Two full-porcine PEDV (porcine epidemic diarrhea virus) monoclonal neutralizing antibodies and application thereof

Abstract

The invention discloses a monoclonal antibody C62 and a monoclonal antibody N19 for a porcine epidemic diarrhea virus (PEDV), and belongs to the field of genetic engineering. The monoclonal antibody comprises a heavy chain variable region, a light chain variable region, a heavy chain constant region and a light chain constant region, the amino acid sequences of the heavy chain variable regions of C62 and N19 are respectively shown as SEQ ID NO: 1 and SEQ ID NO: 3, and the amino acid sequences of the light chain variable regions of C62 and N19 are respectively shown as SEQ ID NO: 2 and SEQ ID NO: 4. The monoclonal antibody provided by the invention is a real antibody obtained from a pig body by applying a single B cell antibody technology, and has very high neutralizing activity on PEDV (Porcine Epidemic Diarrhea Virus).

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and relates to two whole-swine PEDV monoclonal antibodies with neutralizing activity. Background Art

[0002] Porcine epidemic diarrhea (PED) is an acute, highly contagious disease caused by porcine epidemic diarrhea virus (PEDV), with the main symptoms being vomiting, watery diarrhea, and dehydration. According to phylogenetic analysis, PEDV can be divided into two major categories, genotype GI (classical strain) and genotype GII (highly virulent strain). With the development and marketing of GII genotype vaccines, although the infection rate of PEDV has been reduced, the prevalence of PEDV has not been prevented, and the mortality rate of piglets is still high. Although vaccination is the main strategy for preventing and controlling PEDV infection, the currently available PEDV vaccines cannot provide complete protection for pigs infected with highly virulent strains, which urgently requires us to cooperate with other prevention and control measures to prevent PEDV.

[0003] PEDV mainly infects the digestive tract and is transmitted through the fecal-oral route. In addition to symptomatic treatment and supportive treatment, there is currently no specific treatment for PEDV. For digestive tract pathogen infection, oral administration of specific neutralizing antibodies or antibody derivatives to animals is an effective prevention and treatment method, because neutralizing antibodies can neutralize viruses and inhibit the infection of viruses to intestinal cells. At present, the main technologies for preparing monoclonal neutralizing antibodies are hybridoma cell technology, phage display technology, and single B cell antibody technology. The antibodies prepared by hybridoma cell technology are mouse antibodies, and there are problems such as poor uniformity and immune rejection in their applications; the antibodies prepared by phage display are usually single-chain antibodies, and the pairing of heavy and light chains is random (non-natural pairing), and the antibody affinity is unstable; the antibodies prepared by single B cell antibody technology have naturally paired heavy and light chains, and can target specific species, avoiding immune rejection reactions, which makes single B cell antibody technology an important method for screening neutralizing antibodies.

[0004] Most of the PEDV monoclonal neutralizing antibodies reported so far are mouse antibodies, with only one strain PC10 being a whole-porcine antibody (Fu F, Li L, Shan L, et al. Aspike-specific whole-porcine antibody isolatedfrom aporcine B cell that neutralizes both genogroup 1and 2PEDV strains. [J]. Veterinary Microbiology, 2017: 99-105.), and three pig-derived single-chain antibodies. Compared with single-chain antibodies consisting only of heavy and light chain variable regions, complete antibodies consist of two heavy chains and two light chains, both of which include variable regions and constant regions. Based on the differences in the heavy chain constant region, antibodies can be divided into five types: IgA, IgG, IgM, IgD, and IgE. Light chains can be divided into two types: Kappa and Lambda based on sequence characteristics. IgG antibodies play an important role in humoral immunity, and currently many antibody drugs are IgG antibodies. The variable region of an antibody contains three hypervariable regions, CDR1, CDR2, and CDR3, which have large amino acid variations and are key regions for binding to antigens. A complete antibody has an Fc fragment, which is more stable in vivo and has Fc-mediated antiviral functions in addition to neutralizing activity (Fc binds to complement to form a membrane attack complex, causing target cell lysis; Fc can also bind to Fc receptors on the surface of effector cells to mediate effector cell killing of target cells). The only previously reported all-swine antibody PC10 (with a Kappa light chain) has a good neutralizing effect on GI-type PEDV strains, but has a poor neutralizing effect on highly virulent (GII-type) strains. However, the most prevalent strains are highly virulent (GII-type) strains, which urgently requires us to develop neutralizing antibodies against GII-type virus strains and develop antibody biologics to supplement the effects of vaccines.

[0005] Based on this, we used PEDV-S1 protein as bait antigen and single B cell antibody technology to prepare multiple whole pig-derived highly reactive antibodies, three of which were named B5 (patent applied for), C62, and N19. Among the three antibodies, C62 and N19 (the light chains are both Lambda type, different from PC10) are two whole pig-derived neutralizing antibodies against highly virulent strains of PEDV. The development of this neutralizing antibody has laid the foundation for the prevention and treatment of PEDV. Summary of the invention

[0006] The purpose of the present invention is to provide two whole-swine PEDV antibodies, which can not only react with PEDV-S1 protein, but also neutralize PEDV, especially highly virulent strains, and can therefore be used for the diagnosis, prevention and treatment of PEDV.

[0007] The present invention is achieved in that:

[0008] The applicant used PEDV-S1 protein as the screening antigen and applied single B cell antibody technology to perform high-throughput screening of antibodies from pigs. In this process, multiple functionally diverse single B cells were obtained. The cDNA of these single B cells was used as a template for two rounds of PCR amplification to obtain the variable region genes of the antibody heavy chain and light chain and sequence them. Then, the variable region sequences of these antibody heavy chains and light chains were optimized and synthesized and inserted into expression vectors containing the pig IgG1 heavy chain constant region or the pig lambda light chain constant region, respectively, to obtain complete heavy chain and light chain vectors expressing antibodies. Finally, the complete heavy chain and light chain vectors were co-transfected into host cells for expression, and multiple functionally diverse monoclonal antibodies were finally obtained after purification.

[0009] The applicant named two of the antibodies C62 and N19, both of which are anti-PEDV monoclonal antibodies that actually exist in pigs. Since these antibodies include heavy chain and light chain variable regions and heavy chain and light chain constant regions, they are different from existing single-chain antibodies. Since the variable region sequences of these antibodies are different from existing whole pig antibodies, they have great differences in reactivity, neutralization activity and other aspects. Experiments have shown that the antibodies C62 and N19 screened by the present invention have strong neutralization activity against PEDV and can be better used for the prevention and treatment of PEDV epidemic strains, namely GII type strong strains.

[0010] A more specific plan is as follows:

[0011] Two whole-swine PEDV monoclonal antibodies C62 and N19, the monoclonal antibodies include heavy chain, light chain variable regions and heavy chain, light chain constant regions, the amino acid sequences of the heavy chain variable regions of C62 and N19 are shown in SEQ ID NO: 1 and SEQ ID NO: 3, respectively, and the amino acid sequences of the light chain variable regions of C62 and N19 are shown in SEQ ID NO: 2 and SEQ ID NO: 4, respectively.

[0012] Preferably, the heavy chain constant region of the monoclonal antibodies C62 and N19 is of IgG1 type, and the light chain constant region is of lambda type.

[0013] The present invention further provides DNA fragments encoding the two whole-swine source PEDV monoclonal antibodies C62 and N19.

[0014] The DNA fragments encoding the complete heavy chains of C62 and N19 are shown in SEQ ID NO: 7 and SEQ ID NO: 11, respectively; the DNA fragments encoding the complete light chains of C62 and N19 are shown in SEQ ID NO: 9 and SEQ ID NO: 13, respectively.

[0015] The present invention also provides an expression vector and a host cell containing the DNA fragment, which can be used to produce the monoclonal antibodies C62 and N19.

[0016] A specific embodiment of the present invention verifies the reactivity of the monoclonal antibodies C62 and N19 with PEDV-S1 protein and PEDV strains. Therefore, the monoclonal antibodies C62 and N19 obtained in the present invention can be used for the detection of PEDV and its antigenic proteins. Based on this, the present invention provides the use of the monoclonal antibodies C62 and N19 in the preparation of a PEDV detection kit.

[0017] A specific embodiment of the present invention also verifies the neutralizing activity of the monoclonal antibodies C62 and N19 against PEDV strains. Based on this, the present invention also provides the use of the monoclonal antibodies C62 and N19 in the preparation of biological preparations for the prevention and treatment of PEDV. Specifically, the monoclonal antibodies C62 and N19 have neutralizing activity against PEDV virus and can bind to PEDV surface antigens, thereby resisting porcine epidemic diarrhea caused by the invasion of PEDV virus, especially GII type virulent strains.

[0018] For more detailed technical solutions, please refer to the specific embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 : Gel electrophoresis of antibody C62 and N19 identification.

[0020] Figure 2 : ELISA test results of antibody C62 and N19 reactivity.

[0021] Figure 3 : Results of indirect immunofluorescence detection of the reactivity of antibody C62 with N19.

[0022] Figure 4 : Sequence alignment of the variable regions of antibodies B5, C62, and N19 showed that there were significant differences in the sequences of the hypervariable regions CDR1, CDR2, and CDR3. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention and not all of them. Based on the embodiments of the present invention, other alternatives obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0024] The applicant used PEDV-S1 protein as the screening antigen and used single B cell antibody technology to perform high-throughput antibody screening from pigs. In the process, multiple functionally diverse single B cells and monoclonal antibodies were obtained. One of the antibodies, B5, has been applied for a Chinese invention patent on October 14, 2022, with application number 202211259289X and publication number CN116217714A. Monoclonal antibody B5 can specifically recognize S1 protein and is a reactive antibody with no neutralizing activity against PEDV. The applicant used monoclonal antibody B5 to screen a specific antigen epitope peptide on PEDV.

[0025] The other two antibodies (C62 and N19) in this application were also screened using the same method. Like B5, these two antibodies are also real anti-PEDV antibodies in pigs, but their performance is very different from that of the previous B5. They can not only react with S1 protein, but also have a high level of PEDV neutralization activity. The applicant also compared it with another currently known whole-swine PEDV monoclonal antibody PC10. The results showed that C62 and N19 have higher neutralization activity against PEDV and can be used to prepare therapeutic antibodies against GII type PEDV strong strains.

[0026] Key material description:

[0027] CH-pcDNA3.4 vector containing porcine IgG1 heavy chain constant region and CL-pcDNA3.4 vector containing porcine lambda light chain constant region: optimized and synthesized by GeneWeizhi Biotechnology Co., Ltd.

[0028] WHLL, HNAY, and HNXX strains: All are GII type highly virulent PEDV strains preserved in this laboratory. The NCBI database sequence number of HNXX is MK124712.1; the NCBI database sequence number of HNAY is MK111633.1; and the NCBI database sequence number of WHLL is MN037494.1.

[0029] All-porcine monoclonal antibody PC10: donated by Professor Liu Pinghuang from the College of Veterinary Medicine, China Agricultural University.

[0030] The biological materials or reagents not described in the text are all conventional materials in the art, or the same materials as those in CN116217714A.

[0031] Example 1 Preparation of PEDV-specific monoclonal antibodies

[0032] 1. Screening of Single B Cells

[0033] PEDV-S1 protein was used as the screening antigen, pigs were immunized with PEDV vaccine, PBMCs were separated from pig peripheral blood, and specific B cells recognizing PEDV-S1 protein were further obtained by flow sorting. The specific screening method was the same as the method of B5 (CN116217714A), which is briefly described as follows: anticoagulated blood was collected from pigs to separate peripheral blood mononuclear cells (PBMCs), and the PBMCs were stained with biotin-labeled antigen PEDV-S1-biotin, anti-swine IgM-PE-Cy7 antibody, anti-swine IgG-FITC antibody, and anti-swine-CD3-PE antibody, and then washed to remove unbound antigens and antibodies, and then anti-biotin-APC antibody was used to bind to the antigen PEDV-S1-biotin. After washing, anti-swine IgM-PE-Cy7, anti-swine-CD3-PE double-negative lymphocyte populations were flow sorted, and then anti-swine IgG-FITC, PEDV-S1-APC double-positive antigen-specific B cells were further screened.

[0034] In this experiment, a number of antigen-specific single B cells were obtained, and the heavy chain and light chain variable region sequences of the B5 antibody were obtained by nested PCR amplification and sequencing of one of the B cells.

[0035] 2. Amplification of monoclonal antibody variable region genes

[0036] Another two specific single B cells obtained in the laboratory were added to a 96-well PCR plate containing 10 μL of lysate (one cell per well), the lysate was reverse transcribed, and primers were designed based on the antibody variable region gene reference sequence in the IMGT database for nested PCR amplification to obtain the antibody variable region gene. The method was the same as that in CN116217714A, as follows:

[0037] The variable region of the antibody was amplified by nested PCR. In the first round, the reverse transcribed cDNA was used as a template and amplified using H / L-Out-F and H / L-Out-R respectively. In the second round, the product of the first round of PCR was used as a template and amplified using nested primers H / L-In-F and H / L-In-R. After the amplification, the variable region genes of the antibody heavy chain and light chain could be obtained.

[0038] Primers used to amplify the heavy chain variable region:

[0039] H-Out-F:GTTTCGGCTGAACTGGGTGGTC;

[0040] H-Out-R: GGTCACTGRCTCGGGGAAGTAGC;

[0041] H-In-F: GGTGGAGTSTGGRGGAGGCCTG;

[0042] H-In-R: CAGGGGGCCAGAGGGTAGACC;

[0043] Primers used to amplify the light chain variable region:

[0044] L-Out-F: ATGGCCTGGACGGTGCTTCTGATC

[0045] L-Out-R:CCTCCAGGTCACSGTCACG

[0046] L-In-F:TCTCAGACTGTGATCCAGGAG

[0047] L-In-R:GTCACTTATTAGACACACCAGGGTG

[0048] First round amplification system:

[0049]

[0050] The first round amplification program: 95°C for 5 min; 95°C for 30 s, 56°C for 50 s, 72°C for 1 min, 34 cycles; 72°C for 10 min.

[0051] Second round amplification system:

[0052]

[0053] The second round amplification program: 95°C for 5 min; 95°C for 30 s, 60°C for 50 s, 72°C for 1 min, 35 cycles; 72°C for 10 min.

[0054] The amplified products were sequenced to obtain the heavy chain variable region (VH) gene sequence of antibody C62, encoding the amino acid sequence as shown in SEQ ID NO: 1; the light chain variable region (VL) gene sequence, encoding the amino acid sequence as shown in SEQ ID NO: 2. The heavy chain variable region (VH) gene sequence of antibody N19, encoding the amino acid sequence as shown in SEQ ID NO: 3; the light chain variable region (VL) gene sequence, encoding the amino acid sequence as shown in SEQ ID NO: 4.

[0055] 3. Construction of complete heavy and light chain plasmids

[0056] After obtaining the heavy chain and light chain variable region sequences of C62 and N19, the gene codons were optimized and synthesized respectively, and then the heavy chain variable region was inserted into the CH-pcDNA3.4 vector containing the pig IgG1 heavy chain constant region through the NotI and BbvCI restriction sites to construct a vector plasmid expressing the complete heavy chain of the antibody; the light chain variable region was inserted into the CL-pcDNA3.4 vector containing the pig Lambda light chain constant region through NotI and AleI to construct a vector plasmid expressing the complete light chain of the antibody. The recombinant expression plasmid was transformed into the DH5α competent amplification plasmid, and the plasmid was extracted using an endotoxin-free plasmid extraction kit, and the operation steps were carried out according to the kit instructions.

[0057] Among them, the amino acid sequence of the porcine IgG1 heavy chain constant region (CH) is shown in SEQ ID NO: 5; the amino acid sequence of the porcine Lambda light chain constant region (CL) is shown in SEQ ID NO: 6.

[0058] The nucleotide sequence of the complete heavy chain of the prepared monoclonal antibody C62 is shown in SEQ ID NO: 7, and the amino acid sequence is shown in SEQ ID NO: 8; the nucleotide sequence of the complete light chain of the monoclonal antibody C62 is shown in SEQ ID NO: 9, and the amino acid sequence is shown in SEQ ID NO: 10. The nucleotide sequence of the complete heavy chain of the monoclonal antibody N19 is shown in SEQ ID NO: 11, and the amino acid sequence is shown in SEQ ID NO: 12; the nucleotide sequence of the complete light chain of the monoclonal antibody N19 is shown in SEQ ID NO: 13, and the amino acid sequence is shown in SEQ ID NO: 14.

[0059] 4. Antibody Expression and Purification

[0060] C62 and N19 were expressed and purified in the same way as B5. The complete heavy chain plasmid and the complete light chain plasmid were co-transfected into CHO cells at a ratio of 1:1 to express the antibody and purify and identify it. The specific operations are as follows:

[0061] (1) Cell culture. Count the CHO cells and centrifuge them. Use new culture medium to adjust the density to 2×10 7 / mL, transfer 10mL of cell suspension into a 125mL shaking flask and put it back into the incubator. After shaking and culturing for 1h, take it out of the incubator for transfection.

[0062] (2) Cell transfection. Add 85 μg of light chain plasmid and 85 μg of heavy chain plasmid to CHO cells and shake well. Then add 350 μL of transfection reagent (TA-CHO) and mix well. After sufficient mixing, return the cells to the incubator for 6 h. After 6 h in the incubator, add 20 mL of fresh culture medium to dilute the transfected cells and return them to the incubator for further culture. 24 h after transfection, add 360 μL of KE-CHO (CHO cell protein expression enhancer) and 600 μL of KT-Feed (plant peptone nutrient additive for transient recombinant protein expression), and transfer to a 32°C incubator for low-temperature expression. Add 300 μL of glucose on the second day, 600 μL of glucose and 600 μL of KT-Feed on the third day, and 600 μL of glucose on the fourth and fifth days. Collect the cell supernatant at 12000 rpm / 30 min on the sixth day.

[0063] (3) Antibody purification and identification. After the expressed supernatant was filtered with a 0.22 μm filter, the antibody was purified using a pre-loaded column of 1 mL Protein A from Huiyan Biotechnology. The operation was as follows: Assemble the Huiyan Protein A column, wash it with ultrapure water for 5 column volumes at a flow rate of 1 mL / min, balance it with PBS for 20 column volumes, and then load the filtered cell supernatant at 0.2 mL / min. After loading, load 10 column volumes of PBS at a flow rate of 1 mL / min, and finally elute it with elution buffer for 10 column volumes. Wash it with ultrapure water for 5 column volumes and store the column with 20% ethanol. After purification, the antibody was replaced with PBS using an ultrafiltration tube and stored at -20°C. Take 40 μL of antibody and add 10 μL of 5× protein reducing loading, boil the sample at 100°C for 10 min, and identify the expression by SDS-PAGE protein electrophoresis.

[0064] After protein electrophoresis of the antibody (abbreviated as C62, N19 in the figure), two bands appeared, one at about 55KD, which is the heavy chain, and the other at about 25KD, which is the light chain ( Figure 1 ).

[0065] Example 2 Activity verification of whole porcine monoclonal antibodies

[0066] 1.ELISA to detect antibody reactivity

[0067] The expressed and purified PEDV-S1 protein was coated on the ELISA coated plate at a concentration of 2 μg / mL at 4°C overnight; after washing 5 times with PBST, 5% skim milk powder was added for blocking at 37°C for 2 h; after washing 5 times with PBST, a 2-fold diluted whole pig antibody was added and incubated at 37°C for 1.5 h; after washing 5 times with PBST, a 1:5000 diluted anti-pig IgG-HRP antibody was added and incubated at 37°C for 0.5 h; after washing 5 times with PBST, a color developing solution was added and incubated at 37°C for 10 min, then a stop solution was added and the OD630nm value was read with an enzyme reader.

[0068] The results showed that antibodies C62 and N19 both specifically bound to PEDV-S1 protein ( Figure 2 ).

[0069] 2. Indirect immunofluorescence detection of antibody reactivity

[0070] Different PEDV strains (WHLL, HNAY, HNXX strains) were inoculated into 24-well plates. After inoculation, the cells were washed with PBS three times and fixed with 4% paraformaldehyde for 10 min; washed with PBS three times and permeabilized with 0.2% Triton X-100 for 10 min; washed with PBS three times, added with 10 μg / mL antibody, and incubated at 37°C for 1.5 h; washed with PBS three times, added with 1:100 diluted anti-swine IgG-FITC antibody, and incubated at 37°C for 0.5 h; washed with PBS three times, added with 1:5000 diluted DAPI; washed with PBS three times, added with 1 mL PBS, and observed and photographed under an inverted fluorescence microscope.

[0071] The results showed that antibodies C62 and N19 reacted with PEDV strains and produced specific green fluorescence ( Figure 3 ).

[0072] 3. Neutralization test to verify the neutralizing activity of antibodies

[0073] In order to compare the neutralizing effects of C62, N19 and PC10 on highly virulent strains, we mixed 2-fold diluted antibodies (concentrations ranging from 1.95μg / mL to 500μg / mL) with an equal volume of 200TCID50 virus solution and incubated them at 37°C for 1h; washed the 96-well cell culture plate three times with PBS and then dried; transferred 100μL of the antibody-virus mixture to a 96-well plate, and set up virus control groups of 200TCID50, 20TCID50, 2TCID50, and 0.2TCID50, then added 100μL of DMEM containing 20μg / mL of trypsin, and placed it in a 37°C incubator for 2-3 days to observe the experimental results. The results are expressed as IC50, which stands for half-maximal inhibitory concentration in μg / mL. The lower the IC50 value, the stronger the neutralizing ability of the antibody. An IC50 value of 50 μg / mL is used as the critical value of neutralization, and antibodies with IC50>50 μg / mL are identified as non-neutralizing active antibodies.

[0074] Table 1 IC50 determination of neutralization activity of monoclonal antibodies against strong strains of PEDV

[0075]

[0076] The present invention uses single B cell antibody technology to express multiple whole pig antibodies, and ELISA further screens out three highly reactive antibodies, named B5 (patent applied for), C62, and N19. By comparing the variable region sequences of these three antibodies, it is found that there are large differences in the antibody hypervariable regions CDR1, CDR2, and CDR3 ( Figure 4 ). Indirect immunofluorescence was used to detect the reactivity of C62 and N19 antibodies with different highly virulent PEDV strains, and it was found that they reacted specifically with multiple PEDV strains. In order to verify the neutralizing effect of the two antibodies on highly virulent strains, we used three different GII type PEDV strains and compared them with B5 and PC10. The results showed that the neutralizing activity of C62 and N19 antibodies against GII type highly virulent strains was better than that of B5 and PC10 reported previously. This result shows that these two neutralizing antibodies can play an important role in the development of biological reagents for the prevention, diagnosis and treatment of PEDV.

[0077] Appendix: Description of Sequence Listing

[0078] SEQ ID NO: 1: amino acid sequence of the heavy chain variable region (VH) of monoclonal antibody C62;

[0079] SEQ ID NO: 2: amino acid sequence of the light chain variable region (VL) of monoclonal antibody C62;

[0080] SEQ ID NO: 3: amino acid sequence of the heavy chain variable region (VH) of monoclonal antibody N19;

[0081] SEQ ID NO: 4: amino acid sequence of the light chain variable region (VL) of monoclonal antibody N19;

[0082] SEQ ID NO: 5: amino acid sequence of the constant region (CH) of the heavy chain of a monoclonal antibody;

[0083] SEQ ID NO: 6: amino acid sequence of the monoclonal antibody light chain constant region (CL);

[0084] SEQ ID NO: 7: Nucleotide sequence of the optimized complete heavy chain of monoclonal antibody C62;

[0085] SEQ ID NO: 8: Amino acid sequence of the complete heavy chain of monoclonal antibody C62;

[0086] SEQ ID NO: 9: Nucleotide sequence of the optimized complete light chain of monoclonal antibody C62;

[0087] SEQ ID NO: 10: Amino acid sequence of the complete light chain of monoclonal antibody C62;

[0088] SEQ ID NO: 11: Nucleotide sequence of the optimized complete heavy chain of monoclonal antibody N19;

[0089] SEQ ID NO: 12: Amino acid sequence of the complete heavy chain of monoclonal antibody N19;

[0090] SEQ ID NO: 13: Nucleotide sequence of the optimized complete light chain of monoclonal antibody N19;

[0091] SEQ ID NO: 14: Amino acid sequence of the complete light chain of monoclonal antibody N19.

Claims

1. Two whole-swine-derived porcine epidemic diarrhea virus (PEDV) monoclonal antibodies C62 or N19, characterized in that: The monoclonal antibody comprises heavy chain and light chain variable regions and heavy chain and light chain constant regions. The amino acid sequences of the heavy chain variable regions of C62 and N19 are shown in SEQ ID NO: 1 and SEQ ID NO: 3, respectively. The amino acid sequences of the light chain variable regions of C62 and N19 are shown in SEQ ID NO: 2 and SEQ ID NO: 4, respectively.

2. The two whole-swine PEDV monoclonal antibodies C62 or N19 according to claim 1, characterized in that: The heavy chain constant region is of IgG1 type, and the light chain constant region is of lambda type.

3. A DNA fragment encoding the two whole-swine PEDV monoclonal antibodies C62 or N19 according to claim 1 or 2.

4. The DNA fragment according to claim 3, characterized in that: It includes a DNA fragment encoding a complete heavy chain and a complete light chain of a monoclonal antibody, wherein the DNA fragment encoding the complete heavy chains of C62 and N19 are shown as SEQ ID NO: 7 and SEQ ID NO: 11, respectively; the DNA fragment encoding the complete light chains of C62 and N19 are shown as SEQ ID NO: 9 and SEQ ID NO: 13, respectively.

5. An expression vector and a host cell containing the DNA fragment of claim 3.

6. Use of the two whole-swine PEDV monoclonal antibodies C62 or N19 described in claim 1 in the preparation of a PEDV detection kit.

7. Use of the two whole-swine PEDV monoclonal antibodies C62 or N19 described in claim 1 in the preparation of biological preparations for the prevention and treatment of PEDV.

8. The use according to claim 7, characterized in that: The monoclonal antibody C62 or N19 has neutralizing activity against PEDV virus and can bind to PEDV surface antigens, thereby resisting porcine epidemic diarrhea caused by the invasion of PEDV virus, especially GII type strong strains.

9. A PEDV detection kit, comprising the two whole-swine PEDV monoclonal antibodies C62 or N19 according to claim 1.

10. A biological preparation for the prevention and treatment of PEDV, comprising the two whole-swine PEDV monoclonal antibodies C62 or N19 according to claim 1.

Images