Method for preparing glucose crystals by using glucose secondary mother liquor

Abstract

The invention relates to a method for preparing glucose crystals by using glucose secondary mother liquor, and belongs to the technical field of bioengineering. Bacillus subtilis WB600 is used as a chassis strain, pP43NMK is used as an expression vector, an oligosaccharide debranching enzyme mutant is subjected to heterologous expression, the mutant is obtained by mutating the 219th valine of amino acid as shown in SEQ ID NO.1 into alanine, an extracellular expression product is obtained and used for treating residual liquid after secondary extraction of glucose crystals, and the mutant is subjected to high-yield extraction of glucose crystals. The content of small molecule sugar in the treated glucose secondary mother liquor is reduced, the content of glucose is increased, the treated glucose secondary mother liquor is used for recrystallization to obtain dextrose monohydrate, the decolorization rate and crystallization rate of products are improved, the problems that in the prior art, the utilization rate of the glucose secondary mother liquor is low, and the market value is limited can be effectively solved, and good industrial application prospects are achieved.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a method for preparing glucose crystals by utilizing glucose secondary mother liquor. Background Art

[0002] Starch is a covalent polymer formed by glucose dehydration and glycosidic bond connection. It is a high molecular weight carbohydrate. Its basic building block is α-D-glucose. Starch is mainly divided into two categories: straight-chain starch and amylopectin. Dehydrated glucose connected by α-1,4-glycosidic bonds is called straight-chain starch. The molecular structure of amylopectin is more complex than that of straight-chain starch. It is mainly a main chain connected by α-1,4-glycosidic bonds, and at the branch point, it is connected into multiple branch structures by α-1,6-glycosidic bonds.

[0003] Starch sugar production has a long history. Various sugars such as glucose, maltose, oligosaccharides and fructose syrup are obtained from starch raw materials by acid or enzyme methods, and are collectively referred to as starch sugars. Glucose is a monosaccharide widely distributed in nature. The industrial production of glucose mainly adopts the double enzyme method, that is, the starch is liquefied by α-amylase and then glucoamylase is added for saccharification reaction. Amylase refers to an enzyme that can act on starch. Amylase mainly hydrolyzes glycosidic bonds in starch molecules. At present, the enzymes used in industrial starch sugar production are mainly: α-amylase, β-amylase, glucoamylase and debranching enzymes. Among them, debranching enzymes mainly hydrolyze α-1,6-glycosidic bonds in starch or macromolecular glycogen. According to their different specificity for substrates, debranching enzymes are divided into amylopectinase, isoamylase and oligosaccharide debranching enzymes. Glucoamylase mainly acts on the α-1,4-glycosidic bonds in starch, and its hydrolysis efficiency for α-1,6-glycosidic bonds is very slow. At the same time, glucoamylase also has transglycosidic activity, and catalyzes glucose polymerization to generate isomaltooligosaccharides composed of α-1,6-glycosidic bonds when the glucose concentration is high in the late stage of saccharification reaction. Therefore, when saccharifying enzyme is used alone, starch hydrolysis is not thorough enough, and more by-products are produced.

[0004] In order to obtain high-purity glucose syrup, debranching enzymes can be used in combination in the saccharification reaction. Debranching enzymes are responsible for hydrolyzing branch points in the substrate, providing linear substrates that are easier to hydrolyze for saccharifying enzymes, accelerating the saccharification reaction, reducing the generation of by-products, and improving the yield and purity of glucose. Pullulanase has high debranching efficiency for dextrin and pullulan with relatively small molecular weight, but low debranching efficiency for large molecular starch. Some pullulanases have α-1,4-glycosidic bond hydrolysis activity and are prone to produce more by-products. Isoamylase has high debranching efficiency for amylopectin with relatively large molecular weight and glycogen with dense branches, but low debranching efficiency for small molecular maltodextrin. Oligo-1,6-Glucosidase (EC 2.4.1.10) is an enzyme that can hydrolyze the α-1,6-glycosidic bonds between oligosaccharide molecules to generate more small-molecule sugars. However, in industry, there is an urgent need for an oligosaccharide debranching enzyme that can hydrolyze the α-1,4-glycosidic bonds between small-molecule sugar molecules to meet the industrial demand for the hydrolysis of maltooligosaccharides and isomaltooligosaccharides. In current research, most oligosaccharide debranching enzymes are expressed in Escherichia coli and almost all are expressed intracellularly. This expression system is difficult to obtain enzyme solution, has cumbersome steps, and is inefficient, which seriously hinders the large-scale industrial application of oligosaccharide debranching enzymes. Bacillus subtilis is a Gram-positive bacterium that is ubiquitous in nature. Due to its unique physiological advantages and the identity of food-grade engineered bacteria, it is widely used in multiple industries such as food, agriculture, environment, and biology.

[0005] In the industrial production process of glucose, the reaction liquid remaining after the crystallized glucose is separated from the crystallization tank is called glucose mother liquor. According to the number of glucose crystallizations, it can be divided into primary mother liquor, secondary mother liquor and chromatographic residual liquor. Among them, the primary mother liquor will return to the crystallization tank for crystallization again, but the secondary mother liquor is difficult to crystallize again due to its low glucose content and high content of small molecule sugars such as disaccharides and trisaccharides. It is usually sold, but since a large amount of glucose mother liquor is produced after each crystallization, the price of glucose mother liquor is low and the market value is limited, which is contrary to the concept of recycling green that makes full use of waste. During the glucose crystallization process, some pigments and impurities may remain in the glucose mother liquor, which have a direct impact on the quality of the final product. By monitoring the changes in conductivity, the content of impurities such as inorganic salts in the solution can be understood. Generally, higher conductivity means that there are more inorganic salt impurities, which will affect the purity of glucose crystals.

[0006] Therefore, how to make full use of various small molecule sugars in glucose mother liquor, improve the comprehensive utilization rate and economic value of glucose mother liquor, and enhance the purity and quality of glucose crystals are issues that need to be urgently addressed. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a method for preparing glucose crystals by using glucose secondary mother liquor, using Bacillus subtilis WB600 as a chassis strain, using pP43NMK as an expression vector, heterologously expressing an oligosaccharide debranching enzyme mutant, wherein the mutant is a mutant in which the valine at position 219 of the amino acid shown in SEQ ID NO.1 is mutated to alanine, and the extracellular expression product obtained is used to treat the residual liquid after secondary extraction of glucose crystals. The content of small molecular sugars in the treated glucose secondary mother liquor is reduced, and the content of glucose is increased, and the glucose is used for re-crystallization to obtain glucose monohydrate.

[0008] The first object of the present invention is to provide a method for preparing glucose crystals using glucose secondary mother liquor, using an oligosaccharide debranching enzyme mutant to treat the glucose secondary mother liquor, wherein the glucose secondary mother liquor is the residual liquid after secondary extraction of glucose crystals, and the oligosaccharide debranching enzyme mutant is obtained by mutating the 219th valine in the amino acid sequence shown in SEQ ID NO.1 to alanine, and is heterologously expressed by Bacillus subtilis.

[0009] Furthermore, the method also includes the steps of desalting, decolorizing, filtering, concentrating, cooling and drying.

[0010] Furthermore, the Bacillus subtilis uses pP43NMK as an expression vector.

[0011] Furthermore, the Bacillus subtilis is Bacillus subtilis WB600.

[0012] Furthermore, the treatment time is 0-48 hours.

[0013] Preferably, the treatment time is 24 hours.

[0014] Furthermore, the pH value of the glucose secondary mother liquor is 5-7.

[0015] Preferably, the pH value of the glucose secondary mother liquor is 6.

[0016] Furthermore, the mass concentration of the substrate in the glucose secondary mother liquor is 10-50%.

[0017] Preferably, the mass concentration of the substrate in the glucose secondary mother liquor is 40%.

[0018] Furthermore, the added amount of the oligosaccharide debranching enzyme mutant is 0-50 U / g.

[0019] Preferably, the added amount of the oligosaccharide debranching enzyme mutant is 30 U / g.

[0020] The second object of the present invention is to provide a recombinant Bacillus subtilis, wherein the recombinant Bacillus subtilis uses Bacillus subtilis WB600 as an expression host and pP43NMK as an expression vector to heterologously express an oligosaccharide debranching enzyme mutant, wherein the oligosaccharide debranching enzyme mutant is obtained by mutating the valine at position 219 of the amino acid sequence shown in SEQ ID NO.1 to alanine.

[0021] The third object of the present invention is to provide a microbial agent comprising the above-mentioned recombinant Bacillus subtilis.

[0022] The use of the above-mentioned recombinant Bacillus subtilis or the above-mentioned microbial agent in preparing glucose crystals using glucose secondary mother liquor.

[0023] Beneficial effects of the present invention:

[0024] The present invention uses genetic engineering to efficiently secrete and express oligosaccharide debranching enzymes through a Bacillus subtilis system, thereby reducing the difficulty of obtaining, simplifying the enzyme extraction process, and laying a solid material foundation for the industrial application of oligosaccharide debranching enzymes. The oligosaccharide debranching enzyme mutants are applied to treat glucose secondary mother liquor, and the treated glucose secondary mother liquor is used to crystallize again to obtain glucose monohydrate, and the product decolorization rate and crystallization rate are improved, which can effectively solve the problems of low utilization rate of glucose secondary mother liquor and limited market value in the prior art, and has good industrial application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0026] Figure 1 This is the SDS-PAGE analysis of the recombinant oligosaccharide debranching enzyme mutant constructed in Example 2 of the present invention, wherein M is the protein standard molecular weight, and lane 1 is the extracellular supernatant of Bacillus subtilis;

[0027] Figure 2 HPLC curves of the reaction products before and after the oligosaccharide debranching enzyme mutant in Example 3 of the present invention acts on 40% (w / w) glucose secondary mother liquor;

[0028] Figure 3 HPLC curves of the products of the oligosaccharide debranching enzyme mutant in Example 6 of the present invention acting on 40% (w / w) glucose secondary mother liquor at different time periods. DETAILED DESCRIPTION

[0029] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0030] The culture medium involved in the embodiment is as follows:

[0031] LB medium: yeast powder 5 g / L, tryptone 10 g / L, NaCl 10 g / L, pH 7.0.

[0032] TB medium: yeast powder 24g / L, tryptone 12g / L, K 2 HPO 4 16.432g / L, KH 2 PO 4 2.314g / L, glycerol 5g / L, pH 7.0.

[0033] LB solid medium: 1.5% (w / v) agar powder was added to LB medium.

[0034] The detection method involved in the embodiment is as follows:

[0035] Enzyme activity determination: 800 μL substrate pNPG (p-nitrophenyl α-D-glucoside, 10 mM) and 150 μL phosphate buffer (500 mM, pH 6.0) were mixed in a 5 mL centrifuge tube, placed in a 50 °C water bath for 15 min, and 50 μL of the diluted enzyme solution to be tested was added. After 5 min of reaction, 1 mL of Na 2 CO 3 Solution (1M) was added to terminate the reaction and the absorbance was measured at 410nm. The enzyme solution inactivated at high temperature was used as a blank control. Enzyme activity definition: Under the above conditions, 1 μmol of p-nitrophenol (pNP) is hydrolyzed per minute as 1 unit of enzyme activity.

[0036] Conductivity determination: conductivity meter.

[0037] Decolorization rate: The change in absorbance of the sugar solution at a wavelength of 420nm before and after decolorization. The UV spectrophotometer is the main equipment for measuring the absorbance of the sugar solution. The decolorization rate is calculated as follows:

[0038]

[0039] Where: A 0 is the absorbance of the sugar solution before decolorization, A 1 It is the absorbance value of the sugar solution after decolorization.

[0040] Crystallization rate: The mass of solids before and after crystallization. The calculation method of crystallization rate is

[0041]

[0042] Where: M 1 is the mass of the crystal after crystallization, M 2is the mass of the reaction solution before crystallization, A is the solid content of the crystals after crystallization, and B is the purity of glucose.

[0043] Example 1: Construction of a recombinant Bacillus subtilis secretory expression system

[0044] The recombinant plasmid pET-28a(+) / V219A was used as a template (disclosed in patent CN116064456A), and the primers required for this experiment were designed, and the two end primers R1 and F1 were designed; two restriction enzyme sites (BamH I and Pst I) on the empty plasmid pP43NMK were selected, and the oligosaccharide debranching enzyme gene was obtained after PCR amplification, and the pP43NMK vector linear fragment was obtained after double enzyme digestion. The PCR reaction system was 25μL 2×Phanta Max Master Mix, 2μL forward primer (10μM), 2μL reverse primer (10μM), 1μL template DNA, and 20μL sterile ultrapure water. The PCR amplification conditions were 98℃ pre-denaturation for 3min, followed by 30 cycles (98℃10s, 60℃15s, 68℃1min / kb); and finally 4℃ for 10min. The double enzyme digestion reaction system was 40 μL Buffer Y, 15 μL empty pP43NMK vector, 2 μL Pst I, and 2 μL BamH I.

[0045] Table 1 Primers for PCR amplification

[0046] Primers Primer sequence (5'-3') R1 ATGCTTCTATTTCCATTTGAGAGCAGGA F1 GTGGTGGTGGGTGGTGGTGGCCCTGCAAGCGCAGGA

[0047] The target gene was connected to the vector fragment after enzyme digestion using the homologous recombination method. The connection system was: 2μL target gene fragment, 2μL pP43NMK vector fragment, 4μL 5×CE II Buffer, 2μL Exnase II, 10μL sterile ultrapure water, fully mixed and incubated at 37°C for 30min. After the connection was completed, the recombinant plasmid was transformed into the cloning host E.coli JM109, and spread on the LB solid medium containing ampicillin, and cultured in a 37°C incubator overnight. The next day, a single colony of appropriate size was picked and cultured in LB liquid medium. After culturing in a 37°C shaker for 10-12h, the plasmid was extracted and sequenced, and the expression vector pP43NMK / V219A with correct sequencing was transformed into the expression host B.subtilis WB600. The genetically engineered bacteria were preserved according to the same operation as above and named B.subtilis WB600 (pP43NMK / V219A).

[0048] Example 2: Fermentation production of recombinant oligosaccharide debranching enzyme

[0049] (1) The genetically engineered bacteria B. subtilis WB600 (pP43NMK / V219A) prepared in Example 1 was streaked on a LB solid culture medium and placed in a 37° C. constant temperature incubator for overnight culture. On the second day, a positive single colony was picked and inoculated into 50 mL LB liquid culture medium containing 10 μg / mL kanamycin, and cultured at 37° C. and 200 r / min for 8-10 h to obtain an activated seed solution;

[0050] (2) The activated seed solution was transferred to 50 mL TB liquid culture medium containing 10 μg / mL kanamycin at an inoculum volume of 4% (v / v), and cultured in a shaking flask at 30° C. and 200 rpm for 72 h to prepare a fermentation broth;

[0051] (3) After 72 hours of fermentation, the bacterial solution was centrifuged at 4°C and 10,000 r / min for 20 minutes. The extracellularly expressed oligosaccharide debranching enzyme mutant enzyme solution was present in the supernatant. Samples were taken for SDS-PAGE protein electrophoresis and enzyme activity determination. The results were as follows: Figure 1 As shown, the enzyme activity of the oligosaccharide debranching enzyme mutant was 175 U / mL and the bands in the protein electrophoresis were clear and correctly positioned, indicating that the oligosaccharide debranching enzyme mutant had been successfully secreted and expressed in the Bacillus subtilis system.

[0052] Example 3: Treatment of secondary mother liquor with oligosaccharide debranching enzyme mutants to increase glucose content

[0053] Prepare a glucose secondary mother liquor with a substrate concentration of 40% (dry basis, w / w), adjust its pH value to 6.0, keep it in a 50°C water bath for 15 minutes, add 30U / g (substrate dry basis) of the oligosaccharide debranching enzyme mutant prepared in Example 1, start the reaction timer, react for 24 hours under a stirring rate of 200r / min, and inactivate the enzyme in a boiling water bath for 30 minutes to terminate the reaction. Centrifuge the reaction solution after enzyme inactivation at 10000r / min for 10 minutes, take the supernatant and pass it through a 0.22μm water system membrane, and then dilute it 20 times, and use high performance liquid chromatography (HPLC) to analyze the content of various small molecule sugars in the product. By calculating the peak area of ​​various small molecule sugars in the system before and after the reaction, and calculating its concentration by peak area and comparing it with the dry matter in the substrate, the oligosaccharide debranching enzyme mutant hydrolyzes oligosaccharides in the glucose secondary mother liquor.

[0054] The contents of small molecule sugars before and after treatment with the oligosaccharide debranching enzyme mutant are shown in Table 2. The maltose content in the hydrolyzate decreased from 8.98% to 0.15%, the isomaltose content decreased from 7.56% to 0.16%, and the panose content decreased from 1.76% to undetectable; at the same time, the glucose percentage increased from 81.36% to 99.35%. This result shows that the use of oligosaccharide delipase to treat glucose secondary mother liquor can hydrolyze oligosaccharides, while increasing the glucose content and reducing the content of small molecule sugars.

[0055] Table 2 Product analysis of oligosaccharide debranching enzyme mutants in treating glucose secondary mother liquor

[0056]

[0057] Note: F stands for fructose, G 1 G stands for glucose 2 stands for maltose, IG 2 A stands for isomaltose and P stands for panose.

[0058] Example 4: Comparison of oligosaccharide debranching enzyme mutants in treating glucose secondary mother liquors with different substrate concentrations

[0059] According to the method involved in Example 3, a glucose secondary mother liquor reaction system was constructed to prepare glucose secondary mother liquors with substrate concentrations of 10%, 20%, 30%, 40% and 50% (dry basis, w / w), respectively, and other reaction conditions, reaction processes and detection methods remained unchanged. The results of glucose content obtained at different substrate concentrations in this example are shown in Table 3.

[0060] Table 3 Effects of oligosaccharide debranching enzyme mutants on glucose content at different substrate concentrations

[0061] Secondary mother liquor concentration (w / w) Glucose content (%) 10％ 99.21 20％ 99.32 30％ 99.06 40％ 99.35 50％ 98.74

[0062] As shown in Table 3, as the substrate concentration continues to increase, the glucose content in the treated glucose secondary mother liquor remains basically unchanged, but when the substrate concentration of the secondary mother liquor reaches 50% (dry basis, w / w), the glucose content begins to decrease slightly, which may be because glucose, as a product of the oligosaccharide debranching enzyme mutant, inhibits the enzyme activity of the oligosaccharide debranching enzyme mutant at a certain concentration. When the glucose content in the substrate is high, the substrate inhibition degree increases and the enzyme activity decreases.

[0063] Example 5: Comparison of different addition amounts of oligosaccharide debranching enzyme mutants in treating glucose secondary mother liquor

[0064] According to the method involved in Example 3, the glucose secondary mother liquor reaction system was constructed, and the dosage of the oligosaccharide debranching enzyme mutant was 0 U / g, 10 U / g, 20 U / g, 30 U / g, 40 U / g and 50 U / g substrate, respectively, and the other reaction conditions, reaction process and detection method remained unchanged. The results of glucose content obtained by different enzyme addition amounts in this example are shown in Table 4.

[0065] Table 4 Effect of oligosaccharide debranching enzyme mutants on glucose content at different enzyme addition amounts

[0066] Different enzyme addition amounts (U / g) Glucose content (%) 0 81.36 10 97.54 20 98.32 30 99.21 40 99.01 50 98.57

[0067] As shown in Table 4, when the addition amount of oligosaccharide debranching enzyme mutant was 0-50U / g, the glucose content increased, indicating that the oligosaccharide debranching enzyme mutant had a certain effect in the glucose secondary mother liquor. When the enzyme addition amount was 10U / g, the glucose yield could be increased from 81.36% to 97.54%; when the addition amount of oligosaccharide debranching enzyme mutant was 20-30U / g, the glucose yield was stable at about 99%; when the addition amount of oligosaccharide debranching enzyme mutant was 50U / g, the glucose yield began to stop increasing, which may be because the small molecular sugars in the glucose secondary mother liquor have been fully contacted with the oligosaccharide debranching enzyme mutant and the reaction is complete.

[0068] Example 6: Comparison of oligosaccharide debranching enzyme mutants in treating glucose secondary mother liquor at different times

[0069] According to the method involved in Example 3, a glucose secondary mother liquor reaction system was constructed, and the reaction times were 0 h, 6 h, 12 h, 24 h, 36 h and 48 h, respectively, and the other reaction conditions, reaction process and detection method were the same as in Example 3. The results of glucose content obtained at different reaction times in this example are shown in Table 5.

[0070] Table 5 Effect of oligosaccharide debranching enzyme mutants on glucose content at different reaction times

[0071] Different reaction time (h) Glucose content (%) 0 81.36 6 91.45 12 97.89 24 99.25 36 99.01 48 98.65

[0072] As shown in Table 5, when the reaction time is 0-24h, the glucose content increases continuously, reaching a maximum value of 99.25% at 24h. When the reaction is continued to 36h, the glucose content is basically stable, indicating that the oligosaccharide debranching enzyme mutant has reacted completely with maltose, isomaltose and panose in the reaction system. If the reaction is continued to 48h, the glucose content decreases slightly, which may be because the reaction time is too long and other bacteria grow in the reaction system, resulting in a decrease in glucose content.

[0073] Example 7: Comparison of oligosaccharide debranching enzyme mutants in treating glucose secondary mother liquors at different pH values

[0074] According to the method involved in Example 3, a glucose secondary mother liquor reaction system was constructed, and the pH values ​​of the reaction system were 5.0, 5.5, 6.0, 6.5 and 7.0, respectively. Other reaction conditions, reaction processes and detection methods were the same as in Example 3. The glucose content results obtained at different reaction pH in this example are shown in Table 6.

[0075] Table 6 Effect of oligosaccharide debranching enzyme mutants on glucose content at different reaction pH

[0076] Different reaction pH Glucose content (%) 5.0 92.82 5.5 97.54 6.0 99.24 6.5 98.64 7.0 94.56

[0077] As shown in Table 6, when the reaction pH is 5.0 and 7.0, the glucose content is low, only 92.82%. This may be because when the reaction pH is not the optimal pH of the oligosaccharide debranching enzyme mutant, the activity of the oligosaccharide debranching enzyme mutant is inhibited, and the hydrolysis ability is reduced, resulting in the inability to completely hydrolyze other small molecular sugars except glucose. When the reaction pH is 5.5 and 6.5, the glucose content increases, and when the reaction pH is 6, the glucose content reaches a maximum of 99.24%.

[0078] Example 8: Re-crystallization of glucose monohydrate from glucose secondary mother liquor treated with oligosaccharide debranching enzyme mutants

[0079] Prepare a glucose secondary mother liquor with a substrate concentration of 40% (dry basis, w / w), adjust the pH value to 6.0, keep it in a 50°C water bath for 15 minutes, add 30U / g (substrate dry basis) of the oligosaccharide debranching enzyme mutant prepared in Example 1, start the reaction timing, react for 24 hours under a stirring rate of 200r / min, and then inactivate the enzyme in a boiling water bath for 30 minutes to terminate the reaction. Desalting and decolorizing, filtering, concentrating, crystallizing and drying the glucose secondary mother liquor before and after the reaction are respectively carried out to obtain a crystalline glucose product. After obtaining the glucose secondary mother liquor after the enzyme reaction, the glucose content, purity, moisture and conductivity are detected. The crystallization step includes: treating the glucose secondary mother liquor with the oligosaccharide debranching enzyme mutant, ion exchange desalting and decolorizing, activated carbon decolorizing, suction filtration, evaporation concentration, cooling crystallization, and drying to obtain glucose crystals.

[0080] (1) Two resins are used for desalination: D001 and D354 resins are respectively filled into two ion exchange columns, with a resin filling amount of 70%, and the two resins are activated by acid and alkali, respectively, and finally washed with pure water until neutral for use. The glucose secondary mother liquor reaction solution is centrifuged and filtered, and passed through a cation exchange resin and an anion exchange resin at room temperature.

[0081] (2) The decolorization step is carried out using activated carbon: first, 2% (w / w) granular activated carbon (20-100 mesh) is added to the glucose secondary mother liquor after the reaction, and decolorized at pH 6.0 and temperature 70°C for 2 h. After centrifugal filtration, the absorbance value of the sugar solution is measured.

[0082] (3) The filtration step is carried out by suction filtration: the glucose secondary mother liquor after decolorization by activated carbon is suction filtered, and a 0.22 μm water system membrane is used for suction filtration to remove the activated carbon.

[0083] (4) The concentration step is carried out using a rotary evaporator: the decolorized reaction solution is transferred to a rotary evaporator and evaporated and concentrated under the conditions of 80°C, 25 r / min, and a vacuum degree of 0.1 MPa.

[0084] (5) The crystallization step is carried out by cooling crystallization: the crystallization temperature is 25° C., the crystallization time is 12 hours; and drying is performed after crystallization.

[0085] (6) The drying step is carried out by vacuum drying: the drying temperature is 65° C., the drying time is 4 hours, and the crystal yield of the obtained glucose product is calculated.

[0086] Table 7 Crystallization properties of glucose secondary mother liquor before and after treatment with oligosaccharide debranching enzyme mutants

[0087]

[0088] After the desalting and decolorizing steps, the conductivity of the glucose secondary mother liquor reaction solution was greatly reduced from 145μS / cm to 8μS / cm, indicating that most of the impurities in the reaction solution have been removed. The decolorization rate and crystallization rate of the glucose secondary mother liquor after the enzyme reaction were improved. This is because the content of other small molecular sugars in the glucose secondary mother liquor system after the enzyme reaction decreased, the glucose content increased, and the crystallization rate of the reaction solution was also improved.

[0089] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A method for preparing glucose crystals using glucose secondary mother liquor, characterized in that: An oligosaccharide debranching enzyme mutant is used to treat glucose secondary mother liquor, wherein the glucose secondary mother liquor is the residual liquid after secondary extraction of glucose crystals. The oligosaccharide debranching enzyme mutant is obtained by mutating the 219th valine of the amino acid sequence shown in SEQ ID NO.1 to alanine and is heterologously expressed by Bacillus subtilis.

2. The method according to claim 1, characterized in that: The Bacillus subtilis uses pP43NMK as an expression vector.

3. The method according to claim 1, characterized in that: The Bacillus subtilis is Bacillus subtilis WB600.

4. The method according to claim 1, characterized in that: The treatment time is 0-48 hours.

5. The method according to claim 1, characterized in that: The pH value of the glucose secondary mother liquor is 5-7.

6. The method according to claim 1, characterized in that: The mass concentration of the substrate in the glucose secondary mother liquor is 10-50%.

7. The method according to claim 1, characterized in that: The added amount of the oligosaccharide debranching enzyme mutant is 0-50 U / g.

8. A recombinant Bacillus subtilis, characterized in that: The recombinant Bacillus subtilis uses Bacillus subtilis WB600 as an expression host and pP43NMK as an expression vector to heterologously express an oligosaccharide debranching enzyme mutant, wherein the oligosaccharide debranching enzyme mutant is obtained by mutating the valine at position 219 of the amino acid sequence shown in SEQ ID NO.1 to alanine.

9. A microbial agent comprising the recombinant Bacillus subtilis according to claim 8.

10. Use of the recombinant Bacillus subtilis according to claim 8 or the microbial agent according to claim 9 in preparing glucose crystals using glucose secondary mother liquor.

Images