Colorectal cancer related viroid detection primer group, kit and application

Abstract

The invention relates to a colorectal cancer related viroid detection primer group, a kit and application, and belongs to the technical field of molecular biology. The primer group comprises a Divergent primer group and a Convergent primer group, and the primer group comprises a Divergent primer group and a Convergent primer group; the Divergent primer group comprises an upstream primer Divergent-CCAV-F and a downstream primer Divergent-CCAV-R, and the upstream primer Divergent-CCAV-F and the downstream primer Divergent-CCAV-R are used as primers of the Divergent primer group; and the Convergent primer group comprises an upstream primer Convergent-CCAV-F and a downstream primer Convergent-CCAV-R. The invention also discloses a kit for detecting the content of the CCAV-F. The invention also discloses a kit for detecting the content of the CCAV-F. The primer group disclosed by the invention is high in specificity, convenient and rapid to use, capable of rapidly detecting CCAV and easy to popularize and apply.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a detection primer set, a kit and an application of a colorectal cancer-related viroid. Background Art

[0002] Colorectal cancer is a common malignant tumor in the gastrointestinal tract. The early symptoms are not obvious. As the tumor grows, symptoms such as changes in bowel habits, blood in the stool, diarrhea, alternating diarrhea and constipation, and local abdominal pain appear. In the late stage, systemic symptoms such as anemia and weight loss appear. Its morbidity and mortality rate are second only to gastric cancer, esophageal cancer, and primary liver cancer among malignant tumors of the digestive system.

[0003] Colorectal cancer is the third most common cancer and the second leading cause of cancer-related death worldwide. The treatment of colorectal cancer is generally based on surgery, which removes the tumor and then performs systemic treatment, supplemented by radiotherapy, chemotherapy, etc., but the efficacy is limited. In addition, there is no very clear understanding of the pathogenesis of colorectal cancer, which greatly limits the diagnosis and treatment of the disease.

[0004] As we all know, viroids are the smallest known infectious pathogens, originally discovered in plants, but so far not found in animals. So far, no viroids associated with colorectal cancer have been found, and there are no reports on the detection of viroids associated with colorectal cancer.

[0005] Therefore, how to overcome the shortcomings of the existing technology is an urgent problem to be solved in the field of molecular biology technology. Summary of the invention

[0006] The purpose of the present invention is to solve the deficiencies of the prior art and to provide a detection primer set, a kit and an application of a colorectal cancer-related viroid.

[0007] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of the present invention provides a primer set for detecting colorectal cancer-related viroids, wherein the primer set is a Divergent primer set and a Convergent primer set;

[0009] The Divergent primer set includes the upstream primer Divergent-CCAV-F and the downstream primer Divergent-CCAV-R, and the sequences are as follows:

[0010] Divergent-CCAV-F: 5'-acactcatgtactctcacacataac-3';

[0011] Divergent-CCAV-R:5'-atagtgtgagtgtacgtgttttttg-3';

[0012] The Convergent primer set includes the upstream primer Convergent-CCAV-F and the downstream primer Convergent-CCAV-R, and the sequences are as follows:

[0013] Convergent-CCAV-F: 5'-tacactcacactataacactataca-3';

[0014] Convergent-CCAV-R:5'-cgtgttttttgtgtgcatgagtgtc-3'.

[0015] The second aspect of the present invention provides a kit for detecting a primer set for colorectal cancer-associated viroids.

[0016] Further, preferably, the PCR amplification reaction system of the Divergent primer set is 2×Master Mix 5 μL, Divergent-CCAV-F 10 μM 0.3 μL, Divergent-CCAV-R 10 μM 0.3 μL, Nuclease-Free H2O 3.4 μL, and cDNA 1 μL.

[0017] The PCR amplification reaction system of the Convergent primer set was 2×Master Mix 5μL, Convergent-CCAV-F 10μM 0.3μL, Convergent-CCAV-R 10μM 0.3μL, Nuclease-Free H2O 3.4μL, and cDNA 1μL.

[0018] Furthermore, preferably, the PCR amplification reaction program is 95°C for 10 min, 1 cycle; 95°C for 15 s, 60°C for 60 s, for a total of 40 cycles.

[0019] The third aspect of the present invention provides the use of the above-mentioned kit containing the detection primer set of colorectal cancer-associated viroid in the preparation of products for colorectal cancer diagnosis or prognosis evaluation.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The inventors of the present invention discovered a new type of viroid-like circular RNA in the tumor tissue of colorectal cancer patients. The research found that it is a mammalian viroid and named it colorectal cancer-associated viroid (CCAV). This is the first time that the inventors have identified a previously undiscovered viroid in humans. The virus has no homology with the genomes of other species. Its sequence information ensures that the new virus detected is unique.

[0022] The primer set of the present invention has high specificity, is convenient and quick to use, and has a simple detection method, can quickly detect CCAV, and is easy to promote and apply.

[0023] The primer set of the present invention can be used for auxiliary clinical diagnosis of colorectal cancer and prognosis judgment of colorectal cancer treatment, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the CCAV BaseScope in situ hybridization image;

[0025] Figure 2 The expression diagram of CCAV in cancer tissue and adjacent tissue; tumor is cancer tissue, adjacent is adjacent tissue;

[0026] Figure 3 Representative electropherograms of Divergent primers and Convergent primers. DETAILED DESCRIPTION

[0027] The present invention is further described in detail below in conjunction with embodiments.

[0028] Those skilled in the art will appreciate that the following examples are only used to illustrate the present invention and should not be considered to limit the scope of the present invention. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the art or the product specifications are used. If the manufacturer of the materials or equipment used is not specified, they are all conventional products that can be purchased.

[0029] The inventors of the present invention discovered a novel viroid-like circular RNA in the tumor tissue of colorectal cancer patients. The research found that it is a mammalian viroid and named it colorectal cancer-associated viroid (CCAV). This is the first time that the inventors have identified a previously undiscovered viroid in humans.

[0030] We used a computer algorithm developed by the Wu Qingfa team, which is unique in that it is a reference-free computational method. It uses the technology of breaking longer reads into shorter fragments (SLS) and gradually filtering overlapping small RNA2 (PFOR2) to facilitate the detection of new viroid-like circular RNAs through RNA deep sequencing. SLS splits long RNA sequences into 21nt virtual small RNAs, and then performs PFOR2 analysis, retaining only 21nt virtual internal small RNAs (ISRs) for circRNA assembly. Our goal is to use a reference-free computer algorithm to study the presence of viroids in colorectal cancer tissues, aiming to gain new insights into the pathogenesis and treatment of colorectal cancer.

[0031] Through deep sequencing, whole transcriptome data of CRC clinical samples were collected. After excluding low-quality bases and irrelevant reads, clean, high-quality reads were aligned to the human genome (hg38) using Tophat, and matched reads were discarded. The remaining unmatched reads were converted into virtual small RNAs using the SLS program and then assembled using PFOR2. To improve computational efficiency, the "step" parameter in the SLS program was set to 8. In this process, more than 10,000 assemblies were assembled. These sequences were compared with the human genome (hg38) using BLAST to remove highly homologous sequences, leaving only non-homologous sequences. After screening, 5235 sequences were retained with a GC content of 51.35% and a total length of 1114562 bp. Most of the fragment lengths were clustered between 100 bp and 200 bp. In order to more accurately eliminate sequences from the human genome, 5235 sequences were individually aligned to the human genome under more stringent screening conditions, resulting in the screening of 130 sequences. Throughout the experimental design process, sequencing data homologous to the human genome were systematically discarded as much as possible, and non-homologous data were used as the basic dataset for the PFOR2 program operation.

[0032] Based on these sequences, PCR and Sanger sequencing were performed to verify and finally three sequences were identified. TM In the in situ hybridization analysis of the detection reagent kit v2-RED, only one test was positive, which was identified as a new viroid-like circular RNA in colorectal cancer patients. It was named colorectal cancer-associated viroid (CCAV).

[0033] CCAV is a single-stranded circular RNA virus with only 114 nucleotides (nt) and a GC content of 42.11%. The nucleotide sequence has been submitted to GenBank, and the GenBank accession number is OR538373. Its secondary structure is circular, which is different from the rod-shaped conformation of all known viroids (with extensive base pairing characteristics). CCAV is not derived from the splicing of the human genome. Comparison with the genomes of other species shows no homology. Its sequence information ensures that the new virus detected is unique.

[0034] The RNA sequence of CCAV is shown below:

[0035] tacactcacactataacactatacacacacagcactcaacacactacacacactcatgtactctcacacataacactacacacacaggacactcatgcacacaaaaaacacg (SEQ ID NO. 1)

[0036] (1) BaseScope in situ hybridization

[0037] The kit uses BaseScope from ACD TM Detection Reagent Kit v2-RED (Cat. No. 323900).

[0038] Fresh tumor tissue (colorectal cancer) was immediately fixed in 10% neutral formalin (NBF) buffer and placed at room temperature for 16-32 hours. After fixation, the sample was washed with 1× PBS, dehydrated step by step with standard ethanol, and then transparentized with xylene. The processed sample was embedded in paraffin using standard procedures, the paraffin block was trimmed as needed, and the embedded tissue was sliced ​​into 5±1μm sections using a microtome. The paraffin strip was placed in a 40-45℃ water bath and the sections were attached to PLUS slides. Slides were dried overnight at room temperature. Fresh pathology sections were baked in a 60°C drying oven for 1 hour, then dewaxed, twice in xylene for 5 minutes each, and twice in ethanol for 2 minutes each. Then dried at 60°C for 5 minutes, or until completely dry. Tissue Treat with hydrogen peroxide at room temperature for 10 minutes and then 1X target repair reagent was used for target repair at 100°C for 15 minutes. The slides were washed 3-5 times with distilled water, transferred to fresh 100% ethanol, incubated at room temperature for 3-5 minutes, removed, and completely dried at room temperature.

[0039] Use the Immedge hydrophobic pen to draw a hydrophobic circle around each slice 2-4 times. After the hydrophobic circle is completely dry, Protease IV was incubated at 40°C for 10 minutes.

[0040] Subsequently, the BaseScope probe (BA-Hs-CCAV-Junction targeting 61-13: tactctcacacataacactacacacacaggacactcatgcacacaaaaaaacacgtacactcacacta, SEQ ID NO. 6) was inserted into the ACD HybEZ TM II hybridization system (Advanced Cell Diagnostics, CA, USA) at 40°C for 2 hours: incubated with AMP1 (40°C for 30 minutes), AMP2 (40°C for 30 minutes), AMP3 (40°C for 15 minutes), AMP4 (40°C for 30 minutes), AMP5 (40°C for 30 minutes), AMP6 (40°C for 15 minutes), AMP7 (room temperature for 30 minutes) and AMP8 (room temperature for 15 minutes) reagents in sequence. Finally, Fast Red was used to visualize the expression of CCAV. Images were taken using Pannoramic MIDI (3DHISTECH, Hungary). For quality control, BaseScope TM Negative control probe DapB-1ZZ (Advanced Cell Diagnostics, CA, USA, Cat No. 701021), targeting the bacterial gene dapB, and BaseScope TM The positive control probe HμMan(Hs)-PPIB-1ZZ (Advanced Cell Diagnostics, CA, USA, Cat No.701041) was used as negative control and positive control, respectively.

[0041] The present invention uses BaseScope TM The detection kit v2-RED detected the CCAV level in fresh colorectal cancer pathological sections from the First Affiliated Hospital of Kunming Medical University. TM Probes were designed for the target region 61-13 bp. TM In situ hybridization analysis using the detection reagent kit v2-RED confirmed the presence of CCAV in fresh pathological sections ( Figure 1 ).like Figure 1 As shown, the expression level of CCAV in tissues is not high.

[0042] (2) qPCR detection of CCAV in cancer tissues and adjacent paracancerous tissues

[0043] A. Total RNA extraction: Take 50 mg tissue, add 500 μL Trizol, grind to homogenate, add Trizol to 1 ml, shake vigorously for 30 seconds, and place on ice for 5 minutes; add 200 μL chloroform and shake for 10 seconds, place at room temperature for 3 minutes, and centrifuge at 4℃12000rpm for 15 minutes after the solution is separated; carefully pipette the supernatant into an RNase-Free conical bottom centrifuge tube, add 400 μL isopropanol, slowly invert and mix, place at -20℃ for 30-60 minutes, and then centrifuge at 4℃12000rpm for 15 minutes; discard the supernatant, RNA precipitates at the bottom of the centrifuge tube, add 1 ml 75% ethanol (RNase-Free ultrapure water), gently blow and wash the precipitate, and centrifuge at 4℃12000rpm for 10 minutes; discard the supernatant, dry at room temperature for 5-10 minutes, and add 15-20 μL RNase-Free water to dissolve the RNA;

[0044] B. Reverse transcription (RT): Select the RevertAid First Strand cDNA Synthesis Kit (K1622) from Thermo. First add 1μL of Random Primer, 1μg of total RNA, and water to 12μL to each tube; 65℃, 5min; then add 4μL of 5×Buffer, 2μL of dNTP Mix, 1μL of Protector RNase Inhibitor, and 1μL of Transcriptase in sequence. The total reverse transcription system is 20μL; 25℃5min, 42℃6min, 70℃5min, and the obtained cDNA is stored at low temperature;

[0045] C.PCR: Select the SYBR-Green PCR kit from Roche.

[0046] The PCR amplification reaction system was 2×Master Mix 5 μL, Divergent-CCAV-F (10 μM) 0.3 μL, Divergent-CCAV-R (10 μM) 0.3 μL, Nuclease-Free H2O 3.4 μL, and cDNA 1 μL.

[0047] Set the program: 95℃ for 10min, then 95℃ for 15s, 60℃ for 60s for 40 cycles. Store at 4℃ after completion.

[0048] CCAV was detected in tumor and adjacent tissues of 100 patients with stage I, II, III, and IV CRC. Figure 2). In this step, the linear RNA was pre-digested by RNase R. The expression of CCAV in cancer tissues was significantly increased compared with adjacent tissues (*P<0.05)( Figure 2 ).

[0049] Although a lot of experimental evidence is still needed to understand its role in tumor development, this discovery represents the first identification of a mammalian viroid. It changes the traditional understanding that viroids only exist in plants and expands the scope of viroids. This breakthrough opens up new avenues for studying human diseases and deserves further exploration.

[0050] (3) CCAV detection

[0051] The primer set for CCAV detection is shown in Table 1.

[0052] Table 1

[0053]

[0054] The two pairs of primers are Divergent primers and Convergent primers;

[0055] Among them, the Divergent primers were designed for the CCAV circular junction, the target product was the CCAV circular junction sequence (acactcatgtactctcacacataacactacacacacaggacactcatgcacacaaaaaacacgtacactcacactat, 77 bp), and the product was unique;

[0056] Convergent primers were designed for the CCAV linear sequence. The target product is the entire linear sequence of CCAV (tacactcacactataacactatacacacacagcactcaacacactacacacacactcatgtactctcacacataacactacacacacaggacactcatgcacacaaaaaacacg, 114bp), and the product is unique.

[0057] The present invention also provides a molecular detection method for colorectal cancer-associated viroid CCAV, the specific method is:

[0058] A. Total RNA extraction: Take 50 mg tissue, add 500 μL Trizol, grind to homogenate, add Trizol to 1 ml, shake vigorously for 30 seconds, and place on ice for 5 minutes; add 200 μL chloroform and shake for 10 seconds, place at room temperature for 3 minutes, and centrifuge at 4℃12000rpm for 15 minutes after the solution is separated; carefully pipette the supernatant into an RNase-Free conical bottom centrifuge tube, add 400 μL isopropanol, slowly invert and mix, place at -20℃ for 30-60 minutes, and then centrifuge at 4℃12000rpm for 15 minutes; discard the supernatant, RNA precipitates at the bottom of the centrifuge tube, add 1 ml 75% ethanol (RNase-Free ultrapure water), gently blow and wash the precipitate, and centrifuge at 4℃12000rpm for 10 minutes; discard the supernatant, dry at room temperature for 5-10 minutes, and add 15-20 μL RNase-Free water to dissolve the RNA;

[0059] B. Reverse transcription (RT): Select the RevertAid First Strand cDNA Synthesis Kit (K1622) from Thermo Company. First add 1μL of Random Primer, 1μg of total RNA, and add water to 12μL in each tube; 65℃, 5min; then add 4μL of 5×Buffer, 2μL of dNTP Mix, 1μL of Protector RNase Inhibitor, and 1μL of Transcriptase in sequence. The entire reverse transcription system is 20μ; 25℃5min, 42℃6min, 70℃5min, and the obtained cDNA is stored at low temperature;

[0060] C.PCR: Select the SYBR-Green PCR kit from Roche.

[0061] The PCR amplification reaction system of the Divergent primer set was 2×Master Mix 5 μL, Divergent-CCAV-F (10 μM) 0.3 μL, Divergent-CCAV-R (10 μM) 0.3 μL, Nuclease-Free H2O 3.4 μL, and cDNA 1 μL.

[0062] The PCR amplification reaction system of Convergent primer set was 2×Master Mix 5μL, Convergent-CCAV-F (10μM) 0.3μL, Convergent-CCAV-R (10μM) 0.3μL, Nuclease-Free H2O 3.4μL, cDNA 1μL. Set the program: 95℃10min, then 95℃15s, 60℃60s for 40 cycles. After the end, store at 4℃.

[0063] The expression of CCAV in cancer tissues was significantly increased ( Figure 2 ); Divergent primer group and Convergent primer group amplified specific bands ( Figure 3 ), where dp represents Divergent primer and cp represents Convergent primer.

[0064] That is, when the primer set of the present invention is used for detection, if the detection result is Figure 3 If the positions of the specific bands amplified by the Divergent primer set and the Convergent primer set are consistent, CCAV is determined to be present; otherwise, CCAV is determined to be absent.

[0065] The present invention also detects whether CCAV exists in normal human diploid cells KMB17 and human colon adenocarcinoma cells SW480, wherein the expression of CCAV is detected in human colon adenocarcinoma cells SW480, while CCAV is not detected in normal human diploid cells KMB17.

[0066] Considering that this is the first evidence provided by the applicant for the existence of viroids in colorectal cancer tissues, and its specific mechanism of action in tumor development still requires a lot of experimental evidence, this discovery marks the first time that viroids have been confirmed to exist in mammals. The applicant's research has revised the previous concept that viroids only exist in plants, and this discovery has the potential to change the current virology paradigm, indicating that viroids may exist in a wider range of life systems. This discovery has opened up new avenues for studying human diseases and is worthy of further exploration.

[0067] The above shows and describes the basic principles, main features and advantages of the present invention. It should be understood by those skilled in the art that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, which fall within the scope of the present invention to be protected. The scope of protection of the present invention is defined by the attached claims and their equivalents.

Claims

1. A primer set for detecting colorectal cancer-related viroids, characterized in that: The primer sets are Divergent primer set and Convergent primer set; The Divergent primer set includes the upstream primer Divergent-CCAV-F and the downstream primer Divergent-CCAV-R, and the sequences are as follows: Divergent-CCAV-F: 5'-acactcatgtactctcacacataac-3'; Divergent-CCAV-R:5'-atagtgtgagtgtacgtgttttttg-3'; The Convergent primer set includes the upstream primer Convergent-CCAV-F and the downstream primer Convergent-CCAV-R, and the sequences are as follows: Convergent-CCAV-F: 5'-tacactcacactataacactataca-3'; Convergent-CCAV-R:5'-cgtgttttttgtgtgcatgagtgtc-3'.

2. A kit comprising the detection primer set for colorectal cancer-associated viroid according to claim 1.

3. A kit comprising the primer set for detecting colorectal cancer-associated viroid according to claim 2, characterized in that: The PCR amplification reaction system of Divergent primer set was 2× Master Mix 5 μL, Divergent-CCAV-F 10 μM 0.3 μL, Divergent-CCAV-R 10 μM 0.3 μL, Nuclease-Free H2O 3.4 μL, cDNA 1 μL; The PCR amplification reaction system of the Convergent primer set was 2×Master Mix 5μL, Convergent-CCAV-F 10μM 0.3μL, Convergent-CCAV-R 10μM 0.3μL, Nuclease-Free H2O 3.4μL, and cDNA 1μL.

4. The kit for detecting a primer set of colorectal cancer-associated viroid according to claim 2, characterized in that: The PCR amplification reaction program was 95°C for 10 min, 1 cycle; 95°C for 15 s, 60°C for 60 s, for a total of 40 cycles.

5. Use of the detection primer set for colorectal cancer-associated viroids according to claim 1 and the kit containing the detection primer set for colorectal cancer-associated viroids according to claim 2 in the preparation of products for colorectal cancer diagnosis or prognosis evaluation.

Images