Erasable and reusable single nucleotide polymorphism gene chip and detection method

Abstract

The invention belongs to the technical field of biological chips, and particularly relates to an erasable and reusable single nucleotide polymorphism gene chip and a detection method, a solid-phase chip substrate loaded with a capture probe, and a closed probe, a primer probe and a fluorescent developing probe which are matched for use, according to the erasable and reusable single nucleotide polymorphism gene chip and the detection method provided by the invention, the gene chip detection technology overcomes the problem that the application cost is high due to the fact that a solid-phase SNP gene detection chip can only be used for one time for a long time, and erasable reuse of the SNP gene detection chip is realized; and the application cost of the solid-phase gene chip for large-scale sample genotyping can be greatly reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of biochips, in particular to an erasable and multiplexed single nucleotide polymorphism gene chip and a detection method. Background Art

[0002] Biochip technology is a biological high-tech technology developed in the 1980s. It uses glass, silicon wafers, nylon membranes or other polymer materials as carriers, integrates and arranges a large number of biological materials per unit area, and achieves the purpose of high-throughput simultaneous detection of multiple diseases or analysis of multiple biological samples through molecular hybridization or antigen-antibody reaction. Biochips can be divided into gene chips, protein chips and tissue chips according to the type of biological information stored. Among them, gene chips mostly use microbeads as supports, fix many specific oligonucleotide sequences or gene fragments on the supports as probes, and then hybridize with the genes of the objects to be tested according to the principle of base complementary pairing, and use imaging equipment to detect and compare the fluorescent signals on the probes, converting the acquisition of optical signals into the acquisition of biological information. Gene chips play an important role in gene expression detection, mutation detection, and genomic polymorphism analysis.

[0003] Single nucleotide polymorphism (SNP) refers to the polymorphism of DNA sequence caused by the variation of single nucleotide at the genome level. It is an important basis for studying genetic variation of humans, animals and plants. SNP is characterized by large number and wide distribution, while gene chips have the characteristics of large detection throughput and convenient detection, which makes the use of gene chips to detect SNP have broad application prospects. The existing solid-phase SNP gene detection chip uses single base extension technology to identify mutation sites, which has the disadvantage of only being disposable, resulting in high chip detection costs and difficulty in large-scale application.

[0004] Therefore, an erasable and multiplexable single nucleotide polymorphism gene chip and a detection method are proposed to solve the above-mentioned problems. Summary of the invention

[0005] The purpose of the present invention is to provide an erasable and multiplexable single nucleotide polymorphism gene chip and a detection method to solve the problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions: an erasable and multiplexed single nucleotide polymorphism gene chip, a solid-phase chip substrate loaded with capture probes, and matching blocking probes, primer probes and fluorescent colorimetric probes.

[0007] Preferably, the solid phase chip substrate is a solid phase support carrying capture probes, including a nucleic acid microbead array chip prepared by photolithography combined with physical assembly or a microwell plate connected with capture probes.

[0008] Preferably, the primer probes include primer probe A, primer probe B and primer probe C, the primer probe A sequence length is 12-50 bases, and is continuously complementary to the target sequence from the 3' end to the 5' end to the previous base of the mutation site; the primer probes B and C include a chain hybridization trigger sequence of 16-30 bases and a target sequence complementary sequence of 12-50 bases from the 5' end to the 3' end, and the target sequence complementary sequences of the primer probes B and primer probes C are respectively continuously complementary to the wild type and mutant types of the target sequence from the 5' end to the 3' end to the base of the mutation site.

[0009] Preferably, the capture probe comprises, from the 5' end to the 3' end, a transition sequence of 0-15 bases, a primer probe A capture sequence of 10-20 bases, and a primer probe B capture sequence of 12-30 bases, wherein the primer probe A capture sequence is complementary to the primer probe A sequence, and the primer probe B capture sequence is complementary to the target sequence complementary sequence of primer probe B.

[0010] Preferably, the blocking probe is continuously complementary to the capture probe from the 5' end to the 3' end to a portion or all of the capture sequence of the primer probe A.

[0011] Preferably, the fluorescent colorimetric probes include colorimetric probe A, colorimetric probe B, colorimetric probe C and colorimetric probe D, wherein the 5' ends of colorimetric probe A and colorimetric probe B are modified with the same fluorescent colorimetric group, and the 5' ends of colorimetric probe C and colorimetric probe D are modified with the same fluorescent colorimetric group, and the sequence lengths are both 20-60 bases; all colorimetric probes can self-fold to form hairpin structures, wherein the chain hybridization triggering sequence of primer probe B can trigger the alternating opening and self-assembly of the hairpins of colorimetric probe A and colorimetric probe B, and the chain hybridization triggering sequence of primer probe C can trigger the alternating opening and self-assembly of the hairpins of colorimetric probe C and colorimetric probe D.

[0012] A detection method of the erasable and multiplexed single nucleotide polymorphism gene chip, the specific steps of the detection method are as follows:

[0013] Step 1: The sample solution after nucleic acid extraction is first incubated with the primer probe for preliminary polymorphic site recognition and chain signal conversion;

[0014] Step 2: the mixed solution after incubation is dripped onto the chip substrate loaded with capture probes and blocking probes to perform a strand displacement reaction;

[0015] Step 3: After the strand displacement, the chip substrate is lightly cleaned with a neutral salt solution, and then a fluorescent colorimetric probe solution is added dropwise for co-incubation to perform a colorimetric reaction;

[0016] Step 4: After color development, the chip substrate is lightly cleaned with a neutral salt solution and then placed under a fluorescence microscope to take a picture and record. Single nucleotide polymorphism genotyping detection can be achieved based on the color of the fluorescence image;

[0017] Step 5: After use, the chip is incubated and cleaned with alkaline solution to erase the colorimetric probe; the erased chip is incubated again with the blocking probe and can be used again according to the standard detection process.

[0018] Preferably, the concentration of the primer probe is 0.05-1 μM, and 1-5 U of Ampligase enzyme needs to be added to the co-incubation of the sample solution and the primer probe. The Ampligase enzyme is a thermostable DNA ligase, and a PCR instrument or a temperature control device such as an oscillating metal bath is used to perform a cycle reaction 10-60 times, at 90-95°C for 30-120s, 2-5°C for 30-120s, and 60-65°C for 1-5min.

[0019] Preferably, the temperature of the strand displacement reaction is 20-40°C, and the time of the strand displacement reaction is 10-90 min; the pH of the neutral salt solution is 6.5-7.5, and the fluorescent colorimetric probes are annealed before use to prepare a mixed solution with a concentration of 0.5-2 μM, and the annealing procedure is: heating at 90-95°C for 5-10 min, and naturally cooling to room temperature.

[0020] Preferably, the color development reaction time is 10-90 min, and the temperature is 20-40°C; the pH of the alkaline solution is 12-13, the incubation and washing time of the alkaline solution is 10-30 min, and the number of incubation and washing times is 1-3 times; the concentration of the blocking probe is 0.5-2 μM, the incubation temperature is 20-40°C, and the incubation time is 10-90 min.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides an erasable and multiplexed single nucleotide polymorphism gene chip and a detection method. The gene chip detection technology overcomes the long-standing problem that solid-phase SNP gene detection chips can only be used once, resulting in high application costs, and realizes the erasable multiplexing of SNP gene detection chips, which can greatly reduce the application cost of solid-phase gene chips for large-scale sample genotyping. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a flow chart of the detection method of the present invention;

[0024] Figure 2 This is a diagram showing the analysis of the chip for SNP1 genotyping detection;

[0025] Figure 3This is a diagram showing the analysis of the chip for SNP2 genotyping detection;

[0026] Figure 4 This is a diagram showing the analysis of the chip for SNP3 genotyping detection;

[0027] Figure 5 This is a diagram showing the chip used for SNP4 genotyping analysis;

[0028] Figure 6 This is a diagram showing the analysis of the chip for SNP5 genotyping detection;

[0029] Figure 7 This is a diagram showing the effect of alkaline washing and erasing of the microbead solid phase chip substrate in mutant target sequence testing;

[0030] Figure 8 This is a diagram showing the effect of alkaline washing and erasing of the microbead solid phase chip substrate in the wild-type target sequence test. DETAILED DESCRIPTION

[0031] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] In the description of the present invention, it is necessary to understand that the terms "upper", "lower", "front", "back", "left", "right", "top", "bottom", "inside", "outside", etc., indicating the orientation or position relationship are based on the orientation or position relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention.

[0033] See also Figure 1-8 , the present invention provides a technical solution:

[0034] The invention discloses an erasable and multiplexed single nucleotide polymorphism gene chip, which comprises a solid-phase chip substrate loaded with a capture probe and a matching blocking probe, a primer probe and a fluorescent color developing probe.

[0035] The solid phase chip substrate is a solid phase support carrying capture probes, including a nucleic acid microbead array chip prepared by photoetching technology combined with physical assembly or a microwell plate connected with capture probes.

[0036] The primer probes include primer probe A, primer probe B and primer probe C. The primer probe A has a sequence length of 12-50 bases and is continuously complementary to the target sequence from the 3' end to the 5' end to the previous base of the mutation site; the primer probes B and C include a chain hybridization trigger sequence of 16-30 bases and a target sequence complementary sequence of 12-50 bases from the 5' end to the 3' end, and the target sequence complementary sequences of the primer probes B and C are respectively continuously complementary to the wild type and mutant type of the target sequence from the 5' end to the 3' end to the mutation site base.

[0037] The capture probe includes a transition sequence of 0-15 bases, a primer probe A capture sequence of 10-20 bases, and a primer probe B capture sequence of 12-30 bases from the 5' end to the 3' end. The primer probe A capture sequence is complementary to the primer probe A sequence, and the primer probe B capture sequence is complementary to the target sequence complementary sequence of primer probe B.

[0038] The blocking probe is continuously complementary to the capture probe from the 5' end to the 3' end to a portion or all of the capture sequence of the primer probe A.

[0039] The fluorescent colorimetric probes include colorimetric probe A, colorimetric probe B, colorimetric probe C and colorimetric probe D, wherein the 5' ends of colorimetric probe A and colorimetric probe B are modified with the same fluorescent colorimetric group, and the 5' ends of colorimetric probe C and colorimetric probe D are modified with the same fluorescent colorimetric group, and the sequence lengths are all 20-60 bases; all colorimetric probes can self-fold to form hairpin structures, wherein the chain hybridization triggering sequence of primer probe B can trigger the alternating open-loop self-assembly of the hairpins of colorimetric probe A and colorimetric probe B, and the chain hybridization triggering sequence of primer probe C can trigger the alternating open-loop self-assembly of the hairpins of colorimetric probe C and colorimetric probe D.

[0040] A detection method for erasable and multiplexed single nucleotide polymorphism gene chip, the specific steps of the detection method are as follows:

[0041] Step 1: The sample solution after nucleic acid extraction is first incubated with the primer probe for preliminary polymorphic site recognition and chain signal conversion;

[0042] Step 2: the mixed solution after incubation is dripped onto the chip substrate loaded with capture probes and blocking probes to perform a strand displacement reaction;

[0043] Step 3: After the strand displacement, the chip substrate is lightly cleaned with a neutral salt solution, and then a fluorescent colorimetric probe solution is added dropwise for co-incubation to perform a colorimetric reaction;

[0044] Step 4: After color development, the chip substrate is lightly cleaned with a neutral salt solution and then placed under a fluorescence microscope to take a picture and record. Single nucleotide polymorphism genotyping detection can be achieved based on the color of the fluorescence image;

[0045] Step 5: After use, the chip is incubated and cleaned with alkaline solution to erase the colorimetric probe; the erased chip is incubated again with the blocking probe and can be used again according to the standard detection process.

[0046] The concentration of the primer probe is 0.05-1 μM. 1-5 U of Ampligase enzyme needs to be added to the co-incubation of the sample solution and the primer probe. The Ampligase enzyme is a heat-stable DNA ligase. A PCR instrument or a temperature control device such as an oscillating metal bath is used to perform a cycle reaction 10-60 times, at 90-95° C. for 30-120 s, 2-5° C. for 30-120 s, and 60-65° C. for 1-5 min.

[0047] The temperature of the chain displacement reaction is 20-40°C, and the time of the chain displacement reaction is 10-90 minutes; the pH of the neutral salt solution is 6.5-7.5, and the fluorescent colorimetric probes are annealed before use to prepare a mixed solution with a concentration of 0.5-2 μM, and the annealing procedure is: heating at 90-95°C for 5-10 minutes and naturally cooling to room temperature.

[0048] The color development reaction time is 10-90 minutes, and the temperature is 20-40°C; the pH of the alkaline solution is 12-13, the incubation and cleaning time of the alkaline solution is 10-30 minutes, and the number of incubation and cleaning times is 1-3 times; the concentration of the blocking probe is 0.5-2 μM, the incubation temperature is 20-40°C, and the incubation time is 10-90 minutes.

[0049] Experimental Example 1 SNP1 Detection

[0050] Target sequence mutation: TTTCTATTCCTCACTCGGATTCAGAAAACAACAAT

[0051] CCATGTGACAGTAATATTATTAACG

[0052] Target sequence wild type: TTTCTATTCCTCACTCGGATTCAGAAAACCACAAT

[0053] CCATGTGACAGTAATATTATTAACG

[0054] Primer probe A: 5'P-GTTTTCTGAATCCGA

[0055] Primer probe B: GCACTATCCTACGTTGCAGGTCACATGGATTGTT

[0056] Primer probe C: GCTAGACAAGTCTGCAATCGTCACATGGATTGTG

[0057] Capture probe: NH2-TTTTTTTCGGATTCAGAAAACAACAATCCATGTGAC

[0058] Blocking probe: GTCACATGGATTGTTGTTTTC

[0059] Chromogenic probe A: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0060] CTAC

[0061] Chromogenic probe B: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0062] CTAC

[0063] Chromogenic probe C: ROX-GATTGCAGACTTGTCTAGCTTTCTACGCTAGACA

[0064] AGTC

[0065] Chromogenic probe D: ROX-AGACAAGTCGTGGCAGTTTCACGACTTGTCTAGC

[0066] GTAG

[0067] Preparation of microbead solid phase chip substrate

[0068] 1) Polystyrene microsphere activation step: The pre-prepared morpholineethanesulfonic acid buffer (MES) with a pH of 6 is mixed with carboxyl polystyrene microspheres to prepare a 5 mg / mL suspension; then 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) solution and N-hydroxysuccinimide (NHS) solution prepared using MES are added, and when the concentration of EDC and NHS in the suspension system reaches 25 mg / mL, the suspension is shaken for 1 hour.

[0069] 2) Step of covalently binding capture probe to polystyrene microspheres: 10 nmol of capture probe dry powder to be connected was dissolved in MES buffer, mixed with activated polystyrene microsphere suspension, wherein the polystyrene microsphere content was 5 mg, and reacted at room temperature for 4 hours by shaking, and then washed three times by centrifugation (5000 rpm, 5 min) with PBST buffer (8 mM Na2HPO4, 2 mM KH2PO4, 10 mM KCl, 140 mM NaCl, 0.05% (V / V) Tween-20, pH 7.2-7.4), and then resuspended in ultrapure water to obtain a microbead solution in which polystyrene microspheres were covalently bound to capture probes.

[0070] 3) A groove array region is formed on a first surface of a silicon substrate (10 mm×10 mm×1 mm) by photolithography.

[0071] 4) The above-mentioned polystyrene microbeads covalently bound to oligonucleotide chains are injected into ultrapure water, and a monodisperse microbead solution with a concentration of 1 mg / mL is prepared by ultrasonic dispersion; the etched silicon substrate is placed in the mounting groove (10 mm×10 mm×2 mm) in the assembly mold (75 mm×25 mm×3 mm), 150 μL of the monodisperse microbead solution is evenly dripped on the first surface of the silicon substrate, and a glass slide is covered on the assembly mold. After ensuring that there is no air in the liquid under the glass slide, it is sealed with a sealing film, and the front side is placed in an ultrasonic cleaner, and 120W ultrasonic assembly is used for 10 minutes. The surface of the silicon substrate is cleaned twice with deionized water to complete the assembly of the microbeads, and a microbead solid phase chip substrate is prepared.

[0072] 5) Add 1 μM blocking probe solution prepared in 1×PBST (8 mM Na2HPO4, 2 mM KH2PO4, 10 mM KCl, 140 mM NaCl, 0.05% (V / V) Tween-20, pH 7.2-7.4) onto the microbead solid phase chip substrate, incubate at room temperature for 30 min, and gently wash 3 times with 1×PBST buffer for later use.

[0073] Target sequence comparison test

[0074] 1) Use Ampligase Reaction Buffer (20mM Tris-HCl (pH 8.3), 25mM KCl, 10mMgCl2, 0.5mM NAD, and 0.01% X-100) was prepared with 100 μL reaction solution: 10 nM target sequence, 0.1 μM primer probe A, 0.1 μM primer probe B, 0.1 μM primer probe C, 1 U Ampligase enzyme (Lucigen, USA), and the PCR instrument was used for 30 cycles: 95°C for 30 s, 4°C for 30 s, and 60°C for 1 min.

[0075] 2) The mixed solution after the reaction was dripped onto the assembled chip substrate loaded with capture probes and blocking probes and incubated at 40° C. for 30 min, and then gently washed three times with 1×PBST buffer solution.

[0076] 3) 1×PBST was used to prepare chromogenic probe A, chromogenic probe B, chromogenic probe C and chromogenic probe D solutions, each with a concentration of 2 μM, and heated at 95°C for 5 min, and then cooled naturally to room temperature. Then, a mixed solution of the four probes with a concentration of 0.5 μM was prepared for use.

[0077] 4) Add freshly prepared fluorescent colorimetric probe mixed solution onto the cleaned chip substrate, react at 40°C for 30 min, gently wash three times with 1×PBST buffer solution, and then place under a fluorescence microscope to record the fluorescence microscopic images of FAM and ROX.

[0078] like Figure 2 As shown, the beads on the mutant target chip showed obvious FAM green fluorescence, and the beads in the ROX yellow fluorescence channel did not emit light; the beads on the wild-type target chip showed obvious ROX yellow fluorescence, and the beads in the FAM green fluorescence channel did not emit light; the beads on the heterozygous (mutant + wild) target chip emitted light in both the FAM green fluorescence channel and the ROX yellow fluorescence channel; the experimental results were the same as expected, indicating that this chip can be used for SNP1 genotyping detection and analysis;

[0079] Experimental Example 2 SNP2 Detection

[0080] Target sequence mutation: GCAGCAGCAGCAAGCTATGGCGGAAGAACCGAAAG

[0081] TTCCACCACCTTCCAATCCTACGTT

[0082] Target sequence wild type: GCAGCAGCAGCAAGCTATGGCGGAAGAACAGAAAG

[0083] TTCCACCACCTTCCAATCCTACGTT

[0084] Primer probe A: 5' P-GTTCTTCCGCCATAG

[0085] Primer probe B: GCACTATCCTACGTTGCAGGTGGTGGAACTTTCG

[0086] Primer probe C: GCTAGACAAGTCTGCAATCGTGGTGGAACTTTCT

[0087] Capture probe: NH2-TTTTTTCTATGGCGGAAGAACCGAAAGTTCCACCAC

[0088] Blocking probe: GTGGTGGAACTTTCGGTTCTT

[0089] Chromogenic probe A: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0090] CTAC

[0091] Chromogenic probe B: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0092] CTAC

[0093] Chromogenic probe C: ROX-GATTGCAGACTTGTCTAGCTTTCTACGCTAGACA

[0094] AGTC

[0095] Chromogenic probe D: ROX-AGACAAGTCGTGGCAGTTTCACGACTTGTCTAGC

[0096] GTAG

[0097] Preparation of microbead solid phase chip substrate

[0098] Same as Example 1.

[0099] Target sequence comparison test

[0100] The difference from Example 1 is:

[0101] 1) The concentration of primer probes A, B, and C was 0.5 μM, 2 U of Ampligase enzyme (Lucigen, USA), and the PCR instrument was used for 40 cycles: 95°C for 30 s, 4°C for 30 s, and 60°C for 1 min.

[0102] 2) The mixed solution after the reaction was incubated on the chip substrate at 25° C. for 20 min.

[0103] 3) The concentration of the four probe mixed solutions is 1 μM.

[0104] 4) The fluorescent colorimetric probe was reacted on the chip substrate at 25°C for 25 minutes.

[0105] like Figure 3 As shown, the microbeads on the mutant target chip showed obvious FAM green fluorescence, and the microbeads in the ROX yellow fluorescence channel did not emit light; the microbeads on the wild-type target chip showed obvious ROX yellow fluorescence, and the microbeads in the FAM green fluorescence channel did not emit light; the microbeads on the heterozygous (mutant + wild) target chip emitted light in both the FAM green fluorescence channel and the ROX yellow fluorescence channel; the experimental results were consistent with the expected results, indicating that this chip can be used for SNP2 genotyping detection and analysis.

[0106] Experimental Example 3 SNP3 Detection

[0107] Target sequence mutation: TTAACTAATTTGTGGTGCACGCAGGTTTCGTTTGA

[0108] TTTGCTTGAAAAGTACTTGGAAGAG

[0109] Target sequence wild type: TTAACTAATTTGTGGTGCACGCAGGTTTCATTTGAT

[0110] TTGCTTGAAAAGTACTTGGAAGAG

[0111] Primer probe A: 5' P-GAAACCTGCGTGCAC

[0112] Primer probe B: GCACTATCCTACGTTGCAGTCAAGCAAATCAAAC

[0113] Primer probe C: GCTAGACAAGTCTGCAATCTCAAGCAAATCAAAT

[0114] Capture probe: NH2-TTTGTGCACGCAGGTTTCGTTTGATTTGCTTGA

[0115] Blocking probe: TCAAGCAAATCAAACGAAACC

[0116] Chromogenic probe A: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0117] CTAC

[0118] Chromogenic probe B: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0119] CTAC

[0120] Chromogenic probe C: ROX-GATTGCAGACTTGTCTAGCTTTCTACGCTAGACA

[0121] AGTC

[0122] Chromogenic probe D: ROX-AGACAAGTCGTGGCAGTTTCACGACTTGTCTAGC

[0123] GTAG

[0124] Preparation of microbead solid phase chip substrate

[0125] Same as Example 1.

[0126] Target sequence comparison test

[0127] The difference from Example 1 is:

[0128] 1) The concentration of primer probes A, B, and C was 0.8 μM, 2 U of Ampligase enzyme (Lucigen, USA), and the PCR instrument was used for 50 cycles: 95°C for 30 s, 4°C for 30 s, and 60°C for 2 min.

[0129] 2) The mixed solution after the reaction was incubated on the chip substrate at 25°C for 20 minutes

[0130] 3) The concentration of the four probe mixed solutions is 2 μM.

[0131] 4) The fluorescent colorimetric probe was reacted on the chip substrate at 25°C for 10 min.

[0132] like Figure 4 As shown, the microbeads on the mutant target chip showed obvious FAM green fluorescence, and the microbeads in the ROX yellow fluorescence channel did not emit light; the microbeads on the wild-type target chip showed obvious ROX yellow fluorescence, and the microbeads in the FAM green fluorescence channel did not emit light; the microbeads on the heterozygous (mutant + wild) target chip emitted light in both the FAM green fluorescence channel and the ROX yellow fluorescence channel; the experimental results were consistent with the expected results, indicating that this chip can be used for SNP3 genotyping detection and analysis.

[0133] Experimental Example 4 SNP4 Detection

[0134] Target sequence mutation: CCAGTTGTAGCAGGCATAGATCTCAACCATGCAAAT

[0135] CTGAAAGGAACCCTTGTGAAGGAG

[0136] Target sequence wild type: CCAGTTGTAGCAGGCATAGATCTCAACCACGCAAAT

[0137] CTGAAAGGAACCCTTGTGAAGGAG

[0138] Primer probe A: 5' P-TGGTTGAGATCTATG

[0139] Primer probe B: GCACTATCCTACGTTGCAGCCTTTCAGATTTGCA

[0140] Primer probe C: GCTAGACAAGTCTGCAATCCCTTTCAGATTTGCG

[0141] Capture probe: NH2-TTTTTTCATAGATCTCAACCATGCAAATCTGAAAGG

[0142] Blocking probe: CCTTTCAGATTTGCATGGTTG

[0143] Chromogenic probe A: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0144] CTAC

[0145] Chromogenic probe B: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0146] CTAC

[0147] Chromogenic probe C: ROX-GATTGCAGACTTGTCTAGCTTTCTACGCTAGACA

[0148] AGTC

[0149] Chromogenic probe D: ROX-AGACAAGTCGTGGCAGTTTCACGACTTGTCTAGC

[0150] GTAG

[0151] Preparation of microbead solid phase chip substrate

[0152] Same as Example 1.

[0153] Target sequence comparison test

[0154] The difference from Example 1 is:

[0155] 1) The concentration of primer probes A, B, and C was 0.05 μM, 1 U of Ampligase enzyme (Lucigen, USA), and the PCR instrument was used for 60 cycles: 95°C for 30 s, 4°C for 30 s, and 60°C for 1 min.

[0156] 2) The mixed solution after the reaction was incubated on the chip substrate at 40°C for 60 minutes

[0157] 3) The concentration of the four probe mixed solutions is 2 μM.

[0158] 4) The fluorescent colorimetric probe was reacted on the chip substrate at 40°C for 60 minutes.

[0159] like Figure 5 As shown, the microbeads on the mutant target chip showed obvious FAM green fluorescence, and the microbeads in the ROX yellow fluorescence channel did not emit light; the microbeads on the wild-type target chip showed obvious ROX yellow fluorescence, and the microbeads in the FAM green fluorescence channel did not emit light; the microbeads on the heterozygous (mutant + wild) target chip emitted light in both the FAM green fluorescence channel and the ROX yellow fluorescence channel; the experimental results were consistent with the expected results, indicating that this chip can be used for SNP4 genotyping detection and analysis.

[0160] Experimental Example 5 SNP3 Detection

[0161] Target sequence mutation: TTTCTATTCCTCACTCGGATTCAGAAAACAACAAT

[0162] CCATGTGACAGTAATATTATTAACG

[0163] Target sequence wild type: TTTCTATTCCTCACTCGGATTCAGAAAACCACAAT

[0164] CCATGTGACAGTAATATTATTAACG

[0165] Primer probe A: 5'P-GTTTTCTGAATCCGA

[0166] Primer probe B: GCACTATCCTACGTTGCAGGTCACATGGATTGTT

[0167] Primer probe C: GCTAGACAAGTCTGCAATCGTCACATGGATTGTG

[0168] Capture probe: NH2-TTTTTTTCGGATTCAGAAAACAACAATCCATGTGAC

[0169] Blocking probe: GTCACATGGATTGTTGTTTTC

[0170] Chromogenic probe A: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0171] CTAC

[0172] Chromogenic probe B: FAM-CTGCAACGTAGGATAGTGCTTTCTACGCACTATC

[0173] CTAC

[0174] Chromogenic probe C: ROX-GATTGCAGACTTGTCTAGCTTTCTACGCTAGACA

[0175] AGTC

[0176] Chromogenic probe D: ROX-AGACAAGTCGTGGCAGTTTCACGACTTGTCTAGC

[0177] GTAG

[0178] Preparation of microbead solid phase chip substrate

[0179] Same as Example 1.

[0180] Target sequence comparison test

[0181] The difference from Example 1 is:

[0182] 1) The concentration of primer probes A, B, and C was 1 μM, 2 U of Ampligase enzyme (Lucigen, USA), and the PCR instrument was used for 20 cycles: 95°C for 30 s, 4°C for 30 s, and 60°C for 1 min.

[0183] 2) The mixed solution after the reaction was incubated on the chip substrate at 40°C for 20 minutes

[0184] 3) The concentration of the four probe mixed solutions is 1.5 μM.

[0185] 4) The fluorescent colorimetric probe was reacted on the chip substrate at 25°C for 30 minutes.

[0186] like Figure 6As shown, the microbeads on the mutant target chip showed obvious FAM green fluorescence, and the microbeads in the ROX yellow fluorescence channel did not emit light; the microbeads on the wild-type target chip showed obvious ROX yellow fluorescence, and the microbeads in the FAM green fluorescence channel did not emit light; the microbeads on the heterozygous (mutant + wild) target chip emitted light in both the FAM green fluorescence channel and the ROX yellow fluorescence channel; the experimental results were consistent with the expected results, indicating that this chip can be used for SNP5 genotyping detection and analysis.

[0187] Experimental Example 6 Chip Erasing and Reuse Test 1

[0188] Target sequence mutant, primer probe A, primer probe B, primer probe C, capture probe, blocking probe, colorimetric probe A, colorimetric probe B, colorimetric probe C, colorimetric probe D are the same

[0189] Same as Example 1

[0190] Preparation of microbead solid phase chip substrate

[0191] Same as Example 1.

[0192] Mutant target sequence testing

[0193] Same as Example 1.

[0194] Alkaline cleaning and erasing of microbead solid phase chip substrate

[0195] 1) After use, the chip was washed by adding alkaline solution with pH 12 for 3 times at room temperature, each time for 10 min, and then washed with 1× PBST until neutral.

[0196] 2) Add 1 μM blocking probe solution prepared with 1×PBST onto the microbead solid phase chip substrate, incubate at room temperature for 30 min, and gently wash 3 times with 1×PBST buffer for later use.

[0197] The above target sequence test and microbead solid phase chip substrate alkaline washing and erasing steps were repeated 10 times.

[0198] like Figure 7 As shown in the figure, after each use, the gene chip can be effectively erased by washing with alkaline solution, the color developing probe is removed, and the fluorescence disappears. It can function normally when used again, and the mutant target sequence can be accurately identified, and the repeated use performance is good.

[0199] Experimental Example 7 Chip Erasure and Reuse Test 2

[0200] Target sequence wild type, primer probe A, primer probe B, primer probe C, capture probe, blocking probe, colorimetric probe A, colorimetric probe B, colorimetric probe C, colorimetric probe D are the same

[0201] Same as Example 1

[0202] Preparation of microbead solid phase chip substrate

[0203] Same as Example 1.

[0204] Wild-type target sequence testing

[0205] Same as Example 1.

[0206] Alkaline cleaning and erasing of microbead solid phase chip substrate

[0207] 1) After use, the chip was washed by adding alkaline solution with pH 12 for 3 times at room temperature, each time for 10 min, and then washed with 1× PBST until neutral.

[0208] 2) Add 1 μM blocking probe solution prepared with 1×PBST onto the microbead solid phase chip substrate, incubate at room temperature for 30 min, and gently wash 3 times with 1×PBST buffer for later use.

[0209] The above target sequence test and microbead solid phase chip substrate alkaline washing and erasing steps were repeated 10 times.

[0210] like Figure 8 As shown, after each use, the gene chip can be effectively erased by washing with alkaline solution, the color developing probe is removed, and the fluorescence disappears. It can function normally when used again, and the wild-type target sequence can be accurately identified, and the reusability performance is good.

[0211] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention; therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is limited by the attached claims rather than the above description. Therefore, it is intended to include all changes within the meaning and scope of the equivalent elements of the claims in the present invention, and any figure marks in the claims should not be regarded as limiting the claims involved.

[0212] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. An erasable and multiplexable single nucleotide polymorphism gene chip, characterized in that: A solid phase chip substrate loaded with capture probes and matching blocking probes, primer probes and fluorescent color development probes.

2. The erasable and multiplexable single nucleotide polymorphism gene chip according to claim 1, characterized in that: The solid phase chip substrate is a solid phase support carrying capture probes, including a nucleic acid microbead array chip prepared by photoetching technology combined with physical assembly or a microwell plate connected with capture probes.

3. The erasable and multiplexable single nucleotide polymorphism gene chip according to claim 1, characterized in that: The primer probes include primer probe A, primer probe B and primer probe C. The primer probe A has a sequence length of 12-50 bases and is continuously complementary to the target sequence from the 3' end to the 5' end to the previous base of the mutation site; the primer probes B and C include a chain hybridization trigger sequence of 16-30 bases and a target sequence complementary sequence of 12-50 bases from the 5' end to the 3' end, and the target sequence complementary sequences of the primer probes B and C are respectively continuously complementary to the wild type and mutant type of the target sequence from the 5' end to the 3' end to the mutation site base.

4. The erasable and multiplexable single nucleotide polymorphism gene chip according to claim 1, characterized in that: The capture probe includes a transition sequence of 0-15 bases, a primer probe A capture sequence of 10-20 bases, and a primer probe B capture sequence of 12-30 bases from the 5' end to the 3' end. The primer probe A capture sequence is complementary to the primer probe A sequence, and the primer probe B capture sequence is complementary to the target sequence complementary sequence of primer probe B.

5. The erasable and multiplexable single nucleotide polymorphism gene chip according to claim 1, characterized in that: The blocking probe is continuously complementary to the capture probe from the 5' end to the 3' end to a portion or all of the capture sequence of the primer probe A.

6. The erasable and multiplexable single nucleotide polymorphism gene chip according to claim 1, characterized in that: The fluorescent colorimetric probes include colorimetric probe A, colorimetric probe B, colorimetric probe C and colorimetric probe D, wherein the 5' ends of colorimetric probe A and colorimetric probe B are modified with the same fluorescent colorimetric group, and the 5' ends of colorimetric probe C and colorimetric probe D are modified with the same fluorescent colorimetric group, and the sequence lengths are all 20-60 bases; all colorimetric probes can self-fold to form hairpin structures, wherein the chain hybridization triggering sequence of primer probe B can trigger the alternating open-loop self-assembly of the hairpins of colorimetric probe A and colorimetric probe B, and the chain hybridization triggering sequence of primer probe C can trigger the alternating open-loop self-assembly of the hairpins of colorimetric probe C and colorimetric probe D.

7. A method for detecting an erasable and multiplexed single nucleotide polymorphism gene chip according to any one of claims 1 to 6, characterized in that: The specific steps of the detection method are as follows: Step 1: The sample solution after nucleic acid extraction is first incubated with the primer probe for preliminary polymorphic site recognition and chain signal conversion; Step 2: dripping the mixed solution after incubation onto the chip substrate loaded with capture probes and blocking probes to perform strand displacement reaction; Step 3: After the strand displacement, the chip substrate is lightly cleaned with a neutral salt solution, and then a fluorescent colorimetric probe solution is added dropwise for co-incubation to perform a colorimetric reaction; Step 4: After color development, the chip substrate is lightly cleaned with a neutral salt solution and then placed under a fluorescence microscope to take a picture and record. Single nucleotide polymorphism genotyping detection can be achieved based on the color of the fluorescence image; Step 5: After use, the chip is incubated and cleaned with alkaline solution to erase the colorimetric probe; the erased chip is incubated again with the blocking probe and can be used again according to the standard detection process.

8. The method for detecting an erasable and multiplexed single nucleotide polymorphism gene chip according to claim 7, characterized in that: The concentration of the primer probe is 0.05-1 μM. 1-5 U of Ampligase enzyme needs to be added to the co-incubation of the sample solution and the primer probe. The Ampligase enzyme is a heat-stable DNA ligase. A PCR instrument or a temperature control device such as an oscillating metal bath is used to perform a cycle reaction 10-60 times, at 90-95° C. for 30-120 s, 2-5° C. for 30-120 s, and 60-65° C. for 1-5 min.

9. The method for detecting an erasable and multiplexed single nucleotide polymorphism gene chip according to claim 7, characterized in that: The temperature of the chain displacement reaction is 20-40°C, and the time of the chain displacement reaction is 10-90 minutes; the pH of the neutral salt solution is 6.5-7.5, and the fluorescent colorimetric probes are annealed before use to prepare a mixed solution with a concentration of 0.5-2 μM, and the annealing procedure is: heating at 90-95°C for 5-10 minutes and naturally cooling to room temperature.

10. The method for detecting an erasable and multiplexed single nucleotide polymorphism gene chip according to claim 7, characterized in that: The color development reaction time is 10-90 minutes, and the temperature is 20-40°C; the pH of the alkaline solution is 12-13, the incubation and cleaning time of the alkaline solution is 10-30 minutes, and the number of incubation and cleaning times is 1-3 times; the concentration of the blocking probe is 0.5-2 μM, the incubation temperature is 20-40°C, and the incubation time is 10-90 minutes.

Images