTTAGGTGACACTATAG-3′; T7 primer: 5′-TAATACGACTCACTATAGGG-3′.

[0023] When performing PCR amplification reaction, TaKaRa's PrimerStar high-fidelity enzyme was used. The PCR amplification reaction program was: 95°C pre-denaturation for 4 min; 98°C denaturation for 10 s, 55°C annealing for 15 s, 72°C extension for 3.5 min, for a total of 35 cycles. The specific reaction system is shown in Table 1.

[0024] Table 1 PCR reaction system .

[0025] The PCR products were identified by agarose gel electrophoresis, and a 2357 bp band was obtained by amplifying the Bar gene expression cassette. TaXTH-2D The expression cassette obtained a 3408 bp band, indicating that the expression cassette for genetic transformation was successfully amplified.

[0026] In order to create gene editing materials using CRISPR / Cas9 technology, we first designed a gene editing target sgRNA: AGAGGAAGGCGTCCCGGGACTGG, which is located on the first exon and targets three copies of TaXTH-2A, 2B, and 2D. First, the target site sgRNA was constructed into the Blunt-TaU3 vector to form Blunt-TaU3-sgRNA, and then the Blunt-TaU3-sgRNA was amplified, and the amplified fragment was seamlessly cloned into the HindIII-cut pLH3 vector to form the final vector. The constructed final vector was transformed into Agrobacterium, and then introduced into the wheat material Fielder through Agrobacterium-mediated genetic transformation technology to obtain gene editing materials.

[0027] Embodiment 2 TaXTH-2D Determination of yield-related traits in transgenic wheat Will TaXTH-2D The overexpression and gene editing materials were planted at the experimental base of Henan Agricultural University in October 2022. Conventional field management was adopted throughout the wheat growth period. During the flowering period of wheat, 12 plants were randomly selected for listing in each strain. After full maturity, the individual plants were harvested and the yield and thousand-grain weight of the individual plants were weighed. Before the wheat harvest in 2023, it rained in Zhengzhou for several consecutive days, resulting in severe spike germination in the wheat materials. However, after the harvest and seeding, it was found that TaXTH-2DThe yield per plant and 1000-grain weight of the overexpression line were higher than those of the receptor control, while the yield per plant and 1000-grain weight of the TaXTH gene-edited line were lower than those of the receptor control ( Figure 1 ).

[0028] Embodiment 3 TaXTH-2D Identification of ear sprout resistance in transgenic wheat During the flowering period of wheat, 15 main stem ears were randomly selected for hanging in each strain. When the wheat stems, leaves, and ears all turned yellow (late wax maturity), the hanging materials were collected (cut from 5-10 cm below the stem of the ear), and 5 ears were used as a replicate. The harvested materials were soaked in sterile water for 4 hours, and then soaked and disinfected in 1% sodium hypochlorite solution for 15 minutes, then wrapped with wet filter paper and placed in a beaker with sterile water at the bottom. The beaker was placed in an incubator at 22°C to keep the filter paper moist. Photos of the germination of the entire ear were taken around the fifth day, and the number of visible sprouted kernels (the visible germination standard was the embryo extending out of the husk), the number of all germinated kernels (the germination standard was the rupture of the epidermis of the embryo of the grain), and the total number of kernels per ear were recorded to calculate the percentage of visible sprouted kernels (PVSK) and the percentage of all germinated seeds (the germination standard was the rupture of the epidermis of the embryo of the grain). The results showed TaXTH-2D The ratio of visible germinated kernels and seed germination rate of the overexpression lines were lower than those of the receptor control ( Figure 2 ), while the PVSK and seed germination rates of the gene-edited lines were higher than those of the recipient control ( Figure 3 ),illustrate TaXTH-2D Genes can improve wheat ear sprout resistance.

[0029] Although some preferred embodiments of the present application have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present application.

[0030] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. Wheat genes <h2 style=";text-align:left;direction:ltr">TaXTH-2D , containing wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Gene expression cassette or containing wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Application of expression vector in the regulation of ear sprout resistance.

2. The use according to claim 1, characterized in that: The wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Overexpression in plants.

3. Wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D , containing wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Gene expression cassette or containing wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Application of the expression vector in the preparation of spike sprouting resistance regulating reagents.

4. Wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D , containing wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Gene expression cassette or containing wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Application of the expression vector in breeding / identifying plant varieties / lines with ear sprout resistance.

5. Wheat Genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D , containing wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Gene expression cassette or containing wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D The use of the expression vector in the preparation of reagents for breeding / identification of ear sprout resistance.

6. Wheat Genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D , containing wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Gene expression cassette or containing wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D The invention relates to the use of the expression vector in constructing or breeding transgenic plants with ear sprout resistance.

7. Wheat Genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D , containing wheat genes <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Gene expression cassette or containing wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D Application of the expression vector in improving wheat yield per plant and / or thousand-grain weight.

8. The use according to claim 1, 3, 4, 5, 6 or 7, characterized in that: The gene expression cassette contains Actin promoter and Nos terminator; the wheat gene <h2 style=";text-align:left;direction:ltr"> TaXTH-2D The DNA sequence is shown in SEQ ID NO.1.

Images