SNP (Single Nucleotide Polymorphism) molecular marker related to cotton boll length character and application of SNP molecular marker

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) molecular marker related to a cotton boll length character and application of the SNP molecular marker, and relates to the technical field of plant genetic engineering. The nucleotide sequence of the SNP molecular marker is one or a combination of more of SEQ ID NO.13-24. The SNP molecular marker related to the cotton boll length character of the upland cotton can be used for early prediction of the cotton boll length character of the cotton, identification and screening of high-yield cotton variety resources and improvement of the cotton boll length character of the cotton, and has a wide application prospect; the method is directly expressed in the form of DNA, can be used for detection in each tissue and development stage of cotton, is not limited by environment and seasons, is not influenced by the problems of expression and the like, does not need to analyze the length of a fragment, only needs + / -analysis, and is suitable for rapid, high-throughput and automatic screening.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a SNP molecular marker related to cotton boll length traits and an application thereof. Background Art

[0002] Cotton is an important economic crop in my country. Studies have shown that the length of cotton bolls is closely related to yield (Chen Quanqiu et al., 2013). Faced with the situation of declining yield and increasing demand, the length of cotton bolls has become one of the important target traits for breeders to improve.

[0003] Genome-wide association study (GWAS) is a method of scanning variation information across the entire genome. It is based on linkage disequilibrium (LD) to identify the relationship between target traits and genetic markers within a population, and then screen single nucleotide polymorphism (SNP) variation sites related to phenotypes (Wang et al., 2018). SNP refers to the diversity of DNA sequences caused by the variation of a single nucleotide at the genome level. It is numerous and rich in polymorphism. SNP variation is the most abundant genetic variation in the genome and is almost distributed throughout the entire genome. In addition, linkage disequilibrium (LD) refers to the frequency of simultaneous inheritance of two genes in a population being greater than the frequency of random combination. The two genomes are considered to be in a state of linkage disequilibrium. It is the basis and premise of GWAS and determines the accuracy of genome-wide association analysis, the density of markers, and the accuracy of analysis results. The degree of linkage disequilibrium (LD) in a population is affected by both genetic and non-genetic factors such as recombination, mutation, and genetic drift. Among these factors, recombination and mutation are the most important. Recombination breaks the linkage relationship between sites and reduces the degree of linkage disequilibrium, while mutation produces new genetic variation, causing new linkage disequilibrium within the population (Lu Qing, 2016). Generally speaking, the degree of genetic diversity of a population has a significant impact on the level of linkage disequilibrium. The richer the genetic diversity of a population and the more types of variation, the lower the level of linkage disequilibrium.

[0004] Genetic markers are an effective means of expressing genetic variation, and there are four main types: morphological markers, cytological markers, biochemical markers, and molecular markers. DNA molecular markers reflect genetic variation at the DNA level. Compared with other genetic markers, they have obvious advantages such as large number, high polymorphism, neutral expression, partial co-dominance, and no environmental influence. Molecular marker technology is widely used in the construction of genetic linkage maps of major crops and other herbaceous plants, and on this basis, studies on the location of quantitative trait genes have been conducted (Chen et al. 2014b; Guo et al., 2014; Guan et al., 2014; Griffiths et al., 2013; Hashida et al., 2013; Liu et al., 2014b; Singh et al., 2013; Taye et al., 2013; Zhao et al., 2014; Zheng et al., 2013). Several molecular marker technologies are often used together to complement each other, covering different parts of the genome and obtaining more markers. It is foreseeable that DNA molecular marker technology will play a greater role in plant genetic research. However, in the prior art, there are few SNP molecular markers related to cotton boll length traits. Therefore, we provide a SNP molecular marker related to cotton boll length traits and its application. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker related to cotton boll length trait and its application in order to solve the above problems.

[0006] The present invention achieves the above-mentioned purpose through the following technical solutions: The present invention provides a SNP molecular marker related to cotton boll length trait, wherein the nucleotide sequence of the SNP molecular marker is one or more combinations of SEQ ID NO.13-24; The nucleotide sequence of the SNP molecular marker A07-90411001 is shown in SEQ ID NO. 13 or 14. The SNP site of the molecular marker is located at the 90411001 base on chromosome 7 of cotton, which is A / T; The nucleotide sequence of the SNP molecular marker A07-90424258 is shown in SEQ ID NO. 15 or 16. The SNP site of the molecular marker is located at the 90424258th base on chromosome 7 of cotton, which is G / C; The nucleotide sequence of the SNP molecular marker A07-90438244 is shown in SEQ ID NO. 17 or 18. The SNP site of the molecular marker is located at the 90438244th base on chromosome 7 of cotton, which is A / G; The nucleotide sequence of the SNP molecular marker A07-90510034 is shown in SEQ ID NO. 19 or 20. The SNP site of the molecular marker is located at the 90510034th base on chromosome 7 of cotton, which is A / G; The nucleotide sequence of the SNP molecular marker A07-90514527 is shown in SEQ ID NO. 21 or 22. The SNP site of the molecular marker is located at the 90514527th base on chromosome 7 of cotton, which is G / A; The nucleotide sequence of the SNP molecular marker A07-90515003 is shown in SEQ ID NO. 23 or 24. The SNP site of the molecular marker is located at the 90515003rd base on chromosome 7 of cotton, which is C / T; Among them, the location of the SNP site is based on the genome version number Gossypium_hirsutum / CRI-TM1 on cotton chromosome A07.

[0007] The present invention also provides an application of the above-mentioned SNP molecular marker related to the cotton boll length trait in early prediction and screening of cotton boll length.

[0008] As a further optimization scheme of the present invention, when the SNP site of the SNP molecular marker A07-90411001 is located on the 90411001st base on the 7th chromosome of cotton and is A, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90411001 is located on the 90411001st base on the 7th chromosome of cotton and is T, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90424258 is located on the chromosome 7 of cotton and the base at position 90424258 is G, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90424258 is located on the chromosome 7 of cotton and the base at position 90424258 is C, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90438244 is located on the chromosome 7 of cotton and the base at position 90438244 is A, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90438244 is located on the chromosome 7 of cotton and the base at position 90438244 is G, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90510034 is located on the chromosome 7 of cotton and the base at position 90510034 is A, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90510034 is located on the chromosome 7 of cotton and the base at position 90510034 is G, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90514527 is located on the chromosome 7 of cotton and the base at position 90514527 is G, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90514527 is located on the chromosome 7 of cotton and the base at position 90514527 is A, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90515003 is located on the 90515003rd base of the cotton chromosome 7 and is C, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90515003 is located on the 90515003rd base of the cotton chromosome 7 and is T, it is a cotton variety with short bolls; Among them, the location of the SNP site is based on the genome version number Gossypium_hirsutum / CRI-TM1 on cotton chromosome A07.

[0009] The present invention also provides a method for detecting the cotton boll length trait using the SNP molecular markers associated with the cotton boll length trait as described above, comprising the following steps: Extracting DNA from cotton to be tested; Using the sequence containing the site where the SNP molecular marker is located and its upstream and downstream bases as an amplification template, PCR amplification is performed using primers that verify the SNP molecular marker to obtain an amplification product containing the site where the SNP molecular marker is located; The amplified products were subjected to genotyping detection to obtain the SNP molecular marker type of the cotton variety to be tested.

[0010] As a further optimization scheme of the present invention, in step (2), the primers for verifying the SNP molecular marker are specifically as follows: A07-90411001-F: SEQ ID NO.1: ATATCATAACAAACACAAACCTTCA; A07-90411001-R: SEQ ID NO.2: TGTTGGATTATTGCAGTGAAGAA; A07-90424258-F: SEQ ID NO.3: CTTCGGCTGCAGCTGCTGCCA; A07-90424258-R: SEQ ID NO.4:ACAGGCCAGTCAATGTCGGC; A07-90438244-F: SEQ ID NO.5: CCTCACTTTGTTATAGCTCTTATAG; A07-90438244-R: SEQ ID NO.6: CTAACTCTACCTATCTCTATGGCA; A07-90510034-F: SEQ ID NO.7: ATTTATTATTTTTAATTTGTGTTTTGTGG; A07-90510034-R: SEQ ID NO.8: TCTTCGCATTCACCTTGATATG; A07-90514527-F: SEQ ID NO.9: ACACAAGTACAGTATGACAGCCT; A07-90514527-R: SEQ ID NO.10: TGGAGAGGGCTGCTGCAGAG; A07-90515003-F: SEQ ID NO.11: TCTCTAGTAGCCCTTTCAACAGCT; A07-90515003-R: SEQ ID NO. 12: AAAGCAAGAGAGATTGGAGCGC.

[0011] As a further optimization scheme of the present invention, in step (3), the types of SNP molecular markers are specifically as follows: SNP molecular marker A07-90411001: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is T type, it is a short-boll variety of cotton; SNP molecular marker A07-90424258: If the SNP molecular marker type is G type, it is a long-boll variety of cotton; if the SNP molecular marker type is C type, it is a short-boll variety of cotton; SNP molecular marker A07-90438244: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is G type, it is a short-boll variety of cotton; SNP molecular marker A07-90510034: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is G type, it is a short-boll variety of cotton; SNP molecular marker A07-90514527: If the SNP molecular marker type is G type, it is a long-boll variety of cotton; if the SNP molecular marker type is A type, it is a short-boll variety of cotton; SNP molecular marker A07-90515003: If the SNP molecular marker type is C type, it is a long-boll cotton variety; if the SNP molecular marker type is T type, it is a short-boll cotton variety.

[0012] The beneficial effects of the present invention are: The SNP molecular markers related to the boll length trait of upland cotton provided by the present invention can be used for early prediction of the boll length trait of cotton, identification and screening of high-yield cotton variety resources, and improvement of the boll length trait of cotton, and have broad application prospects; The SNP molecular markers related to the boll length trait of upland cotton provided by the present invention are directly expressed in the form of DNA, can be detected in various tissues and developmental stages of cotton, are not restricted by the environment and season, are not affected by issues such as expression, and do not need to analyze the length of the fragment, only + / - (positive / negative) analysis is required, which is suitable for rapid, high-throughput, and automated screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Upland cotton ( Gossypium hirsutum L.) Results of genome-wide association analysis of cotton boll length traits [the horizontal axis represents the position on the chromosome (Mb), the genome version is Gossypium_hirsutum / CRI-TM1, the ordinate represents the significance of SNP site association, expressed as -log10 (P-value)].

[0014] Figure 2 This is the result of the significant analysis of the two bases at six SNP sites in the germplasm resources using SPSS software ( Figure 2 a is the comparison result of boll length of germplasm resources at SNP site A07-90411001; Figure 2 b is the comparison result of boll length of germplasm resources at SNP locus A07-90424258; Figure 2 c is the comparison result of boll length of germplasm resources at SNP site A07-90438244; Figure 2 d is the comparison result of boll length of germplasm resources at SNP site A07-90510034; Figure 2 e is the comparison result of boll length of germplasm resources at SNP site A07-90514527; Figure 2 f is the comparison result of boll length of germplasm resources at SNP site A07-90515003), P<0.001. DETAILED DESCRIPTION

[0015] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0016] 1. Materials The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0017] 2. Methods 2.1 Upland cotton ( Gossypium hirsutum L . ) Cotton boll length survey A field trial was conducted using 419 cotton core germplasm resources at the Cotton Research Institute of Shihezi University in an area of ​​5.25m 2 There were 6 rows in each area, with a row spacing of 0.25m, a plant spacing of 0.15m, an observation path of 0.5m, an isolation path of 0.5m, and 50 plants in each repetition. The experiment adopted a completely randomized block design with 3 repetitions and normal field cultivation management. Three plants were randomly selected from each cotton material under each natural environment, and the lengths of the three bolls in the middle and lower parts of the inner boll were measured on each plant, and the average length (mm) was calculated.

[0018] 2.2 SNP detection (Ma et al., 2018) High-quality clean data was obtained by sequencing 419 cotton materials, with a data volume of 6.35Tb, accounting for about 5.7% of 7362 upland cotton materials. About 99.56% of the reads covered 92.20% of the reference genome, with an average depth of 6.55 times. Valid original DNA sequence data was obtained by using Base Calling analysis and low-quality base filtering; valid high-quality sequencing data was aligned to the cotton reference genome by BWA software, and the alignment results were removed by SAMTOOLS to obtain valid high-quality sequences of samples; GATK software was used to detect population SNPs; the Bayesian model was used to detect polymorphic sites in the population, and the GATK result SNPs were filtered to obtain 3665030 high-quality SNPs; in the coding region, 47995 (accounting for 1.3% of the total) non-synonymous mutations, 364 splicing, 210 stop losses and 1050 stop gain SNPs were annotated, which led to amino acid changes, transcript extension or premature stop.

[0019] 2.3 Genome-wide association analysis of boll length traits in upland cotton The whole genome scanning (GWAS) positioning of upland cotton boll length trait, the upland cotton boll length trait results obtained in step 1 and the genotype data obtained in step 2 were statistically analyzed using the mixed linear model of the genome-wide efficient mixed-model association (GEMMA) statistical analysis software. For details, please refer to (http: / / www.xzlab.org / software.html).

[0020] The statistical model is: y = Xα + Zβ + Wμ + e; y is the phenotypic trait, X is the indicator matrix of fixed effects, α is the estimated parameter of fixed effects; Z is the indicator matrix of SNPs, β is the effect of SNPs; W is the indicator matrix of random effects, μ is the predicted random individual, e is the random residual, and obeys e~(0,δe2).

[0021] Analysis results: In this model, by adding the kinship matrix to μ to correct the population analysis, it was found that a total of 6 SNPs were significantly associated with the boll length trait of upland cotton, all located in the gene coding region (CDS). The sequences of the 6 SNP sites are shown in SEQ ID NO.13-24, the reference sequence is the upland cotton standard line TM-1, and the reference genome version number is Gossypium_hirsutum / CRI-TM1 (https: / / www.cottongen.org / species / Gossypium_ hirsutum / CRI-TM1), the allele loci information of the 6 SNP markers is shown in Table 1: Table 1 SNP loci associated with upland cotton boll length: ; 2.4 Verification The effects of the above SNPs were verified using the BLUP values ​​(best linear unbiased prediction value) of boll length in 419 core cotton germplasms under multi-year and multi-site environments. Figure 2As shown, there is a significant association between the 6 SNP sites and the cotton boll length trait; specifically, for SNP site A07:90411001, the boll length of cotton with genotype A is significantly longer than that of cotton with genotype T; for SNP site A07:90424258, the boll length of cotton with genotype G is longer than that of cotton with genotype C; similarly, for SNP sites A07:90438244 and SNP site A07:90510034, the boll length of cotton with genotype A is significantly longer than that of cotton with genotype G; for SNP site A07:90514527, the boll length of cotton with genotype G is significantly longer than that of cotton with genotype A; for SNP site A07:90515003, the boll length of cotton with genotype C is significantly longer than that of cotton with genotype T. It is noteworthy that all these SNP sites are located in the coding region of the gene.

[0022] 3 Development of SNP molecular markers and detection of cotton boll length based on SNP loci Based on the conclusions obtained in step 2.4 above, the six SNPs all showed significant effects on the variation of cotton boll length traits. Specific primers were designed for the sequence differences of the SNP sites and developed into SNP molecular markers. The nucleotide sequences of the specific primers are shown in SEQ ID NO.1-12 and Table 2: Table 2 Specific primer sequences ; The method for detecting cotton boll length using SNP molecular markers related to cotton boll length comprises the following steps: (1) Extracting DNA from cotton to be tested; Using the sequence containing the site where the SNP molecular marker is located and its upstream and downstream bases as an amplification template, PCR amplification is performed using primers that verify the SNP molecular marker to obtain an amplification product containing the site where the SNP molecular marker is located; Perform genotyping detection on the amplified product to obtain the SNP molecular marker type of the cotton variety to be tested; The specific types of SNP molecular markers are as follows: SNP molecular marker A07-90411001: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is T type, it is a short-boll variety of cotton; SNP molecular marker A07-90424258: If the SNP molecular marker type is G type, it is a long-boll variety of cotton; if the SNP molecular marker type is C type, it is a short-boll variety of cotton; SNP molecular marker A07-90438244: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is G type, it is a short-boll variety of cotton; SNP molecular marker A07-90510034: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is G type, it is a short-boll variety of cotton; SNP molecular marker A07-90514527: If the SNP molecular marker type is G type, it is a long-boll variety of cotton; if the SNP molecular marker type is A type, it is a short-boll variety of cotton; SNP molecular marker A07-90515003: If the SNP molecular marker type is C type, it is a long-boll cotton variety; if the SNP molecular marker type is T type, it is a short-boll cotton variety.

[0023] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A SNP molecular marker related to cotton boll length trait, characterized in that: The nucleotide sequence of the SNP molecular marker is one or more combinations of SEQ ID NO.13-24; The positions of the SNP sites of the SNP molecular markers are all based on the cotton A07 chromosome in the genome version number Gossypium_hirsutum / CRI-TM1, as follows: The nucleotide sequence of A07-90411001 is shown in SEQ ID NO.13 / 14, and the base at position 90411001 is A / T; The nucleotide sequence of A07-90424258 is shown in SEQ ID NO.15 / 16, and the base at position 90424258 is G / C; The nucleotide sequence of A07-90438244 is shown in SEQ ID NO. 17 / 18, and the base at position 90438244 is A / G; The nucleotide sequence of A07-90510034 is shown in SEQ ID NO. 19 / 20, and the base at position 90510034 is A / G; The nucleotide sequence of A07-90514527 is shown in SEQ ID NO.21 / 22, and the base at position 90514527 is G / A; The nucleotide sequence of A07-90515003 is shown in SEQ ID NO.23 / 24, and the base at position 90515003 is C / T.

2. Use of the SNP molecular marker associated with cotton boll length trait as claimed in claim 1 in detecting cotton boll length trait.

3. The use according to claim 2, characterized in that: When the SNP site of the SNP molecular marker A07-90411001 is located on the 90411001st base of the cotton chromosome 7 and is A, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90411001 is located on the 90411001st base of the cotton chromosome 7 and is T, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90424258 is located on the chromosome 7 of cotton and the base at position 90424258 is G, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90424258 is located on the chromosome 7 of cotton and the base at position 90424258 is C, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90438244 is located on the chromosome 7 of cotton and the base at position 90438244 is A, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90438244 is located on the chromosome 7 of cotton and the base at position 90438244 is G, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90510034 is located on the chromosome 7 of cotton and the base at position 90510034 is A, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90510034 is located on the chromosome 7 of cotton and the base at position 90510034 is G, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90514527 is located on the chromosome 7 of cotton and the base at position 90514527 is G, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90514527 is located on the chromosome 7 of cotton and the base at position 90514527 is A, it is a cotton variety with short bolls; When the SNP site of the SNP molecular marker A07-90515003 is located on the 90515003rd base of the cotton chromosome 7 and is C, it is a cotton variety with long bolls; when the SNP site of the SNP molecular marker A07-90515003 is located on the 90515003rd base of the cotton chromosome 7 and is T, it is a cotton variety with short bolls; The location of the SNP locus is based on the cotton chromosome A07 in the genome version number Gossypium_hirsutum / CRI-TM1.

4. A method for detecting the cotton boll length trait using the SNP molecular marker associated with the cotton boll length trait as claimed in claim 1, characterized in that: The following steps are involved: (1) Extracting DNA from cotton to be tested; (2) using a sequence containing the site where the SNP molecular marker is located and its upstream and downstream bases as an amplification template, and performing PCR amplification using primers for verifying the SNP molecular marker to obtain an amplification product containing the site where the SNP molecular marker is located; (3) Perform genotyping detection on the amplified products to obtain the SNP molecular marker type of the cotton variety to be tested.

5. The method according to claim 4, characterized in that In step (2), the primers for verifying the SNP molecular markers are specifically as follows: A07-90411001-F: SEQ ID NO.1: ATATCATAACAAACACAAACCTTCA; A07-90411001-R: SEQ ID NO.2: TGTTGGATTATTGCAGTGAAGAA; A07-90424258-F: SEQ ID NO.3: CTTCGGCTGCAGCTGCTGCCA; A07-90424258-R: SEQ ID NO.4:ACAGGCCAGTCAATGTCGGC; A07-90438244-F: SEQ ID NO.5: CCTCACTTTGTTATAGCTCTTATAG; A07-90438244-R: SEQ ID NO.6: CTAACTCTACCTATCTCTATGGCA; A07-90510034-F: SEQ ID NO.7: ATTTATTATTTTTAATTTGTGTTTTGTGG; A07-90510034-R: SEQ ID NO.8: TCTTCGCATTCACCTTGATATG; A07-90514527-F: SEQ ID NO.9: ACACAAGTACAGTATGACAGCCT; A07-90514527-R: SEQ ID NO.10: TGGAGAGGGCTGCTGCAGAG; A07-90515003-F: SEQ ID NO.11: TCTCTAGTAGCCCTTTCAACAGCT; A07-90515003-R: SEQ ID NO. 12: AAAGCAAGAGAGATTGGAGCGC.

6. The method according to claim 4, characterized in that In step (3), the SNP molecular marker types are specifically as follows: SNP molecular marker A07-90411001: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is T type, it is a short-boll variety of cotton; SNP molecular marker A07-90424258: If the SNP molecular marker type is G type, it is a long-boll variety of cotton; if the SNP molecular marker type is C type, it is a short-boll variety of cotton; SNP molecular marker A07-90438244: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is G type, it is a short-boll variety of cotton; SNP molecular marker A07-90510034: If the SNP molecular marker type is A type, it is a long-boll variety of cotton; if the SNP molecular marker type is G type, it is a short-boll variety of cotton; SNP molecular marker A07-90514527: If the SNP molecular marker type is G type, it is a long-boll variety of cotton; if the SNP molecular marker type is A type, it is a short-boll variety of cotton; SNP molecular marker A07-90515003: If the SNP molecular marker type is C type, it is a long-boll cotton variety; if the SNP molecular marker type is T type, it is a short-boll cotton variety.

Images