Primer group, kit and detection method for detecting brucella

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses a primer, a primer probe group, a detection kit and a detection method for detecting brucella. The invention provides a novel specific target gene recA for detecting brucella, and primers and probes are designed based on a recA gene conserved sequence, so that the screened primer probe group can accurately detect brucella in a clinical sample; no cross reaction with staphylococcus aureus, acinetobacter baumannii, klebsiella pneumoniae, escherichia coli and pseudomonas aeruginosa exists, and the specificity reaches 100%. The brucella microdroplet digital PCR detection method provided by the invention is simple to operate, wide in linear range, low in detection limit, good in repeatability and high in sensitivity, a single copy in a sample can be detected, and the detection kit prepared from the brucella microdroplet digital PCR detection method has a good clinical application prospect and a relatively high economic value.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a primer, a primer probe set, a detection kit and a detection method for detecting Brucella. Background Art

[0002] Brucella is a type of Gram-negative bacteria that can cause brucellosis, also known as "undulant fever", "Mediterranean fever" or "Maltese fever". This disease affects a variety of animals, including cattle, sheep, goats, pigs, etc., and can cause human infection through contact with infected animals or consumption of infected animal products. It is also one of the most common zoonotic infectious diseases.

[0003] Brucella detection methods mainly include bacterial isolation and culture, serological diagnosis, antibody detection (test tube agglutination method) and molecular biology detection (conventional PCR, real-time fluorescence quantitative PCR). Among them, bacterial isolation and culture and serological diagnosis are classic detection methods, but they also have problems such as long detection cycle, cumbersome operation, easy missed detection and potential biological hazards. Antibody detection is used for in vitro qualitative detection of Brucella antibodies in body fluids, but there will be problems such as false negatives due to the failure of antibodies to form in the body at the early stage of infection, or missed detection due to the failure of antibodies to be produced due to low immune function. The conventional PCR method requires gel electrophoresis analysis, which is prone to laboratory contamination of PCR products and has low detection sensitivity. Real-time fluorescence quantitative PCR (qPCR) has high sensitivity, but the presence of PCR inhibitors in certain body fluid samples (such as blood) will affect the qPCR effect, thereby limiting its practical application.

[0004] Droplet digital PCR (ddPCR) is a fast, accurate, and absolutely quantitative DNA PCR method developed in recent years, and has been widely used in the detection of bacteria and viruses. ddPCR uses microfluidics and proprietary surfactant chemical components to randomly distribute the reaction system containing the target bacterial nucleic acid into tens of thousands of oil-in-water droplets of uniform size. Each droplet is an independent PCR reactor, which contains zero, one or more target nucleic acid molecules, and can achieve independent PCR amplification. After amplification, the fluorescent signal in each droplet is detected, and the data is analyzed using analysis software based on the Poisson distribution principle to obtain the absolute quantitative value of the number of nucleic acid copies in the original reaction system. Compared with existing PCR methods, ddPCR does not require the preparation of standards and standard curves, which can reduce the difficulty of absolute quantification of nucleic acid copy numbers, reduce the influence of PCR inhibitors in the template, and avoid the subjectivity of analysis. At present, this method has been applied to the detection and research of Brucella.

[0005] Chinese patent application (CN111733217A, China CDC Infectious Diseases Institute) discloses a method for detecting Brucella DNA using digital PCR technology, including: designing upstream and downstream primers and probes based on the gene sequence of Brucella-specific protein bcsp31 (nucleotide sequence as shown in SEQ ID NO: 1-3), mixing with template and 2×ddPCR Supermix to prepare PCR reaction system, adding it and droplet generating oil to a droplet generator to generate droplets, and then performing digital PCR detection to obtain the copy number of Brucella DNA in the sample. In addition, Chinese patent application (CN113755618A, China Animal Health and Epidemiology Center) discloses a method for detecting Brucella in animals based on droplet digital PCR, designing upstream and downstream primers and probes based on the conservative sequence of Brucella bcsp31 gene (nucleotide sequence as shown in SEQ ID NO: 1-3), and the detection steps are basically the same as above. It is not difficult to see that the above patents all carry out nucleic acid detection on the specific target gene bcsp31 of Brucella. In addition, commonly used target genes include omp2, omp31, omp28, 16S rRNA and IS711.

[0006] In order to improve the accuracy, specificity and sensitivity of detection, it is necessary to develop new specific target genes for Brucella to expand the scope of detection and detect pathogens that cannot be identified by existing methods. Summary of the invention

[0007] The main technical problem solved by the invention is to provide a new specific target gene for detecting Brucella.

[0008] Secondly, the present invention provides a primer for detecting Brucella.

[0009] Again, the present invention provides a primer probe set for detecting Brucella.

[0010] From this, the present invention provides a kit for detecting Brucella.

[0011] Finally, the present invention provides a Brucella microdroplet digital PCR detection method.

[0012] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0013] The application of the recA gene fragment (new specific target gene for detecting Brucella) includes but is not limited to one or more of the following aspects:

[0014] (1) Application of recA gene fragment in preparing primers for detecting Brucella;

[0015] (2) Application of recA gene fragment in the preparation of primer probe set for detecting Brucella;

[0016] (3) Application of recA gene fragment in the preparation of a kit for detecting Brucella;

[0017] The nucleotide sequence of the recA gene fragment is shown in SEQ ID NO:1.

[0018] As a preferred embodiment of the present invention, the nucleotide sequence of the recA gene fragment is shown in SEQ ID NO:2.

[0019] The present invention selects the recA gene fragment as the target gene, the expression of which is correlated to the pathogenicity and drug resistance of Brucella, and the sequence and function of which are different among different species, which is helpful for designing specific detection primers and probes.

[0020] A primer for detecting Brucella, wherein the primer is designed and synthesized according to a recA gene fragment, and the nucleotide sequence of the recA gene fragment is shown in SEQ ID NO:1.

[0021] As a preferred embodiment of the present invention, the primer comprises:

[0022] Upstream primer Bru-F: 5′-CTCGCCGGAAACGACAACG-3′ (SEQ ID NO: 3);

[0023] Downstream primer Bru-R: 5'-GTTGCCCACCACTTCGT-3' (SEQ ID NO: 4).

[0024] A primer probe set for detecting Brucella, in addition to the above primers, also comprises a probe (Taqman probe) for detecting a recA gene fragment, wherein the probe is designed and synthesized according to the recA gene fragment.

[0025] As a preferred embodiment of the present invention, the probe is:

[0026] Probe Bru-P: 5'-FAM-CGGCAATGCGCTCAAGTTCTATGCT-BHQ1-3' (SEQ ID NO: 5).

[0027] A kit for detecting Brucella, comprising any one of the following components:

[0028] (1) the above-mentioned primers for detecting Brucella;

[0029] (2) The above-mentioned primer probe set for detecting Brucella.

[0030] As a preferred embodiment of the present invention, the kit further comprises one or more of the following components:

[0031] (1) DNA polymerase Mix;

[0032] (2) Exogenous quality control products;

[0033] (3) critical positive control;

[0034] (4) Droplet generation chip;

[0035] (5) Droplet generation of oil;

[0036] (6) Droplet detection chip;

[0037] (7) Droplet detection oil.

[0038] Specifically, the DNA polymerase Mix is ​​provided in the form of a reaction premix, which can be diluted by multiples when used. For example, a 2× reaction premix is ​​mixed with primers, probes, and templates and then diluted to 1× with water for use.

[0039] Specifically, the exogenous quality control product includes a plasmid recombined with an octopus mitochondrial COX gene fragment (nucleotide sequence as shown in SEQ ID NO: 6), an exogenous quality control primer and an exogenous quality control probe. The exogenous quality control primer and the exogenous quality control probe are designed and synthesized according to the octopus mitochondrial COX gene fragment, as shown below:

[0040] Upstream primer PC-F: 5′-GGCCAGACAGAGGTGTTT-3′ (SEQ ID NO: 7);

[0041] Downstream primer PC-R: 5′-GGAATTAAGCATTCTTTCAATGCAG-3′ (SEQ ID NO: 8);

[0042] Probe PC-P: 5'-VIC-TCACCAAATGTTGCAAAGACTCTGGA-BHQ1-3' (SEQ ID NO: 9).

[0043] Specifically, the critical positive control is a plasmid recombined with a recA gene fragment (nucleotide sequence as shown in SEQ ID NO: 1).

[0044] A Brucella microdroplet digital PCR detection method comprises the following steps:

[0045] (1) Using the sample DNA to be tested as a template, mixing with primers, probes (or primer-probe sets), and DNA polymerase Mix to prepare a reaction system;

[0046] (2) mixing the reaction system with a droplet-generating oil to prepare droplets;

[0047] (3) Taking a droplet to perform a PCR reaction, and then performing a droplet detection to obtain a detection result.

[0048] As a preferred embodiment of the present invention, in step (1), the reaction system is composed of: 0.5 μL template DNA, 7.5 μL DNA polymerase Mix, 2.4 μL each of 10 μM upstream and downstream primers, 0.75 μL 10 μM probe, and sterile double deionized water to 30 μL.

[0049] As a preferred embodiment of the present invention, in step (2), the preparation of microdroplets is: taking 30 μL of the reaction system and 180 μL of microdroplet generation oil, and generating microdroplets in a microdroplet preparation instrument.

[0050] As a preferred embodiment of the present invention, in step (3), the PCR reaction procedure is: 95°C for 10 min; 94°C for 30 s, 60°C for 60 s, 40 cycles; and maintained at 12°C.

[0051] Beneficial effects of the present invention:

[0052] The present invention provides a novel specific target gene recA for detecting Brucella, and designs primers and probes based on the conservative sequence of the recA gene. The primer and probe set screened thereby can accurately detect Brucella in clinical samples, has no cross reaction with Staphylococcus aureus, Acinetobacter baumannii, Klebsiella pneumoniae, Escherichia coli, and Pseudomonas aeruginosa, and has a specificity of 100%.

[0053] The Brucella droplet digital PCR detection method provided by the present invention is simple to operate, has a wide linear range, a low detection limit, good repeatability, and high sensitivity, can detect a single copy in a sample, and achieve absolute quantification of the sample.

[0054] The kit for detecting Brucella provided by the present invention has a simple composition, can accurately detect Brucella in a sample, has high accuracy, good specificity, and has good clinical application prospects and high economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 This is the linear regression result of gradient dilution for Brucella detection in the experimental example.

[0056] Figure 2 This is the original FAM scatter plot of L1-L7 in the experimental example.

[0057] Figure 3 These are the original result images of S1 and S7 in the experimental example.

[0058] Figure 4These are the original result images of strong positive (J1) and weak positive (J2) in the experimental example.

[0059] In order to more clearly illustrate the technical solution to be protected by the present invention, the drawings in the embodiments or experimental examples are briefly introduced above. It should be understood that the above drawings should not be regarded as any limitation on the protection scope of the present invention. For ordinary technicians in this field, other related drawings can also be obtained based on these drawings without paying creative work. DETAILED DESCRIPTION

[0060] The technical solution of the present invention will be clearly and completely explained below in conjunction with specific embodiments and experimental examples.

[0061] Those skilled in the art should understand that the following embodiments and experimental examples are only used to illustrate the technical solutions and technical effects of the present invention and should not be regarded as any limitation on the protection scope of the present invention. Based on the following embodiments, other technical solutions obtained by those skilled in the art without creative work, such as technical solutions obtained after modification, deformation or simple replacement, all belong to the protection scope of the present invention.

[0062] The raw materials, reagents, and equipment used in the examples or experimental examples are all commercially available unless otherwise specified. DNA polymerase Mix was purchased from Xinyi Manufacturing Technology (Beijing) Co., Ltd., and primers, probes, exogenous quality control products, critical positive control products, etc. were commissioned to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for synthesis. The microdroplet digital PCR instrument is Digital PCR System (Xinyi Digital PCR System) was purchased from Xinyi Manufacturing Technology (Beijing) Co., Ltd.

[0063] Example 1

[0064] This embodiment provides a new specific target gene for detecting Brucella - recA gene fragment, the nucleotide sequence of which is as follows:

[0065] CATGAGCCAGGCGCTGCGCAAGCTTACTGGCTCCATTTCCCGTTCAAACTGCATGGTG

[0066] ATCTTCATCAACCAGATCCGCATGAAGATCGGTGTCATGTTCGGCTCGCCGGAAACGA

[0067] CAACGGGCGGCAATGCGCTCAAGTTCTATGCTTCGGTTCGCCTCGATATTCGCCGTAT

[0068] CGGCTCCATCAAGGAGCGCGACGAAGTGGTGGGCAACCAGACCCGCGTGAAGGTGG

[0069] TGAAGAACAAGCTCGCTCCTCCGTTCAAGCAGGTCGAATTCGATATCATGTATGGCGCGGGCGTTTCCAAGGTGGGCGAGCTGGTCGATCTTGGTGTC (SEQ ID NO: 1).

[0070] This embodiment also provides new uses of the recA gene fragment, including one or more of the following:

[0071] (1) Application of recA gene fragment in preparing primers for detecting Brucella;

[0072] (2) Application of recA gene fragment in the preparation of primer probe set for detecting Brucella;

[0073] (3) Application of recA gene fragment in the preparation of a kit for detecting Brucella.

[0074] This embodiment also provides a primer for detecting Brucella, which is designed and synthesized according to the recA gene fragment, including:

[0075] Upstream primer Bru-F: 5′-CTCGCCGGAAACGACAACG-3′ (SEQ ID NO: 3);

[0076] Downstream primer Bru-R: 5'-GTTGCCCACCACTTCGT-3' (SEQ ID NO: 4);

[0077] The nucleotide sequence of the region amplified by the above primers is as follows:

[0078] CTCGCCGGAAACGACAACGGGCGGCAATGCGCTCAAGTTCTATGCTTCGGTTCGCCT CGATATTCGCCGTATCGGCTCCATCAAGGAGCGCGACGAAGTGGTGGGCAAC (SEQ ID NO: 2).

[0079] This embodiment also provides a primer probe set for detecting Brucella, which includes, in addition to the above primers, a probe for detecting a recA gene fragment, as shown below:

[0080] Probe Bru-P: 5'-FAM-CGGCAATGCGCTCAAGTTCTATGCT-BHQ1-3' (SEQ ID NO: 5).

[0081] This embodiment also provides a kit for detecting Brucella, which includes, in addition to the above-mentioned primers and probes (or primer probe sets), DNA polymerase Mix (provided in the form of a reaction premix), exogenous quality control products, droplet generation chips, droplet generation oil, droplet detection chips, droplet detection oil, etc.

[0082] The exogenous quality control products include a plasmid recombined with an octopus mitochondrial COX gene fragment (the vector plasmid is PUC57, synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.), exogenous quality control primers and exogenous quality control probes, as shown below:

[0083] Octopus mitochondrial COX gene fragment:

[0084] ATGGCGCTGGACTCCGCAGATCAGCATCTCAGACATGTTGAAAAGGATGTTTTTATTC

[0085] CTAAAATAATGAGAGAAAAGGCCAGACAGAGGTGTTTTGAACAAGTTCAAGATTTCA

[0086] CCAAATGTTGCAAAGACTCTGGAATACTAATGGTAATAAAGTGTGGGAAAGAAAATT

[0087] CTGCATTGAAAGAATGCTTAATTCCTTACTATAATGATCCAGCATTTTATGAAGAATATAAAATGGAATACCTGAAAGAAAGGGAAGATTTCTGA (SEQ ID NO: 6);

[0088] Upstream primer PC-F: 5′-GGCCAGACAGAGGTGTTT-3′ (SEQ ID NO: 7);

[0089] Downstream primer PC-R: 5′-GGAATTAAGCATTCTTTCAATGCAG-3′ (SEQ ID NO: 8);

[0090] Probe PC-P: 5'-VIC-TCACCAAATGTTGCAAAGACTCTGGA-BHQ1-3' (SEQ ID NO: 9).

[0091] The critical positive control substance is a plasmid (the vector plasmid is PUC57, synthesized by Beijing Tianyi Huiyuan Biotechnology Co., Ltd.) recombinant with a recA gene fragment (the nucleotide sequence is shown in SEQ ID NO: 1).

[0092] Example 2

[0093] This embodiment provides a Brucella microdroplet digital PCR detection method, comprising the following steps:

[0094] (1) Extract DNA from the tissue sample to be tested and store it at -20°C for future use;

[0095] (2) Prepare an aqueous reaction system with the following composition: 0.5 μL template DNA, 7.5 μL DNA polymerase Mix, 2.4 μL each of 10 μM upstream and downstream primers, 0.75 μL of 10 μM probe, add sterile double deionized water to 30 μL, mix thoroughly and set aside;

[0096] (3) adding 30 μL of the aqueous phase reaction system to the aqueous phase solution well of the droplet generation chip, adding 180 μL of the droplet generation oil to the oil phase solution well, and placing the droplet generation chip in a droplet preparation instrument to generate droplets;

[0097] (4) The generated droplets were subjected to PCR reaction. The reaction procedure was as follows: 95°C for 10 min; 94°C for 30 s, 60°C for 60 s, 40 cycles; and maintained at 12°C. After the reaction, droplet detection was performed. The judgment criteria are shown in Table 1. The detection results were as follows: the detection concentration of the recA gene was greater than 10 copies / system, and the sample was judged to be positive.

[0098] Table 1 Results judgment criteria of Brucella droplet digital PCR detection method

[0099]

[0100] In Table 1, the threshold value (i.e., cutoff value) of positive judgment of Brucella recA gene detection was determined by using the critical positive control through the statistical method ROC curve.

[0101] Experimental Example 1

[0102] 1. Screening of specific target genes

[0103] The conserved sequence of Brucella recA gene was selected for primer and probe design. The corresponding whole genome sequence was first found in Genebank (www.ncbi.nlm.nih.gov), and homology analysis and sequence analysis were performed using Blast to obtain the highly conserved sequence of Brucella recA gene (as shown in SEQ ID NO: 1). Beijing Tianyi Huiyuan Biotechnology Co., Ltd. was commissioned to synthesize DNA plasmids, and the highly conserved sequence of recA gene was cloned into the PUC57 vector plasmid. It was used as the target gene fragment for detection, and the design and screening of Brucella detection primers and probes were carried out. The screening results are shown in Table 2 below.

[0104] 2. Screening of exogenous quality control products

[0105] The conserved sequence of octopus mitochondrial COX gene was selected for primer and probe design. The corresponding whole genome sequence was first found in Genebank, and homology analysis and sequence analysis were performed using Blast to obtain a highly conserved sequence of octopus mitochondrial COX gene (as shown in SEQ ID NO: 6). Beijing Tianyi Huiyuan Biotechnology Co., Ltd. was commissioned to synthesize DNA plasmids, and the conserved sequence of octopus mitochondrial COX gene was cloned into the PUC57 vector plasmid (which can be used as an exogenous quality control product, and the target fragment is introduced at the EcoRI / HindIII restriction site), and the design and screening of exogenous quality control primers and probes were carried out. The screening results are shown in Table 2 below.

[0106] Table 2 Brucella detection primers and probes, exogenous quality control primers and probes

[0107]

[0108] Experimental Example 2: Detection System Performance Verification

[0109] 1. Linear verification

[0110] The strong positive calibration reference (synthesized externally) was diluted in series (the dilution gradient was 10 0 , 10 -1 , 10 -2 , 10 -3 , 5×10 -4 , 2.5×10 -4 , 10 -4 100 copies / reaction, 7 gradients in total, each dilution was repeated at least 3 times), and the linearity of the Brucella detection method was verified according to the method of Example 2. The results are shown in Table 3 and Figure 1-2 The theoretical value is calculated as follows: copies / mL (copy number) = (6.2×10(23) copies / mole)×(concentration) / (MWg / mol).

[0111] Table 3 Linearity verification results

[0112]

[0113] From Table 3 and Figure 1-2 It can be seen that the Brucella reference material was gradient diluted by the digital PCR instrument, and the theoretical values ​​and measured values ​​of each Brucella concentration were subjected to linear regression analysis. The slope a of the linear regression curve was 1.0009, and the linear correlation coefficient R2 was 0.9998, which met the requirements.

[0114] 2. Verification of minimum detection limit

[0115] The standard product (L-6 in Table 3) was used to perform the test according to the method of Example 2. The test was repeated 20 times. The results are shown in Tables 4 and Figure 3 shown.

[0116] Table 4 Results of 20 repeated tests on the minimum detection limit of clinical S

[0117]

[0118] From Table 4 and Figure 3 It can be seen that the clinical S test with the lowest detection limit of Brucella was completed by digital PCR, and the positive rate was 100% after 20 repetitions, which met the requirements.

[0119] 3. Specificity verification

[0120] The specificity of the Brucella detection method was verified by performing specificity evaluation on other common pathogen samples (not within the target of the kit), and the detection was performed according to the method of Example 2, with 3 cases of each pathogen. Other pathogen samples included Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Acinetobacter baumannii, and the results are shown in Table 5 below.

[0121] Table 5 Specificity verification results

[0122]

[0123] As can be seen from Table 5, 15 pathogen samples were tested by digital PCR, and the results were all negative, meeting the requirements.

[0124] 4. Repeatability verification

[0125] The repeatability of the Brucella detection method was verified by performing repeatability tests on medium-strong positive samples (L-3 in Table 3) and weak positive samples (L-4 in Table 3). The detection was performed according to the method of Example 2, and each sample was repeatedly tested at least 8 times. The results are shown in Tables 6 and 7. Figure 4 shown.

[0126] Table 6 Repeatability verification results

[0127]

[0128]

[0129] From Table 6 and Figure 4 It can be seen that the 8 test results of the strong positive samples and the weak positive samples were all positive, and the coefficient of variation CV≤10%, which met the requirements.

[0130] 5. Limit of Blank (LOB) Verification

[0131] 20 pathogen-negative samples were collected for blank detection limit verification and tested according to the method of Example 2. The results are shown in Table 7 below.

[0132] Table 7 Blank detection limit verification results

[0133]

[0134]

[0135] It can be seen from Table 7 that the test results of the 20 pathogen-negative samples were all negative, which met the requirements.

[0136] It can be seen from the above experimental results that the Brucella microdroplet digital PCR detection method provided by the present invention can accurately detect Brucella in clinical samples, and has no cross reaction with Staphylococcus aureus, Acinetobacter baumannii, Klebsiella pneumoniae, Escherichia coli, and Pseudomonas aeruginosa, and the specificity is 100%. At the same time, the detection method has a wide linear range, a low detection limit, good repeatability, and high sensitivity. It can detect a single copy in a sample and achieve absolute quantification of the sample, and has good clinical application prospects and high economic value.

[0137] Although the technical solution of the present invention has been described in detail above with general descriptions, specific implementation methods and experimental examples, it should be noted that the embodiments and experimental examples are only used to illustrate the technical solution and technical effects of the present invention, and should not be regarded as any limitation on the protection scope of the present invention. Simple deformation, modification or improvement based on the technical concept of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. Application of recA gene fragment, characterized in that: The application includes but is not limited to one or more of the following aspects: (1) Application of recA gene fragment in preparing primers for detecting Brucella; (2) Application of recA gene fragment in the preparation of primer probe set for detecting Brucella; (3) Application of recA gene fragment in the preparation of a kit for detecting Brucella; The nucleotide sequence of the recA gene fragment is shown in SEQ ID NO:

1.

2. A primer for detecting Brucella, characterized in that: The primers are designed and synthesized according to the recA gene fragment, and the nucleotide sequence of the recA gene fragment is shown in SEQ ID NO:

1.

3. The primer according to claim 2, characterized in that: The primers include: Upstream primer Bru-F: 5′-CTCGCCGGAAACGACAACG-3′; Downstream primer Bru-R: 5′-GTTGCCCACCACTTCGT-3′.

4. A primer probe set for detecting Brucella, characterized in that: The primer probe set comprises the primers for detecting the recA gene fragment as claimed in claim 2 or 3, and the probe for detecting the recA gene fragment, wherein the probe is designed and synthesized according to the recA gene fragment, and the nucleotide sequence of the recA gene fragment is shown in SEQ ID NO:

1.

5. The primer probe set according to claim 4, characterized in that: The probe is: Probe Bru-P: 5′-FAM-CGGCAATGCGCTCAAGTTCTATGCT-BHQ1-3′.

6. A test kit for detecting Brucella, characterized in that: The kit includes any one of the following components: (1) A primer for detecting Brucella as claimed in claim 2 or 3; (2) A primer probe set for detecting Brucella as described in claim 4 or 5.

7. The kit according to claim 6, characterized in that: The kit may further comprise one or more of the following components: (1) DNA polymerase Mix; (2) Exogenous quality control products; (3) critical positive control; (4) Droplet generation chip; (5) Droplet generation of oil; (6) Droplet detection chip; (7) Droplet detection oil.

8. The kit according to claim 7, characterized in that: The exogenous quality control products include a plasmid recombined with an octopus mitochondrial COX gene fragment, an exogenous quality control primer and an exogenous quality control probe; The nucleotide sequence of the octopus mitochondrial COX gene fragment is shown in SEQ ID NO: 6; The exogenous quality control primers and exogenous quality control probes are: Upstream primer PC-F: 5′-GGCCAGACAGAGGTGTTT-3′; Downstream primer PC-R: 5′-GGAATTAAGCATTCTTTCAATGCAG-3′; Probe PC-P: 5′-VIC-TCACCAAATGTTGCAAAGACTCTGGA-BHQ1-3′.

9. A Brucella microdroplet digital PCR detection method, characterized in that: The method comprises the following steps: (1) Using the sample DNA to be tested as a template, mixing with the primer probe set and DNA polymerase Mix as described in claim 4 or 5 to prepare a reaction system; (2) mixing the reaction system with a droplet-generating oil to prepare droplets; (3) Taking a droplet to perform a PCR reaction, and then performing a droplet detection to obtain a detection result.

10. The detection method according to claim 9, characterized in that: In step (1), the reaction system is composed of: 0.5 μL template DNA, 7.5 μL DNA polymerase Mix, 2.4 μL each of 10 μM upstream and downstream primers, 0.75 μL 10 μM probe, and sterile double deionized water to 30 μL; And / or, in step (2), the preparation of microdroplets comprises: taking 30 μL of the reaction system and 180 μL of microdroplet generation oil, and generating microdroplets in a microdroplet preparation instrument; And / or, in step (3), the PCR reaction program is: 95°C for 10 min; 94°C for 30 s, 60°C for 60 s, 40 cycles; maintain at 12°C.

Images