Gene detection kit for anxiety disorder medication guidance and use method

Abstract

The invention belongs to the technical field of gene detection, and particularly relates to a gene detection kit for anxiety disorder medication guidance and a use method, the kit comprises primers and probes for detecting rs4244285, rs4986893 and rs12248560 sites of a CYP2C19 gene, rs776746 sites of a CYP3A5 gene, rs4263535 sites of a GABRA1 gene, rs6295 sites of an HTR1A gene and rs1902023 sites of a UGT2B15 gene, and the use method is characterized in that the primers and probes are used for detecting the rs4244285 sites, the rs4986893 sites and the rs12248560 sites of the CYP2C19 gene, the rs776746 comprising the following steps: 1) premixing and packaging gene detection reagents to respectively obtain PCR reaction liquid 1-14, and packaging the reaction liquid 1-14 into two 8-linked PCR reaction strips to jointly form a PCR reaction system; (2) adding DNA extracted from a sample into the PCR reaction system in the step (1), uniformly mixing, and carrying out PCR amplification; 3) performing genotyping interpretation after the reaction is ended, the kit has the characteristics of high sensitivity, low cost, simplicity and convenience in operation, short detection period, intuitive interpretation and the like, and the anxiety disorder related drug gene polymorphism can be quickly and accurately detected.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a gene detection kit for guiding medication for anxiety disorders and a method of use. Background Art

[0002] Anxiety disorders, also known as "anxiety disorders", are a group of mental disorders with anxiety symptoms as the main clinical phase, including panic disorder, generalized anxiety disorder and social anxiety disorder, which require active medical treatment. Anxiety disorders are mainly manifested as excessive worry, fear and anxiety, as well as related behavioral abnormalities. WHO conducted a world mental health survey and cross-cultural research on 28 countries including my country. From 14 epidemiological studies in Western countries such as the United States, New Zealand, Canada, Norway, Germany, and Australia that have completed the study, it was found that the lifetime prevalence of anxiety disorders in the population is 13.6% to 18.6%, and the annual prevalence is 5.6% to 19.3%. In the Beijing and Shanghai samples of WHO / WMHS, Shen Yucun, Zhang Mingyuan and others surveyed 5,210 people aged 18-70 and found that the annual prevalence of anxiety disorders was 2.7%. Anxiety disorders have an early onset age, with 80-90% developing before the age of 35, and the peak age of onset is 10-25 years old. Overall, anxiety disorders are characterized by a chronic course, high relapse rate, high comorbidity rate, and obvious social function impairment, which bring heavy economic burden and destructive power to families and society.

[0003] At present, drug therapy is an important treatment for anxiety disorders. Anxiety disorder treatment drugs mainly include second-generation antianxiety drugs (benzodiazepines The first generation of anxiety drugs (such as tadalafil and tadalafil), the third generation of anti-anxiety drugs (azaperone), and the third generation of anti-anxiety drugs (such as tadalafil and tadalafil). However, genetic variations in drug metabolism, transport, and drug target genes and changes in their expression levels can affect the drug's in vivo concentration and sensitivity, leading to huge individual differences in drug efficacy and adverse reactions. Therefore, the detection of anxiety disorder-related drug metabolizing enzymes and drug target genes can guide the clinic to select appropriate drugs and dosages for specific patients, achieve personalized medication, thereby improving the effectiveness and safety of drug treatment and preventing the occurrence of serious adverse drug reactions.

[0004] At present, the detection sites of genetic testing kits for anxiety disorder medication guidance are not comprehensive enough, and most of them cover 3-5 sites. At the same time, the most commonly used methods are direct sequencing, second-generation sequencing, and fluorescent probe methods, but these technologies have their own application defects. Some are cumbersome to operate, have a long detection cycle, and some are not intuitive to interpret. As a result, the current application of genetic testing for anxiety disorder medication guidance in clinical practice is poor and has been unable to meet clinical testing needs. Summary of the invention

[0005] In order to solve the problems in the prior art, the present invention provides a gene detection kit for guiding medication for anxiety disorders and a method of use, so that the gene detection kit for guiding medication for anxiety disorders has the characteristics of high sensitivity, low cost, simple operation, short detection cycle, intuitive interpretation, etc., and can quickly and accurately detect gene polymorphisms of drugs related to anxiety disorders.

[0006] The present invention solves the technical problem by adopting the following technical solutions:

[0007] The present invention aims to provide a gene detection kit for guiding medication for anxiety disorders, comprising primers and probes for detecting CYP2C19, CYP3A5, GABRA1, HTR1A and UGT2B15 genes.

[0008] Furthermore, the genetic polymorphism sites detected by the kit include rs4244285, rs4986893 and rs12248560 sites of the CYP2C19 gene, rs776746 site of the CYP3A5 gene, rs4263535 site of the GABRA1 gene, rs6295 site of the HTR1A gene, and rs1902023 site of the UGT2B15 gene.

[0009] Further, primers and probes for detecting the rs4244285 site:

[0010] Wild-type ARMS upstream primer, 4285-WF3:

[0011] SEQ IQ NO.1:CCCACTATCATTGATTATTTCTTG

[0012] Mutant ARMS upstream primer, 4285-MF3:

[0013] SEQ IQ NO.2:CCCACTATCATTGATTATTTCTTA

[0014] Common downstream primer, 4285-R:

[0015] SEQ IQ NO.3: AAGCAATCAATAAAGTCCCGAGG

[0016] Fluorescent probe 4285-P:

[0017] SEQ IQ NO.4: FAM-TGGAGAAAGTAAAAGAACACCAAGAATCG-BHQ1

[0018] Primers and probes for detecting rs4986893 locus:

[0019] Wild-type ARMS upstream primer, 6893-WF2:

[0020] SEQ IQ NO.5:GGATTGTAAGCACCCCCTAG

[0021] Mutant ARMS upstream primer, 6893-MF4:

[0022] SEQ IQ NO.6:GGATTGTAAGCACTCCCAGA

[0023] Common downstream primer, 6893-R:

[0024] SEQ IQ NO.7:GTATTCAAAAATGTACTTCAGGGCT

[0025] Fluorescent probe, 6893-P:

[0026] SEQ IQ NO.8: FAM-TTGCTTCCTGAGAAACCACTTACAGTCT-BHQ1

[0027] Primers and probes for detecting rs12248560 locus:

[0028] Wild-type ARMS upstream primer, 8560-WF3:

[0029] SEQ IQ NO.9:AATTTGTGTCTTTCTGTTCTCAAGAC

[0030] Mutant ARMS upstream primer, 8560-MF4:

[0031] SEQ IQ NO.10: AATTTGTGTCTTCTGTGCTCAGCGT

[0032] Common downstream primer, 8560-R:

[0033] SEQ IQ NO.11:GTTGGTGCCACACAGCTCATAG

[0034] Fluorescent probe, 8560-P:

[0035] SEQ IQ NO.12: FAM-CTGATGTAAGAGATAATGCGCCACGAT-BHQ1 Primers and probes for detecting rs776746 site:

[0036] Wild-type ARMS upstream primer, 6746-WF3:

[0037] SEQ IQ NO.13: GTGGTCCAAACAGGGAAGAGACGC

[0038] Wild-type ARMS downstream primer, 6746-R:

[0039] SEQ IQ NO.14:GGAGAGTGGCATAGGAGATACCC

[0040] Fluorescent probe, 6746-P1:

[0041] SEQ IQ NO.15: FAM-ATGTACCACCCAGCTTAACGAATGC-BHQ1

[0042] Mutant ARMS upstream primer, 6746-MR2:

[0043] SEQ IQ NO.16: CTTTAAAGAGCTCTTTTTGTCTTTCTA

[0044] Mutant ARMS downstream primer, 6746-F:

[0045] SEQ IQ NO.17:ACAGCAAGAGTCTCACACAGG

[0046] Fluorescent probe, 6746-P2:

[0047] SEQ IQ NO.18: FAM-TATGATGAAGGGTAATGTGGTCCAA-BHQ1

[0048] Primers and probes for detecting rs4263535 locus:

[0049] Wild-type ARMS upstream primer, 3535-WF3:

[0050] SEQ IQ NO.19:ACTGGATTCATTCTTGTCCATAAGTA

[0051] Mutant ARMS upstream primer, 3535-MF3:

[0052] SEQ IQ NO.20:ACTGGATTCATTCTTGTCCATAAGTG

[0053] Common downstream primer, 3535-R:

[0054] SEQ IQ NO.21:TACACTGACCATGCTTTAGGTAAGA

[0055] Fluorescent probe, 3535-P:

[0056] SEQ IQ NO.22: FAM-CAACTAGAAGCTGAGCAATGTATTTGAAAGA-BHQ1 Primers and probes for detecting rs6295 sites:

[0057] Wild-type ARMS upstream primer, 6295-WF3:

[0058] SEQ IQ NO.23:GAAGAAGACCGAGTTGTCTGAC

[0059] Mutant ARMS upstream primer, 6295-MF3:

[0060] SEQ IQ NO.24: GAAGAAGACCGAGTGTGTCTGAG

[0061] Common downstream primer, 6295-R:

[0062] SEQ IQ NO.25:GGGAGTAAGGCTGGACTGTTAGAT

[0063] Fluorescent probe, 6295-P:

[0064] SEQ IQ NO.26: FAM-CATTGCACTCCAGCCTGGGC-BHQ1

[0065] Primers and probes for detecting rs1902023 locus:

[0066] Wild-type ARMS upstream primer, 2023-WF3:

[0067] SEQ IQ NO.27:AATTTTCAGAAGAGAATCTTCCAACTA

[0068] Mutant ARMS upstream primer, 2023-MF2:

[0069] SEQ IQ NO.28: AATTTTCAGAAGAGAATCTTCCAAAGC

[0070] Common downstream primer, 2023-R:

[0071] SEQ IQ NO.29:CTGTGTTGACATCTTCGGCTTC

[0072] Fluorescent Probes, 2023-P:

[0073] SEQ IQ NO. 30: FAM-TAGCAGATGATTTACTGGCATTGACAAGA-BHQ1.

[0074] Furthermore, primers and probes for monitoring the internal control gene MTHFR are included, and the sequences are:

[0075] Upstream primer MTHFR-F: SEQ IQ NO.31: AGTGTCTTTGAAGTCTTCGTTC;

[0076] Downstream primer MTHFR-R: SEQ IQ NO.32: CCACTCCAGCATCACTCACTT;

[0077] Fluorescent probe MTHFR-P: SEQ IQ NO.33: CY5-TCTCGGGAGAACCAAACCGGAATG-BHQ2.

[0078] Furthermore, the fluorescent group at the 5' end of the probe is a FAM, VIC, HEX, CY5, Texas Red or ROX fluorescent reporter group suitable for fluorescent quantitative PCR analysis, and the quenching group at the 3' end is a TAMRA, BHQ1, BHQ2, MGB or Dabcy1 fluorescent quenching group suitable for fluorescent quantitative PCR. Preferably, the fluorescent group at the 5' end of the probe is FAM or CY5, and the quenching group at the 3' end is BHQ1 or BHQ2.

[0079] Furthermore, the kit also includes a PCR reaction solution, which contains a hot-start Taq enzyme, UDG enzyme, buffer, magnesium ions, and dNTP substances required for the PCR reaction.

[0080] The invention discloses a gene detection kit for guiding medication for anxiety disorders, comprising primers and probes for detecting CYP2C19, CYP3A5, GABRA1, HTR1A and UGT2B15 genes, primers and probes for monitoring internal control genes, PCR reaction solution, positive quality control products and negative quality control products.

[0081] Medications for anxiety disorders include one or more of diazepam, lorazepam, oxazepam, alprazolam, estazolam, midazolam, clobazam, etizolam, zolpidem, buspirone, and tandospirone.

[0082] The method for obtaining positive quality control products is as follows: based on the wild-type and mutant sequence information of the rs4244285, rs4986893 and rs12248560 sites of the CYP2C19 gene, the rs776746 site of the CYP3A5 gene, the rs4263535 site of the GABRA1 gene, the rs6295 site of the HTR1A gene, and the rs1902023 site of the UGT2B15 gene published in the NCBI database, plasmids are constructed to synthesize sequence gene fragments, and then the fragments are inserted into the T vector, and the Escherichia coli DH5α strain is used to transform and extract the plasmids, and the plasmids are mixed in equal proportions to obtain the positive quality control product.

[0083] The negative control was deionized water treated with DEPC.

[0084] A method for using a gene detection kit for guiding medication for anxiety disorders comprises the following steps:

[0085] 1) premixing and packaging gene detection reagents to obtain PCR reaction solution 1, PCR reaction solution 2, PCR reaction solution 3, PCR reaction solution 4, PCR reaction solution 5, PCR reaction solution 6, PCR reaction solution 7, PCR reaction solution 8, PCR reaction solution 9, PCR reaction solution 10, PCR reaction solution 11, PCR reaction solution 12, PCR reaction solution 13 and PCR reaction solution 14, respectively, and packaging them in two 8-link PCR reaction strips to form a PCR reaction system;

[0086] 2) adding the DNA extracted from the sample to the PCR reaction system in step 1), mixing and then performing PCR amplification;

[0087] 3) After the reaction is completed, genotyping is performed.

[0088] Further, the conditions for PCR amplification in step 2) are:

[0089] The conditions for the UDG enzyme reaction were: 50°C, 2 min;

[0090] The conditions for UDG enzyme inactivation were: 95°C, 10 min;

[0091] The amplification conditions of the system are a two-step method: denaturation: 94°C, 15 seconds; annealing and extension: 60°C, 40 seconds, set fluorescence signal collection; the number of cycles is set to 40.

[0092] Furthermore, the method for extracting DNA from samples is as follows: a blood sample containing an EDTA anticoagulant is taken for nucleic acid extraction, and the extraction reagent is a nucleic acid extraction kit (magnetic bead method) produced by Chongqing Puji Life Science Technology Co., Ltd.

[0093] Furthermore, the detection sites in the PCR reaction system are shown in the following table.

[0094]

[0095]

[0096] Genotyping interpretation: Under the above PCR reaction system and cycling program conditions, the FAM fluorescence detection signal of positive quality control products No. 1-14 should form a logarithmic amplification "S" curve; negative quality control products No. 1-14 should have no amplification curve or the Ct value is 0; observe whether the FAM fluorescence detection signal of No. 1-14 forms a logarithmic amplification "S" curve.

[0097] When the above conditions are met, observe the amplification curve of the reaction tube of the sample to be tested. If a logarithmic amplification "S"-shaped curve is formed, the sample to be tested contains the corresponding base mutation; if there is no logarithmic amplification "S"-shaped curve or the Ct value is 0, there is no corresponding base mutation.

[0098] Compared with the prior art, the beneficial technical effects of the present invention are:

[0099] (1) Based on ARMS technology and TaqMan fluorescent probe technology, the present invention packages 14 anxiety disorder medication guidance-related gene detection reagents into two 8-link PCR reaction strips, which are numbered 1-14 in sequence according to the well positions. Each two reaction strips include one person's detection reagent, which is pre-mixed and packaged for easy detection, thus realizing multi-gene variation analysis in one reaction system, reducing costs while improving detection efficiency.

[0100] (2) The present invention covers 7 loci, while existing detection technologies mostly cover 3-5 loci. The present invention updates the genes and loci for anxiety disorder drug detection, which is more comprehensive than the detection genes of other patents.

[0101] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented according to the contents of the specification. In order to make the above contents of the present invention and its objectives, features and advantages more obvious and easy to understand, the specific implementation methods of the present invention are listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 The present invention discloses a negative quality control product amplification curve of a gene detection kit for guiding medication for anxiety disorders and a method of use thereof.

[0103] Figure 2 A positive quality control product amplification curve of a gene detection kit for guiding medication for anxiety disorders and a method of use of the present invention. DETAILED DESCRIPTION

[0104] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary illustrations and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0105] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0106] The inventors analyzed the individual differences in the efficacy of anxiety disorder-related drugs in clinical practice, screened out 7 polymorphic sites of 5 genes that are closely related to anxiety disorder-related drugs, prepared a composition for detecting the 7 polymorphic sites and a detection kit using the composition, and established an accurate detection method to achieve effective medication guidance for anti-anxiety disorder drugs.

[0107] Example 1: Establishment and optimization of detection system

[0108] 1. The wild-type and mutant sequence information of rs4244285, rs4986893 and rs12248560 of CYP2C19 gene, rs776746 of CYP3A5 gene, rs4263535 of GABRA1 gene, rs6295 of HTR1A gene and rs1902023 of UGT2B15 gene were sorted out on NCBI and sent to Shanghai Bio-Tech for synthesis of wild-type and mutant plasmids. The 14 plasmids were diluted to 10 -4 ng / ul simulated wild-type and mutant samples, and 10 -4 ng / ul simulated wild-type and mutant plasmids were mixed in equal volumes to obtain heterozygous simulated samples.

[0109] 2 Based on the sequence characteristics of the genetic polymorphism sites, design the primers and probes used for sample testing and amplify the analysis results.

[0110] (1) According to the sequence characteristics of the genetic polymorphism site, the primers and probes used for sample detection are designed to obtain the forward primer, reverse primer, and fluorescent probe used in the following PCR detection system, including:

[0111] Design of primers and probes for detecting rs4244285 locus:

[0112] 4285-WF1:CCCACTATCATTGATTATTTCCCG

[0113] 4285-WF2:CCCACTATCATTGATTATTTCCTG

[0114] 4285-WF3: CCCACTATCATTGATTATTTCTTG

[0115] 4285-WF4: CCCACTATCATTGATTATTTATTG

[0116] 4285-MF1: CCCACTATCATTGATTATTTCCCA

[0117] 4285-MF2: CCCACTATCATTGATTATTTCCTA

[0118] 4285-MF3: CCCACTATCATTGATTATTTCTTA

[0119] 4285-MF4: CCCACTATCATTGATTATTTATTA

[0120] 4285-R: AAGCAATCAATAAAGTCCCGAGG

[0121] 4285-P: FAM-TGGAGAAAGTAAAAGAACACCAAGAATCG-BHQ1

[0122] Design primers and probes for detecting rs4986893 locus:

[0123] 6893-WF1: GGATTGTAAGCACCCCCTGG

[0124] 6893-WF2: GGATTGTAAGCACCCCCTAG

[0125] 6893-WF3: GGATTGTAAGCACCCCCAAG

[0126] 6893-WF4: GGATTGTAAGCACCCTCTAG

[0127] 6893-MF1: GGATTGTAAGCACCCCCTGA 6893-MF2: GGATTGTAAGCACCCCCTAA

[0128] 6893-MF3: GGATTGTAAGCACCCCCAAA

[0129] 6893-MF4: GGATTGTAAGCACTCCCAGA

[0130] 6893-R: GTATTCAAAAATGTACTTCAGGGCT

[0131] 6893-P: FAM-TTGCTTCCTGAGAAACCACTTACAGTCT-BHQ1 Design of primers and probes for detecting rs4244285 site:

[0132] 4285-WF1:CCCACTATCATTGATTATTTCCCG

[0133] 4285-WF2:CCCACTATCATTGATTATTTCCTG

[0134] 4285-WF3:CCCACTATCATTGATTATTTCTTG

[0135] 4285-WF4:CCCACTATCATTGATTATTTATTG

[0136] 4285-MF1:CCCACTATCATTGATTATTTCCCA

[0137] 4285-MF2:CCCACTATCATTGATTATTTCCTA

[0138] 4285-MF3:CCCACTATCATTGATTATTTCTTA

[0139] 4285-MF4:CCCACTATCATTGATTATTTATTA

[0140] 4285-R: AAGCAATCAATAAAGTCCCGAGG

[0141] 4285-P: FAM-TGGAGAAAGTAAAAGAACACCAAGAATCG-BHQ1 Design of primers and probes for detecting rs12248560 site:

[0142] 8560-WF1:AATTTGTGTCTTCTGTTCTCAAAGC

[0143] 8560-WF2:AATTTGTGTCTTCTGTTCTCAAAAC

[0144] 8560-WF3: AATTTGTGTCTTTCTGTTCTCAAGAC

[0145] 8560-WF4: AATTTGTGTCTTTCTGTTCTCATGAC

[0146] 8560-MF1:AATTTGTGTCTTCTGTTCTCAAAGT

[0147] 8560 - MF2: AATTTGTGTCTTCTGTTCTCAAAAT

[0148] 8560 - MF3: AATTTGTGTCTTCTGTTCTCAAGAT

[0149] 8560 - MF4: AATTTGTGTCTTCTGTGCTCAGCGT

[0150] 8560 - R: GTTGGTGCCACACAGCTCATAG

[0151] 8560 - P: FAM - CTGATGTAAGAGATAATGCGCCACGAT - BHQ1 Design primer and probe for detecting rs776746 locus:

[0152] 6746 - WF1: GTGGTCCAAACAGGGAAGAGATAC

[0153] 6746 - WF2: GTGGTCCAAACAGGGAAGAGATGC

[0154] 6746 - WF3: GTGGTCCAAACAGGGAAGAGACGC

[0155] 6746 - WF4: GTGGTCCAAACAGGGAAGAGTCGC

[0156] 6746 - R: GGAGAGTGGCATAGGAGATACCC

[0157] 6746 - P1: FAM - ATGTACCACCCAGCTTAACGAATGC - BHQ1

[0158] 6746 - MR1: CTTTAAAGAGCTCTTTTGTCTTTCAA

[0159] 6746 - MR2: CTTTAAAGAGCTCTTTTGTCTTTCTA

[0160] 6746 - MR3: CTTTAAAGAGCTCTTTTGTCTTTGTA

[0161] 6746 - MR4: CTTTAAAGAGCTCTTTTGTCTTAGTA

[0162] 6746 - F: ACAGCAAGAGTCTCACACAGG

[0163] 6746-P2: FAM-TATGATGAAGGGTAATGTGGTCCAA-BHQ1 Design of primers and probes for detecting rs4263535 site:

[0164] 3535-WF1:ACTGGATTCATTCTTGTCCATAATCA

[0165] 3535-WF2:ACTGGATTCATTCTTGTCCATAATTA

[0166] 3535-WF3:ACTGGATTCATTCTTGTCCATAAGTA

[0167] 3535-WF4:ACTGGATTCATTCTTGTCCATATGTA

[0168] 3535-MF1:ACTGGATTCATTCTTGTCCATAATCG

[0169] 3535-MF2:ACTGGATTCATTCTTGTCCATAATTG

[0170] 3535-MF3:ACTGGATTCATTCTTGTCCATAAGTG

[0171] 3535-MF4:ACTGGATTCATTCTTGTCCATATGTG

[0172] 3535-R:TACACTGACCATGCTTTAGGTAAGA

[0173] 3535-P: FAM-CAACTAGAAGCTGAGCAATGTATTTGAAAGA-BHQ1 Design of primers and probes for detecting rs6295 locus:

[0174] 6295-WF1:GAAGAAGACCGAGTTGTGTCTTCC

[0175] 6295-WF2:GAAGAAGACCGAGTTGTGTCTTAC

[0176] 6295-WF3: GAAGAAGACCGAGTGTGTCTTGAC

[0177] 6295-WF4: GAAGAAGACCGAGTTGTGTCAGAC

[0178] 6295-MF1:GAAGAAGACCGAGTTGTGTCTTCG

[0179] 6295-MF2:GAAGAAGACCGAGTTGTGTCTTAG

[0180] 6295-MF3:GAAGAAGACCGAGTTGTCTGAG

[0181] 6295-MF4: GAAGAAGACCGAGTTGTGTCAGAG

[0182] 6295-R:GGGAGTAAGGCTGGACTGTTAGAT

[0183] 6295-P: FAM-CATTGCACTCCAGCCTGGGC-BHQ1

[0184] Design of primers and probes for detecting rs1902023 locus:

[0185] 2023-WF1:AATTTTCAGAAGAGAATCTTCCAAATA

[0186] 2023-WF2: AATTTTCAGAAGAGAATCTTCCAAACA

[0187] 2023-WF3: AATTTTCAGAAGAGAATCTTCCAACTA

[0188] 2023-WF4: AATTTTCAGAAGAGAATCTTCCAACCA

[0189] 2023-MF1: AATTTTCAGAAGAGAATCTTCCAAATC

[0190] 2023-MF2: AATTTTCAGAAGAGAATCTTCCAAAGC

[0191] 2023-MF3: AATTTTCAGAAGAGAATCTTCCAAGTC

[0192] 2023-MF4: AATTTTCAGAAGAGAATCTTCCAAGGC

[0193] 2023-R: CTGTTGTTGACATCTTCGGCTTC

[0194] 2023-P: FAM-TAGCAGATGATTTACTGGCATTGACAAGA-BHQ1

[0195] Primers and probes for detecting the endogenous control gene MTHFR:

[0196] MTHFR-F: AGTGTCTTTGAAGTCTTCGTTC

[0197] MTHFR-R:CCACTCCAGCATCACTCACTT

[0198] MTHFR-P: CY5-TCTCGGGAGAACCAAACCGGAATG-BHQ2

[0199] (2) Prepare single-plex PCR detection systems for detecting rs4244285, rs4986893 and rs12248560 of CYP2C19 gene, rs776746 of CYP3A5 gene, rs4263535 of GABRA1 gene, rs6295 of HTR1A gene, and rs1902023 of UGT2B15 gene, respectively, including one tube for wild-type system and one tube for mutant system. The detection systems are shown in Tables 1 and 2.

[0200] Table 1: Wild-type detection system

[0201] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 Wild-type ARMS upstream primer 0.3 Wild-type ARMS downstream primer 0.3 Probe 0.15 DNA (template) 2 DEPC water Make up to 20ul

[0202] Table 2: Mutation detection system

[0203]

[0204]

[0205] The DNA templates are the wild-type and mutant simulation samples diluted in step 1, and the primers and probes are the primers and probes shown in step 2 (1), respectively.

[0206] In each PCR wild-type detection system, the wild-type ARMS downstream primer and probe were fixed, and one wild-type ARMS upstream primer was added each time; in each PCR mutant detection system, the mutant ARMS downstream primer and probe were fixed, and one mutant ARMS upstream primer was added each time; until all primer and probe combinations in step 2 obtained detection results, the wild-type and mutant ARMS upstream primers were screened. In each PCR mutant detection system and single-plex PCR wild-type detection system, the DNA samples added were the corresponding wild-type and mutant plasmids, with a final concentration of 10 -4 ng / ul.

[0207] (3) The prepared PCR wild-type detection system and PCR mutant detection system are subjected to PCR amplification. The PCR reaction procedure is as follows:

[0208] Stage 1: 50°C, 2 minutes;

[0209] Stage 2: 95°C, 10 minutes;

[0210] The third stage: 94°C, 15 seconds; 60°C, 40 seconds, the number of cycles is set to 40; fluorescence is collected at 60°C.

[0211] (4) Experimental results: PCR was performed on the above primers and probes, and the CT values ​​of the PCR wild-type detection system and the PCR mutant detection system were directly read. The experimental results of each group are shown in Table 3 below.

[0212] Table 3

[0213]

[0214]

[0215]

[0216] According to the CT results, firstly, the wild-type ARMS upstream primers with a wild-type detection system wild-type plasmid between 22-30, mutant plasmid without CT value or greater than 35 were selected, and the mutant ARMS upstream primers with a mutant detection system mutant plasmid between 22-30, wild-type plasmid without CT value or greater than 35 were selected, and then the ARMS upstream primers with a CT value difference of 2 between the wild-type ARMS upstream primer and the mutant ARMS upstream primer were selected. The primer probe combination finally selected is shown in Table 4 below.

[0217] Table 4

[0218]

[0219] 3 Based on the specific primer-probe combination screened by PCR, add internal control to prepare the PCR reaction solution for each site.

[0220] Table 5: Wild-type detection system

[0221] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 Wild-type ARMS upstream primer 0.3 Wild-type ARMS downstream primer 0.3 Wild-type probe 0.15 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.15 DNA (template) 2 DEPC water Make up to 20ul

[0222] Table 6: Mutation detection system

[0223]

[0224]

[0225] The DNA templates are the wild-type, mutant plasmid and hybrid plasmid simulation samples synthesized and diluted in step 1, and the primers and probes are the primers and probes screened in step 2.

[0226] Each wild-type reaction system added a wild-type ARMS upstream primer, a wild-type ARMS downstream primer, and a wild-type probe at one site; each mutant reaction system added a mutant ARMS upstream primer, a mutant ARMS downstream primer, and a mutant probe at one site. The DNA samples added to each site reaction system were the corresponding wild-type, mutant plasmid, and hybrid plasmid, with a final concentration of 10 -4 ng / ul.

[0227] The prepared PCR reaction solution for each site is subjected to PCR amplification. The PCR reaction procedure is as follows:

[0228] Stage 1: 50°C, 2 minutes;

[0229] Stage 2: 95°C, 10 minutes;

[0230] The third stage: 94°C, 15 seconds; 60°C, 40 seconds, the number of cycles is set to 40; fluorescence is collected at 60°C.

[0231] Experimental results: The experimental results of each group of FAM signal CT values ​​at each point are shown in Table 7 below.

[0232] Table 7

[0233]

[0234]

[0235] 4 Based on the reaction results of step 3, adjust the amount of primers and probes at each site to obtain the final reaction system as follows:

[0236] PCR reaction solution 1

[0237] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 4285-WF3 0.3 4285-R 0.3 4285-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0238] PCR reaction solution 2

[0239] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 4285-MF3 0.35 4285-R 0.35 4285-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0240] PCR reaction solution 3

[0241] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 6893-WF2 0.3 6893-R 0.3 6893-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0242] PCR reaction solution 4

[0243] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 6893-MF4 0.3 6893-R 0.3 6893-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0244] PCR reaction solution 5

[0245] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 8560-WF3 0.25 8560-R 0.25 8560-P 0.15 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0246] PCR reaction solution 6

[0247] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 8560-MF4 0.3 8560-R 0.3 8560-P 0.15 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0248] PCR reaction solution 7

[0249]

[0250]

[0251] PCR reaction solution 8

[0252] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 6746-MR2 0.3 6746-F 0.3 6746-P2 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0253] PCR reaction solution 9

[0254] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 3535-WF3 0.3 3535-R 0.3 3535-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0255] PCR reaction solution 10

[0256]

[0257]

[0258] PCR reaction solution 11

[0259] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 6295-WF3 0.3 6295-R 0.3 6295-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0260] PCR reaction solution 12

[0261] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 6295-MF3 0.3 6295-R 0.3 6295-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0262] PCR reaction solution 13

[0263] Reagent name Volume (μL) Hotstart HiTaq Master PCR Mix(25×) 0.8 5×Hotstart HiTaq Buffer 4 2023-WF3 0.3 2023-R 0.3 2023-P 0.2 MTHFR-F 0.3 MTHFR-R 0.3 MTHFR-P 0.2 DNA (template) 2 DEPC water Make up to 20ul

[0264] PCR reaction solution 14

[0265]

[0266]

[0267] The above primers and probes can be used to specifically detect the types of gene mutations associated with anti-anxiety disorder medication in samples, as shown in Table 8 below.

[0268] Table 8

[0269]

[0270] 5. Design of the kit: The kit of the present invention adopts an 8-link PCR reaction strip design, and each 2 reaction strips include 1 test reagent, namely tubes 1-14, and tubes 1-14 are composed of gene detection reagents, which respectively indicate different genotypes of rs4244285, rs4986893 and rs12248560 sites of the CYP2C19 gene, rs776746 site of the CYP3A5 gene, rs4263535 site of the GABRA1 gene, rs6295 site of the HTR1A gene, and rs1902023 site of the UGT2B15 gene. The reaction solutions in tubes 1-14 correspond to PCR reaction solutions 1-14, respectively.

[0271] 6. Obtaining positive quality control products

[0272] The wild-type and mutant sequences of rs4244285, rs4986893 and rs12248560 of CYP2C19 gene, rs776746 of CYP3A5 gene, rs4263535 of GABRA1 gene, rs6295 of HTR1A gene, rs1902023 of UGT2B15 gene and sequence information of MTHFR were sorted out on NCBI and sent to Shanghai Bio-Tech for synthesizing wild-type, mutant and internal control plasmids. The 15 plasmids were diluted to 10 -4 ng / ul equal volumes were mixed to obtain the positive quality control product.

[0273] Example 2: Use of Gene Detection Kit

[0274] 1. Sample collection and processing

[0275] Peripheral blood was collected from patients using a vacuum tube containing EDTA anticoagulant to collect 5 ml of blood specimens. Nucleic acid was extracted using an acid extraction kit (magnetic bead method) produced by Chongqing Puji. The experimental steps were carried out according to the instructions.

[0276] 2. Preparation of reaction system

[0277] Preparation of the reaction system The reaction system was prepared according to the PCR reaction solutions 1-14 in Example 1.

[0278] 3. PCR reaction

[0279] Add the DNA extracted from the sample to the prepared reaction system, and add 1-200ng of template. When performing PCR reaction, the sample to be tested, the positive quality control product and the negative quality control product need to be tested in parallel on the machine, and each sample needs to be added to tubes 1-14 at the same time for reaction.

[0280] 4. Instrument channel and reaction volume selection

[0281] ① Select FAM channel (Reporter: FAM, Quencher: BHQ1) and CY5 channel (Reporter: CY5, Quencher: BHQ2) to detect amplification;

[0282] ②The reaction volume (Sample Volume) is 20μL.

[0283] ③ Reference Dye: If you are using an ABI series PCR instrument, please be sure to select "none" in the passive reference; for specific detection channel settings, please refer to the instructions for use of each instrument.

[0284] Stage 1: 50°C, 2 minutes;

[0285] Stage 2: 95°C, 10 minutes;

[0286] The third stage: 94°C, 15 seconds; 60°C, 40 seconds, the number of cycles is set to 40; fluorescence is collected at 60°C.

[0287] 6. Experimental results

[0288] After the reaction program is completed, the results are saved and interpreted. The test results are interpreted according to the following scheme:

[0289] 1) In the negative control tubes 1-14, there should be no peaks for FAM and CY5, and no Ct values ​​(see attached Figure 1 ); If FAM or CY5 peaks in the negative control, it means that the reaction system is contaminated. Please eliminate the contamination and repeat the reaction.

[0290] 2) In the positive control tubes 1-14, both FAM and CY5 should have normal peaks and show an "S" curve (see attached Figure 2 ); If any of the FAM and CY5 signals in the positive control reaction do not peak normally, please check whether the reaction program settings are correct.

[0291] 3) When the results of 1) and 2) are met, observe the detection signals in tube A and tube B:

[0292] In the reaction tube of the sample to be tested, if the FAM signal of the wild-type detection system is ≤35 and the FAM signal of the mutant detection system is >35, it is wild type; if the FAM signal of the mutant detection system is ≤35 and the FAM signal of the wild-type detection system is >35, it is mutant type; if the FAM signals of the wild-type detection system and the mutant detection system are both less than 35, it is heterozygous.

[0293] Example 3: Determination of the genotype determination criteria of the kit

[0294] According to the detection method in Example 2, the CT value of the PCR detection system is directly read, and the genotype is determined according to the CT value of the FAM signal of the PCR wild-type and mutant-type detection systems. Based on the detection of 120 human peripheral blood gDNA samples by this kit, if the FAM signal of the wild-type detection system is ≤35 and the FAM signal of the mutant-type detection system is >35, it is wild-type; if the FAM signal of the mutant-type detection system is ≤35 and the FAM signal of the wild-type detection system is >35, it is mutant; if the FAM signal of the wild-type detection system and the FAM signal of the mutant-type detection system are both less than 35, it is heterozygous.

[0295] Example 4: Accurate performance evaluation of the kit

[0296] 10 clinical samples were selected and tested according to the test method of Example 2 and the judgment criteria of Example 3, and the gold standard Sanger sequencing method was used for accuracy comparison. The test results are shown in Table 9 below.

[0297] Table 9: Accuracy test results

[0298]

[0299] The detection results of each sample in the accuracy test results are consistent with the comparison results, indicating that the detection system of the kit of Example 2 has good accuracy.

[0300] Example 5: Detection limit performance evaluation of the kit

[0301] Three detection limit reference materials L1, L2, and L3 were selected and diluted with TE buffer to 10 ng / μL, 5 ng / μL, 2.5 ng / μL, and 1 ng / μL, 0.5 g / μL. The detection was performed according to the method of Example 2 using the judgment criteria of Example 3. Each concentration reference material was tested 20 times. The results are shown in Table 10 below.

[0302] Table 10: Detection limit test results

[0303]

[0304] The detection limit of the kit of the present invention is calculated to be as low as 1 ng / μL by taking 95% detection rate as the minimum detection limit, and the present invention has good sensitivity.

[0305] Example 6: Evaluation of Kit Precision

[0306] Three precision reference samples J1 (plasmid mixed to make all sites heterozygous) and J2 (J2 is a clinical sample) were selected for testing according to the method of Example 2, with two batches per day, and each batch was tested 4 times for 5 days. The coefficient of variation (CV, %) was calculated using the Ct values ​​of the 40 test results of the precision experiment. The results are shown in Table 11 below.

[0307] Table 11

[0308] J1 genotype Wild-type FAM CV value Mutant FAM CV value CY5 CV value rs4244285 GA 2.35％ 1.83％ 1.34％ rs4986893 GA 0.87％ 0.50％ 1.22％ rs12248560 CT 1.17％ 1.54％ 0.51％ rs776746 TC 2.03％ 1.58％ 1.75％ rs4263535 AG 2.08％ 1.29％ 1.97％ rs6295 CG 1.05％ 1.71％ 1.22％ rs1902023 AC 1.47％ 0.65％ 0.74％ J2 genotype Wild-type FAM CV value Mutant FAM CV value CY5 CV value rs4244285 GG 0.61％ 0.98％ 1.18％ rs4986893 GG 1.27％ - 1.47％ rs12248560 CT 0.73％ 1.53％ 0.59％ rs776746 TC 1.24％ 1.01％ 1.71％ rs4263535 AG 1.08％ 1.46％ 1.30％ rs6295 CC 0.78％ 1.29％ 1.96％ rs1902023 AC 1.70％ 1.24％ 1.04％

[0309] The calculation results showed that the intra-batch and inter-batch precision results were both within 5%, indicating that the kit of the present invention has good repeatability.

[0310] The serial numbers of the above embodiments of the present invention are only for description and do not represent the advantages or disadvantages of the embodiments.

Claims

1. A gene detection kit for guiding medication for anxiety disorders, characterized in that: Includes primers and probes for detecting CYP2C19, CYP3A5, GABRA1, HTR1A, and UGT2B15 genes.

2. A gene detection kit for guiding medication for anxiety disorders as claimed in claim 1, characterized in that: The genetic polymorphism sites detected by the kit include rs4244285, rs4986893 and rs12248560 sites of the CYP2C19 gene, rs776746 site of the CYP3A5 gene, rs4263535 site of the GABRA1 gene, rs6295 site of the HTR1A gene, and rs1902023 site of the UGT2B15 gene.

3. A gene detection kit for guiding medication for anxiety disorders as claimed in claim 2, characterized in that: Primers and probes for detecting rs4244285 locus: Wild-type ARMS upstream primer 4285-WF3: SEQ IQ NO.1; Mutant ARMS upstream primer 4285-MF3: SEQ IQ NO.2; Common downstream primer 4285-R: SEQ IQ NO.3; Fluorescent probe 4285-P: SEQ IQ NO.4; Primers and probes for detecting rs4986893 locus: Wild-type ARMS upstream primer 6893-WF2: SEQ IQ NO.5; Mutant ARMS upstream primer 6893-MF4: SEQ IQ NO.6; Common downstream primer 6893-R: SEQ IQ NO.7; Fluorescent probe 6893-P: SEQ IQ NO.8; Primers and probes for detecting rs12248560 locus: Wild-type ARMS upstream primer 8560-WF3: SEQ IQ NO.9; Mutant ARMS upstream primer 8560-MF4: SEQ IQ NO.10; Common downstream primer 8560-R: SEQ IQ NO.11; Fluorescent probe 8560-P: SEQ IQ NO.12; Primers and probes for detecting rs776746 locus: Wild-type ARMS upstream primer 6746-WF3: SEQ IQ NO.13; Wild-type ARMS downstream primer 6746-R: SEQ IQ NO.14; Fluorescent probe 6746-P1: SEQ IQ NO.15; Mutant ARMS upstream primer 6746-MR2: SEQ IQ NO.16; Mutant ARMS downstream primer 6746-F: SEQ IQ NO.17; Fluorescent probe 6746-P2: SEQ IQ NO.18; Primers and probes for detecting rs4263535 locus: Wild-type ARMS upstream primer 3535-WF3: SEQ IQ NO.19; Mutant ARMS upstream primer 3535-MF3: SEQ IQ NO.20; Common downstream primer 3535-R: SEQ IQ NO.21; Fluorescent probe 3535-P: SEQ IQ NO.22; Detection of rs6295 locus primers and probes: Wild-type ARMS upstream primer 6295-WF3: SEQ IQ NO.23; Mutant ARMS upstream primer 6295-MF3: SEQ IQ NO.24; Common downstream primer 6295-R: SEQ IQ NO.25; Fluorescent probe 6295-P: SEQ IQ NO.26; Primers and probes for detecting rs1902023 locus: Wild-type ARMS upstream primer 2023-WF3: SEQ IQ NO.27; Mutant ARMS upstream primer 2023-MF2: SEQ IQ NO.28; Common downstream primer 2023-R: SEQ IQ NO.29; Fluorescent probe 2023-P: SEQ IQ NO.

30.

4. A gene detection kit for guiding medication for anxiety disorders as claimed in claim 3, characterized in that: Also included are primers and probes for the internal control gene MTHFR used for monitoring, the sequences of which are: Upstream primer MTHFR-F: SEQ IQ NO.31; Downstream primer MTHFR-R: SEQ IQ NO.32; Fluorescent probe MTHFR-P: SEQ IQ NO.

33.

5. A gene detection kit for guiding medication for anxiety disorders as claimed in claim 4, characterized in that: The fluorescent group at the 5' end of the probe is FAM or CY5, and the quenching group at the 3' end is BHQ1 or BHQ2.

6. A gene detection kit for guiding medication for anxiety disorders as claimed in claim 1, characterized in that: The kit also includes a PCR reaction solution, which contains a hot-start Taq enzyme, UDG enzyme, buffer, magnesium ions, and dNTP substances required for the PCR reaction.

7. A method for using a gene detection kit for guiding medication for anxiety disorders according to any one of claims 1 to 6, characterized in that: The following steps are involved: 1) premixing and packaging gene detection reagents to obtain PCR reaction solution 1, PCR reaction solution 2, PCR reaction solution 3, PCR reaction solution 4, PCR reaction solution 5, PCR reaction solution 6, PCR reaction solution 7, PCR reaction solution 8, PCR reaction solution 9, PCR reaction solution 10, PCR reaction solution 11, PCR reaction solution 12, PCR reaction solution 13 and PCR reaction solution 14, respectively, and packaging them in two 8-link PCR reaction strips to form a PCR reaction system; 2) adding the DNA extracted from the sample to the PCR reaction system in step 1), mixing and then performing PCR amplification; 3) After the reaction is completed, genotyping is performed.

8. A method for using a gene detection kit for guiding medication for anxiety disorders as claimed in claim 7, characterized in that: The conditions for PCR amplification in step 2) are: The conditions for the UDG enzyme reaction were: 50°C, 2 min; The conditions for UDG enzyme inactivation were: 95°C, 10 min; The amplification conditions of the system are a two-step method: denaturation: 94°C, 15 seconds; annealing and extension: 60°C, 40 seconds, set fluorescence signal collection; the number of cycles is set to 40.

Images