Construction method of Rpgr gene knockout mouse model

Abstract

The invention discloses a construction method of an Rpgr gene knockout mouse model, and belongs to the technical field of gene engineering. The construction method comprises the following steps: injecting the recombinant gRNA expression vector provided by the invention into a CRISPR / Cas9 transgenic mouse body through subretinal injection, and obtaining an Rpgr gene knockout mouse model by utilizing a CRISPR / Cas9 gene editing technology; the mouse is a CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 transgenic Or injecting the recombinant gRNA expression vector provided by the invention and an expression vector containing a nucleotide sequence for expressing Cas9 into a wild type mouse body, and obtaining the Rpgr gene knockout mouse model by utilizing a CRISPR / Cas9 gene editing technology. The construction method provided by the invention is good in knockout effect, low in cost, high in efficiency, good in durability after knockout, complete in retina tissue structure, less in time consumption, simple in method and high in flexibility, large-batch screening is not needed, damage of whole-body knockout to other organ functions of mice is avoided, the research time is greatly saved, and the research efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for constructing an Rpgr gene knockout mouse model. Background Art

[0002] Retinitis Pigmentosa (RP) is a type of inherited retinal degenerative disease characterized by the secondary degeneration and death of photoreceptor cells in the retina and atrophy of the retinal pigment epithelium. It initially manifests as night blindness. As the disease progresses, patients will experience a gradual narrowing of the visual field to form tunnel vision, and eventually develop blindness. The global incidence of RP is about 1 / 5000, and about 1 / 4000 in China. The inheritance of retinitis pigmentosa is complex and often accompanied by a family history. RP is mainly a single gene genetic disease, among which the clinical symptoms caused by the pathogenic mutation of X-linked retinitis pigmentosa (XLRP) are earlier and more severe, and the prognosis is poor. XLRP mainly affects male patients. Because male patients have only one X chromosome, the expression of the mutant gene cannot be compensated by the normal gene, so the disease is serious. Female carriers have two X chromosomes, and the other normal X chromosome can partially compensate for the function of the mutant gene, so they usually do not show symptoms or have milder symptoms.

[0003] The main pathogenic gene of XLRP is the retinitis pigmentosa GTPase regulator (RPGR) gene. Retinitis pigmentosa caused by RPGR accounts for 70%–90% of XLRP. Nearly 300 RPGR mutation genes have been identified. Compared with other causes of RP caused by autosomal inheritance, X-linked RP often has a more severe phenotype. Symptoms of XLRP retinitis pigmentosa usually occur in childhood. Clinical studies have found that 5 years old (range 0-14 years old) is the median age of symptom onset, and the symptoms of patients are mainly night blindness and peripheral vision loss. Compared with RP caused by other gene mutations, patients with RPGR gene mutation-related RP have a faster rate of vision loss. It is reported that patients lose about 4-5% of their vision each year, which is attributed to the thinning of the fovea of ​​the retina and the rapid apoptosis of cells in the outer nuclear layer.

[0004] There are two major transcripts of human RPGR, RPGR EX1-19 and RPGR ORF15 , they share exons 1-14 containing the RCC1-like domain. Ex1–19 Widely expressed in multiple tissues, RPGR Ex1-19The isoform contains 19 exons, expressing a full-length messenger RNA transcript of 2448 bp, generating 815 amino acids and forming a protein of approximately 90 kDa in various tissues. ORF15 Exomes contain more than 70% of known disease-causing mutations in RPGR. This suggests that most disease-causing mutations occur in RPGR. ORF15 Among the exons of the subtype, a small number of mutations are located in exons 15-19, indicating that RPGR ORF15 Importance of isoforms in the retina. ORF15 It is only expressed in retinal photoreceptors, located in the connecting cilia of rods and cones, and is involved in the formation of cilia and the regulation of actin stress filaments. It can directly interact with a variety of transport-related proteins to form a transport complex to participate in material transport. ORF15 It is 3459 bp and encodes a 1152 amino acid sequence, forming a protein of approximately 200 kDa. As with the ubiquitously expressed transcript, amino acids 54-367 (exons 3-10) are regulators of the RCC1-like domain. RPGR ORF15 It contains a unique 3′-terminal ORF15 exon encoding two key functional domains: a highly repetitive glycine / glutamate-rich domain and a C-terminal basic domain with homology to tubulin.

[0005] There are currently three mouse models used in research related to Rpgr gene mutations:

[0006] (1) Spontaneous animal models: Spontaneous animal models refer to mouse models in which gene mutations occur under natural conditions.

[0007] (2) Experimental animal models: Experimental animal models refer to mouse models constructed through artificial gene editing technology. The Rpgr KO (Rpgr knockout) model is to completely eliminate the Rpgr protein by knocking out exons 4-6 of the Rpgr gene, thereby causing mice to suffer from RP.

[0008] (3) Rpgr-CKO mouse model (Rpgr conditional knockout): In this model mouse, 3189 bp of the Rpgr gene was knocked out, including the proximal promoter and exons 1-3, resulting in the loss of Rpgr gene expression.

[0009] The three mouse models mentioned above have their own characteristics, but they all face common challenges:

[0010] First, these models are expensive, with a single model mouse costing tens of thousands of yuan, greatly increasing the economic cost of research.

[0011] Second, the cultivation cycle of these models is generally long, which will inevitably extend the experimental cycle and thus increase the time cost of the research.

[0012] Third, all offspring of these models lack the Rpgr gene. Researchers cannot obtain normal mice with the same genetic background, making it impossible to accurately evaluate the specific effects of Rpgr gene knockout on visual function, nor to provide ideal control conditions for subsequent treatment studies.

[0013] Therefore, in further research, it is necessary to find a method to obtain Rpgr gene knockout mice and normal mice in the same genetic background. Summary of the invention

[0014] In order to solve the above technical problems, the present invention provides the following technical solutions.

[0015] In a first aspect, the present invention provides a gRNA expression cassette.

[0016] A gRNA expression cassette comprising a gRNA L2 sequence shown in SEQ ID NO.3 or a functional variant having at least 80% identity with SEQ ID NO.3 and a gRNA R2 sequence shown in SEQ ID NO.4 or a functional variant having at least 80% identity with SEQ ID NO.4.

[0017] In some embodiments, the gRNA L2 sequence is a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO.3.

[0018] In some embodiments, the gRNA R2 sequence is a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO.4.

[0019] In some embodiments, the gRNA expression box also includes a Scaffold sequence (sequence responsible for Cas9 binding) shown in SEQ ID NO.6 or a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO.6.

[0020] In some embodiments, the gRNA expression cassette comprises two Scaffold sequences, and the two Scaffold sequences are each operably connected to the gRNA R2 sequence and the gRNA L2 sequence.

[0021] In some embodiments, the gRNA expression cassette further comprises a U6 promoter sequence.

[0022] In some embodiments, the U6 promoter sequence is operably linked to the gRNA L2 sequence.

[0023] In some embodiments, the U6 promoter sequence is a nucleotide sequence fragment of positions 246-486 in SEQ ID NO.7 or a U6 promoter sequence of a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence fragment of positions 246-486 in SEQ ID NO.7.

[0024] In some embodiments, the gRNA expression cassette further comprises an EF1α sequence.

[0025] In some embodiments, the EF1α sequence is operably linked to a Scaffold sequence following the gRNA L2 sequence.

[0026] In some embodiments, the EF1α sequence is a nucleotide sequence fragment of positions 642-853 in SEQ ID NO.7 or a functional variant EF1α sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence fragment of positions 642-853 in SEQ ID NO.7.

[0027] In some embodiments, the gRNA expression cassette further comprises a Cre sequence.

[0028] In some embodiments, the Cre sequence is operably linked to an EF1α sequence.

[0029] In some embodiments, the Cre sequence is a nucleotide sequence fragment of positions 902-1927 in SEQ ID NO.7 or a Cre sequence of a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence fragment of positions 902-1927 in SEQ ID NO.7.

[0030] In some embodiments, the gRNA expression cassette further comprises a WPRE sequence.

[0031] In some embodiments, the WPRE sequence is operably linked to a Cre sequence.

[0032] In some embodiments, the WPRE sequence is a nucleotide sequence fragment of positions 1943-2531 in SEQ ID NO.7 or a functional variant WPRE sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence fragment of positions 1943-2530 in SEQ ID NO.7.

[0033] In a second aspect, the present invention provides a recombinant gRNA expression vector.

[0034] A recombinant gRNA expression vector, wherein the recombinant gRNA expression vector is an expression vector comprising the gRNA expression cassette described in the first aspect.

[0035] In some embodiments, the expression vector is an adeno-associated virus.

[0036] In some embodiments, the method for preparing the recombinant gRNA expression vector comprises:

[0037] (1) Annealing to prepare gRNA L2 fragment and gRNA R2 fragment respectively;

[0038] (2) Enzyme digestion of pAAV-U6-Scaffold-EF1α-Cre vector;

[0039] (3) inserting the gRNA L2 fragment and the gRNA R2 fragment obtained in step (1) into the pAAV-U6-Scaffold-EF1α-Cre vector obtained after enzyme digestion in step (2) using a ligase, respectively, to obtain pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid and pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid, respectively;

[0040] (4) Recovering the U6-gRNAR2-Scaffold fragment in the pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid by enzyme digestion, or recovering the U6-gRNAL2-Scaffold fragment in the pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid by enzyme digestion;

[0041] (5) Enzyme-digesting the pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid and using a ligase to insert the U6-gRNAR2-Scaffold fragment into the pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid after enzyme digestion to obtain a pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre plasmid; or enzyme-digesting the pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid and using a ligase to insert the U6-gRNAL2-Scaffold fragment into the pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid after enzyme digestion to obtain a pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre plasmid.

[0042] In some embodiments, the pAAV-U6-Scaffold-EF1α-Cre vector is a pAAV plasmid having a nucleotide sequence obtained by deleting gRNA Scrambled (SEQ ID NO.5) in SEQ ID NO.7.

[0043] In some embodiments, the nucleotide sequence of the pAAV-U6-Scaffold-EF1α-Cre vector is a nucleotide sequence obtained by deleting gRNA Scrambled (SEQ ID NO.5) in SEQ ID NO.7, or a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the nucleotide sequence obtained by deleting gRNA Scrambled (SEQ ID NO.5) in SEQ ID NO.7.

[0044] In some embodiments, the nucleotide sequence of the pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre plasmid is as shown in SEQ ID NO.8 or a functional variant having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO.8.

[0045] In some embodiments, the preparation method further comprises plasmid transformation and extraction, virus packaging and / or purification and concentration.

[0046] In some embodiments, the gRNA expression vector contains the nucleotide sequence of the pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre plasmid.

[0047] In a third aspect, the present invention provides a reagent.

[0048] A reagent comprising the expression cassette described in the first aspect, the recombinant gRNA expression vector described in the second aspect, or comprising the recombinant gRNA expression vector described in the second aspect and an expression vector containing a nucleotide sequence expressing Cas9.

[0049] In a fourth aspect, the present invention provides a kit.

[0050] A kit comprising a reagent for the recombinant gRNA expression vector described in the second aspect and a reagent for an expression vector containing a nucleotide sequence for expressing Cas9.

[0051] In a fifth aspect, the present invention provides a method for constructing an Rpgr gene knockout mouse model.

[0052] A method for constructing an Rpgr gene knockout mouse model comprises the following steps:

[0053] The recombinant gRNA expression vector described in the second aspect and the expression vector containing the nucleotide sequence expressing Cas9 are injected into mice by subretinal injection, and the Rpgr gene knockout mouse model is obtained by using CRISPR / Cas9 gene editing technology;

[0054] Alternatively, the recombinant gRNA expression vector described in the second aspect is injected into a mouse by subretinal injection, and the CRISPR / Cas9 gene editing technology is used to obtain an Rpgr gene knockout mouse model; the mouse is a mouse with the CRISPR / Cas9 gene knocked in.

[0055] In a sixth aspect, the present invention provides an application of the aforementioned expression cassette, recombinant gRNA expression vector, reagent, kit or the Rpgr gene knockout mouse model obtained by the construction method.

[0056] A use of the Rpgr gene knockout mouse model obtained by the expression cassette of the first aspect, the recombinant gRNA expression vector of the second aspect, the reagent of the third aspect, the kit of the fourth aspect or the construction method of the fifth aspect in screening or developing drugs for preventing or treating retinitis pigmentosa or X-linked retinitis pigmentosa.

[0057] Beneficial Effects

[0058] Compared with the prior art, a certain embodiment of the present invention has at least one of the following beneficial effects:

[0059] (1) The present invention establishes a CRISPR / Cas9 system in the mouse retina to specifically knock out the Rpgr gene in the retina. The resulting model has good knockout effect, high efficiency, good persistence after knockout, and intact retinal tissue structure. The present invention preferably uses gRNA L2 and gRNA R2 to knock out the Rpgr gene in the mouse retina.

[0060] (2) The present invention performs site-specific knockout of the Rpgr gene in the retina, while the Rpgr gene in other organs of the body is retained (because it is a subretinal injection, the eyeball is an immune-exempt organ and will not circulate throughout the body and will not affect other organs of the body). Therefore, it does not affect the development of mice and the functions of other organs, especially the testicular function of male mice, thereby ensuring the fertility of the knockout mice.

[0061] (3) Compared with the selective knockout mice constructed using the Cre-Loxp system, the technical solution of the present invention is less time-consuming, simpler, more flexible, and does not require large-scale screening. It not only avoids the damage of systemic knockout to the functions of other organs of mice, but also greatly saves research time and improves research efficiency.

[0062] (4) The present invention can simultaneously obtain Rpgr gene knockout mice and normal mice under the same genetic background. This helps to more accurately reveal the role of the Rpgr gene in visual function and provide ideal control conditions for subsequent treatment studies. At the same time, it has a lower cost and reduces the economic burden of research.

[0063] (5) Compared with the problem of long culture cycle of traditional models, the model construction time of the present invention is shorter, which helps to shorten the experimental cycle and improve research efficiency.

[0064] Terminology

[0065] In the description of the present invention, the term "room temperature" means ambient temperature, which refers to a temperature of about 10°C to about 30°C, or about 20°C to 30°C, or about 25°C. The term "wt%" means mass percentage. The term "W / W" means mass ratio. The term "kb" means kilobase pair.

[0066] The term "subretinal injection" (SI) refers to the injection of a therapeutic solution into the subretinal space between the photoreceptors and the retinal pigment epithelium (RPE).

[0067] The "Gene ID" number described herein (eg, Gene ID: 6010) is a number provided by the gene-specific database of the National Center for Biotechnology Information (URL: https: / / www.ncbi.nlm.nih.gov / ).

[0068] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0069] In the following, all numbers disclosed herein are approximate, regardless of whether the word "about" or "approximately" is used. The value of each number may vary by 1%, 2%, 5%, 7%, 8%, 10%, 15% or 20%. Whenever a number with a value of N is disclosed, any number with a value of N+ / -1%, N+ / -2%, N+ / -3%, N+ / -5%, N+ / -7%, N+ / -8%, N+ / -10%, N+ / -15% or N+ / -20% will be explicitly disclosed, where "+ / -" means plus or minus.

[0070] When used in this article, the term "nucleic acid" or "polynucleotide" refers to the polymeric form of nucleotides of any length, and the nucleotides can be ribonucleotides or deoxyribonucleotides. Therefore, the term includes but is not limited to single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids or polymers comprising non-natural or derived nucleotide bases of purine and pyrimidine bases or other natural, chemical or biochemical modifications. The backbone of the polynucleotide can include sugar and phosphate groups (as can be usually present in RNA or DNA) or modified or substituted sugar or phosphate groups. Alternatively, the backbone of the polynucleotide can include synthetic subunits such as polymers of phosphoramidates, and therefore can be oligodeoxynucleoside phosphoramidates (P-NH2) or mixed phosphoramidate-phosphodiester oligomers. Nucleic acid of the present invention can be prepared by any technology well known to those skilled in the art, including chemical synthesis, reorganization and mutation. In a preferred embodiment, nucleic acid of the present invention is a DNA molecule, which is preferably synthesized by recombinant methods well known to those skilled in the art.

[0071] As used herein, the term "sequence identity" or "identity" refers to the number (%) of position matches (identical nucleic acid residues) obtained from the alignment of two polynucleotide sequences. Sequence identity is determined by comparing the sequences while aligning to maximize overlap and identity and simultaneously minimize sequence gaps. In particular, sequence identity can be determined using any of a variety of mathematical global or local alignment algorithms, depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., the Needleman and Wunsch algorithm; Needleman and Wunsch, 1970) that optimally aligns the sequences over their entire length, while sequences of significantly different lengths are preferably aligned using a local alignment algorithm (e.g., the Smith and Waterman algorithm (Smith and Waterman, 1981) or the Altschul algorithm (Altschul et al., 1997; Altschul et al., 2005). Alignment for the purpose of determining percent nucleic acid sequence identity can be achieved in a variety of different ways that are within the skill in the art, for example, using publicly available computer software available on Internet websites such as http: / / blast.ncbi.nlm.nih.gov / or http: / / www.ebi.ac.uk / Tools / emboss / . One skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For purposes of the present invention, percent nucleic acid sequence identity values ​​refer to the alignment of the sequences using the pairwise sequence alignment program EMBOSS. The value generated by Needle, the program uses the Needleman-Wunsch algorithm to produce the best global alignment of two sequences, wherein all search parameters are set to the default values, i.e., scoring matrix=BLOSUM62, gap opening=10, gap extension=0.5, terminal gap penalty=false, terminal gap opening=10, terminal gap extension=0.5.

[0072] As used herein, the term "variant" refers to a nucleotide sequence that is different from the original sequence but retains its essential properties. In general, a variant is closely similar to the original polynucleotide overall and is consistent in many regions. The sequence of a variant may differ in nucleotide substitutions, deletions or insertions of one or more nucleotides in the sequence that do not impair the promoter activity. A variant may have the same length as the original sequence, or may be shorter or longer.

[0073] The term "functional variant" refers to a variant that exhibits the activity of the corresponding nucleotide sequence, for example, a functional variant of SEQ ID NO.8 is a variant that expresses the activity of SEQ ID NO:8.

[0074] The term "nucleotide sequence fragment at position nm in SEQ ID NO.7" means the nucleotide sequence fragment between the nth base and the mth base (including the nth base and the mth base), starting from the first base in SEQ ID NO.7 as position 1.

[0075] The term "expression cassette" refers to a nucleic acid construct comprising a coding sequence and one or more control sequences required for the expression of the coding sequence. In particular, one of these control sequences is a promoter of the present invention. Typically, the expression cassette comprises a coding sequence required for expressing a selected gene product and regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. Therefore, the expression cassette typically comprises a promoter sequence, a coding sequence, and a 3' non-translated region that typically contains a polyadenylation site and / or a transcription terminator. The expression cassette may also comprise other regulatory elements, such as an enhancer sequence, a polylinker sequence and / or a splicing signal sequence that facilitates the insertion of a DNA fragment in a vector. The expression cassette is typically contained in a vector for ease of cloning and transformation.

[0076] The term "operably linked" as used herein refers to the association of nucleic acid sequences on a single nucleic acid molecule such that the function of one is affected by the other. For example, a promoter is operably linked to a coding sequence when the promoter is capable of affecting the expression of the coding sequence, i.e., the coding sequence is under the transcriptional control of the promoter.

[0077] The term "vector" refers to a nucleic acid molecule used as a medium to transfer genetic material in vitro or in vivo, particularly to deliver nucleic acid into a host cell. Vectors include, but are not limited to, plasmids, phagemids, cosmids, transposable elements, viruses, and artificial chromosomes (e.g., YACs).

[0078] The human parvovirus adeno-associated virus (AAV) is a dependent virus that is naturally defective with respect to replication and is able to integrate into the genome of infected cells to establish a latent infection. The last property appears to be unique among mammalian viruses, as the integration occurs at a specific site in the human genome located on chromosome 19 called AAVS1 (19q13.3-qter). Therefore, AAV has attracted considerable interest as a potential vector for human gene therapy. The favorable properties of the virus include its lack of association with any human disease, its ability to infect both dividing and non-dividing cells, and the ability to infect a wide range of cell lines derived from different tissues.

[0079] The promoter or expression cassette of the present invention can be introduced into the vector by any method known to the skilled person.

[0080] The expression cassette or vector of the present invention can be transferred into a host cell using any known technique, including but not limited to calcium phosphate-DNA precipitation, DEAE-Dextran transfection, electroporation, microinjection, gene gun, lipofection or viral infection, and the expression cassette or vector of the present invention can be maintained in the host cell in an ectopic form, or can be integrated into the genome.

[0081] These compositions comprise a therapeutically effective amount of a therapeutic agent (an expression cassette, vector, virion or cell of the invention) and a pharmaceutically acceptable excipient. As used herein, the term "pharmaceutically acceptable" means approved for use in animals and / or humans by a regulatory agency or a recognized pharmacopoeia such as the European Pharmacopoeia. The term "excipient" refers to a diluent, adjuvant, carrier or vehicle with which a therapeutic agent is administered. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 This is the plasmid map of pAAV-U6-gScrambled-Scaffold-EF1α-Cre obtained in Example 1.

[0083] Figure 2 This is the plasmid map of pAAV-U6-gRNAL1-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre obtained in Example 1.

[0084] Figure 3 This is the plasmid map of pAAV-U6-gRNAL1-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre obtained in Example 1.

[0085] Figure 4 This is the plasmid map of pAAV-U6-gRNAL2-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre obtained in Example 1.

[0086] Figure 5 This is the plasmid map of pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre obtained in Example 1.

[0087] Figure 6The fluorescence detection diagram of mice injected with different viral vectors on the 180th day after birth after DAPI and Rhodopsin antibody staining in Example 4. Among them, gScrambled means injection of gScrambled viral vector; L1+R1 means injection of L1+R1 viral vector, L1+R2 means injection of L1+R2 viral vector, L2+R1 means injection of L2+R1 viral vector, and L2+R2 means injection of L2+R2 viral vector.

[0088] Figure 7 This is a statistical chart of ONL thickness of mice injected with different viral vectors on the 180th day after birth in Example 4, where ONH stands for Optic Nerve Head; "distance from ONH" is used to describe the distance from a certain point on the retina to the optic nerve head. Among them, gScrambled means injection of gScrambled viral vector; L1+R1 means injection of L1+R1 viral vector, L1+R2 means injection of L1+R2 viral vector, L2+R1 means injection of L2+R1 viral vector, and L2+R2 means injection of L2+R2 viral vector.

[0089] Figure 8 These are fluorescence detection images of the experimental group Cas9 transgenic mice in Example 5 after DAPI and Rhodopsin antibody staining at different days after birth, and fluorescence detection images of the control group Cas9 transgenic mice after DAPI and Rhodopsin antibody staining at 180 days after birth (P180) (the thickness of the retinal ONL layer of the control group Cas9 transgenic mice remained unchanged from 1 to 180 days; and the thickness of the control group Cas9 transgenic mice is theoretically consistent with that of the uninjected mice, and the thickness will not decrease, so the results only show the results of the control group at 180 days).

[0090] Fig. 9 These are fluorescence detection images of the experimental group Cas9 transgenic mice in Example 5 after DAPI and PNA antibody staining on different days after birth, and fluorescence detection images of the control group Cas9 transgenic mice after DAPI and PNA antibody staining on the 180th day (P180) after birth (the thickness of the retinal ONL layer of the control group Cas9 transgenic mice remained unchanged from 1 to 180 days; and the thickness of the control group Cas9 transgenic mice is theoretically consistent with that of the uninjected mice, and the thickness will not decrease, so the results only show the results of the control group at 180 days).

[0091] Fig.10The ONL thickness statistics of the experimental group Cas9 transgenic mice in Example 5 at different days after birth and the ONL thickness statistics of the control group Cas9 transgenic mice at 180 days after birth (P180) (the thickness of the retinal ONL layer of the control group Cas9 transgenic mice remained unchanged from 1 to 180 days; and the thickness of the control group Cas9 transgenic mice was theoretically consistent with that of the uninjected mice, and the thickness would not decrease, so the results only showed the results of the control group at 180 days).

[0092] Fig.11 This is a graph showing the ERG test results of the experimental group Cas9 transgenic mice of Example 6 at different days after birth and the control group Cas9 transgenic mice at 180 days after birth.

[0093] In the attached figure, Rpgr gScrambled The results of the control group Cas9 transgenic mice on the 180th day after birth; Rpgr KO-P40 The results of the experimental group of Cas9 transgenic mice on the 40th day after birth; Rpgr KO-P90 The results of the experimental group of Cas9 transgenic mice on the 90th day after birth; Rpgr KO-P120 The results of the experimental group of Cas9 transgenic mice on the 120th day after birth; Rpgr KO-P180 Represents the results of the experimental group of Cas9 transgenic mice on the 180th day after birth. DETAILED DESCRIPTION

[0094] In order to enable those skilled in the art to better understand the technical solution of the present invention, some non-limiting embodiments are further disclosed below to further describe the present invention in detail.

[0095] The reagents used in the present invention can be purchased from the market or prepared according to conventional methods in the art or can be prepared by the method described in the present invention.

[0096] The gScrambled viral vector, L1+R1 viral vector, L1+R2 viral vector, L2+R1 viral vector, L2+R2 viral vector, and pAAV-U6-gRNAL1-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre (the sequence is that the SEQ ID NO.3 fragment in SEQ ID NO.8 is replaced by the SEQ ID NO.1 fragment, and the SEQ ID NO.4 fragment in SEQ ID NO.8 is replaced by the SEQ ID NO.2 fragment) provided by the present invention,

[0097] pAAV-U6-gRNAL1-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre (the sequence is the SEQ ID NO.3 fragment in SEQ ID NO.8 replaced with the SEQ ID NO.1 fragment),

[0098] pAAV-U6-gRNAL2-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre (the sequence is the SEQ ID NO.4 fragment in SEQ ID NO.8 replaced with the SEQ ID NO.2 fragment),

[0099] pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre (sequence: SEQ ID NO. 8) can be prepared according to the following examples, or prepared using conventional methods in the art based on the sequence provided by the present invention.

[0100] Cas9 transgenic mice were purchased from The Jackson Laboratory and raised in the SPF-level experimental animal center of Wuhan University of Science and Technology. The most suitable humidity and temperature, sufficient food and water sources, and 12-hour light-dark alternation were provided during the breeding process. All animal experimental equipment and materials used in the experiment were evaluated and approved by the Animal Ethics Committee of Wuhan University of Science and Technology. During the experiment, all experimental operations on mice complied with the ethical standards of experimental animals.

[0101] Example 1: Construction of recombinant vector

[0102] 1. Design of gRNA

[0103] Four gRNAs were designed for knockout based on the fifth exon region of Rpgr, namely gRNA L1, gRNA R1, gRNAL2, and gRNA R2. The control group was gRNA Scrambled.

[0104] gRNA L1: GGTGGCGTATATGCAGCTGG (SEQ ID NO.1);

[0105] gRNA R1: GCCAGCAGAGAGCTGTTTAA (SEQ ID NO. 2);

[0106] gRNA L2: GAAATAATGAAGGTCAACTG (SEQ ID NO.3);

[0107] gRNA R2: AGTAAGAGCAGCGGATGTAT (SEQ ID NO.4);

[0108] gRNA Scrambled: CCTAAGGTTAAGTCGCCCTC (SEQ ID NO. 5).

[0109] 2. AAV plasmid construction

[0110] (1) Annealing: Prepare the annealing system shown in Table 2 (where the Forward oligo and Reverse oligo corresponding to each gRNA are shown in Table 1). After the preparation is completed, perform the annealing program shown in Table 1.

[0111] Table 1: Forward oligo and Reverse oligo corresponding to each gRNA

[0112]

[0113] Table 2: Annealing system (25 μL system)

[0114] name volume Forward oligo 5μL Reverse oligo 5μL 10×annealing buffer 2.5μL <![CDATA[ddH2O]]> 12.5μL

[0115] Table 3: Annealing schedule

[0116] program Duration 95℃ 20min Room temperature 4h

[0117] (2) The plasmid pAAV-U6-Scaffold-EF1α-Cre vector (a pAAV plasmid having a nucleotide sequence obtained by deleting gRNAScrambled (SEQ ID NO.5) from SEQ ID NO.7, which can be prepared according to conventional methods) is subjected to enzyme digestion, and the enzyme digestion system is as shown in the table. Vector digestion: prepare the enzyme digestion system shown in Table 4.

[0118] Table 4: Enzyme digestion system (80 μL system)

[0119] name Dosage pAAV-U6-Scaffold-EF1α-Cre vector 2μg Endonuclease BbsⅠ 1.5μL 10×Fast digest buffer 8μL <![CDATA[ddH2O]]> To 80μL

[0120] (3) The annealed gScrambled, gRNAL1, gRNAL2, gRNAR1 and gRNAR2 sequences were respectively inserted into the plasmid pAAV-U6-EF1α-Cre by T4 ligase to construct the following recombinant plasmids:

[0121] pAAV-U6-gScrambled-Scaffold-EF1α-Cre (sequence is SEQ ID NO.7; plasmid map is Figure 1), pAAV-U6-gRNAR1-Scaffold-EF1α-Cre (the sequence is gRNA Scrambled (SEQ ID NO.5) in SEQ ID NO.7 replaced with SEQ ID NO.2),

[0122] pAAV-U6-gRNAR2-Scaffold-EF1α-Cre (the sequence is gRNAScrambled (SEQ ID NO.5) in SEQ ID NO.7 replaced with SEQ ID NO.4),

[0123] pAAV-U6-gRNAL1-Scaffold-EF1α-Cre (the sequence is gRNAScrambled (SEQ ID NO.5) in SEQ ID NO.7 replaced with SEQ ID NO.1),

[0124] pAAV-U6-gRNAL2-Scaffold-EF1α-Cre (the sequence is gRNAScrambled (SEQ ID NO.5) in SEQ ID NO.7 replaced with SEQ ID NO.3).

[0125] (4) pAAV-U6-gRNAR1-Scaffold-EF1α-Cre and

[0126] The pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid was digested, and the U6-gRNAR1-Scaffold fragment (sequence fragment of U6 promoter (nucleotide sequence fragment of positions 246-486 in SEQ ID NO.7) + gRNA R1 (SEQID NO.2) + Scaffold sequence (SEQ ID NO.6)) and U6-gRNAR2-Scaffold fragment (sequence fragment of U6 promoter (nucleotide sequence fragment of positions 246-486 in SEQ ID NO.7) + gRNA R2 (SEQ ID NO.4) + Scaffold sequence (SEQ ID NO.6)) were purified and recovered. The enzyme digestion system is shown in Table 5.

[0127] Table 5: Enzyme digestion system (80 μL system)

[0128] name Dosage Plasmids 2μg Endonuclease Bgl II 1.5μL Endonuclease Not I 1.5μL 10×Fast digest buffer 8μL <![CDATA[ddH2O]]> To 80μL

[0129] (5) pAAV-U6-gRNAL1-Scaffold-EF1α-Cre and

[0130] The pAAV-U6-gRNAL2-Scaffold-EF1α-Cre vector was digested with enzymes, and the enzyme digestion system is shown in Table 6.

[0131] Table 6: Enzyme digestion system (80 μL system)

[0132] name Dosage Carrier 2μg Endonuclease Bsa I 1.5μL 10×Fast digest buffer 8μL <![CDATA[ddH2O]]> To 80μL

[0133] (6) The U6-gRNAR1-Scaffold and U6-gRNAR2-Scaffold fragments were inserted into the plasmids pAAV-U6-gRNAL1-Scaffold-EF1α-Cre and pAAV-U6-gRNAL2-Scaffold-EF1α-Cre, respectively, by T4 ligase to construct pAAV-U6-gRNAL1-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre (the sequence is SEQ ID NO.8 The SEQ ID NO.3 fragment is replaced by the SEQ ID NO.1 fragment, and the SEQ ID NO.4 fragment in SEQ ID NO.8 is replaced by the SEQ ID NO.2 fragment; the plasmid map is Figure 2 ),

[0134] pAAV-U6-gRNAL1-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre (the sequence is SEQ ID NO.3 fragment in SEQ ID NO.8 replaced with SEQ ID NO.1 fragment; the plasmid map is Figure 3 ), pAAV-U6-gRNAL2-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre (the sequence is the SEQ ID NO.4 fragment in SEQ ID NO.8 replaced with the SEQ ID NO.2 fragment; the plasmid map is Figure 4 ), pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre (sequence is SEQ ID NO.8; plasmid map is Figure 5 ).

[0135] 3. Plasmid transformation and extraction:

[0136] (7) Take pAAV-U6-gScrambled-Scaffold-EF1α-Cre and pAAV-U6-gRNAL1-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre prepared in step 2 respectively.

[0137] pAAV-U6-gRNAL1-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre,

[0138] pAAV-U6-gRNAL2-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre,

[0139] pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre, perform plasmid transformation and extraction according to the following steps:

[0140] (1) Take out the DH5-α competent cell from the -80℃ freezer and quickly thaw it on ice for 15 min. Meanwhile, place the ligation product on ice to cool down. When taking out the competent cell, avoid touching the bottom of the tube.

[0141] (2) After the competent cells are completely thawed, pipette all the ligation products into the competent cells in a clean bench and gently add them to the competent cells. Place on ice for 10 min to allow the ligation products and competent cells to fully contact.

[0142] (3) Place the above centrifuge tube on a float and heat shock it in a 42°C water bath for 90 seconds. Take it out and quickly place it on ice for 10 minutes.

[0143] (4) Place the ice box in a clean bench, slowly add 500 μL of room temperature antibiotic-free LB medium to the centrifuge tube, and then place it in a 37°C constant temperature shaker and culture at 180 rpm for 1 hour. Wipe the glass coating rod with an alcohol cotton ball and place it in the outer flame of an alcohol lamp to burn and sterilize it. Then place the treated coating rod in a clean bench to cool.

[0144] (5) After removing the ligation product from the shaker, centrifuge at 3000 rpm for 3 min at room temperature. During the centrifugation process, add 20 μL of antibiotics to the LB plate containing resistance and spread it evenly with a spreader. After centrifugation, aspirate 500 μL of supernatant and use a small-range pipette to blow the remaining bacterial solution evenly. Pipette 100 μL of bacterial solution onto the LB plate containing antibiotics, spread the bacterial solution evenly with the spreader that was cooled after burning in step ④, and place it in a 37°C constant temperature incubator and invert it overnight for incubation.

[0145] (6) Cultivation: After transformation, use sterilized tweezers to pick up a single colony on the plate with a 10 μL pipette tip in a clean bench, and then place the pipette tip into a 5 mL LB liquid culture medium containing 1% antibiotics in a shaking tube. After marking, place the tube in a 37°C constant temperature shaker at 220 rpm for overnight culture.

[0146] (7) Extraction:

[0147] ① Centrifuge at 4000 rpm for 10 min at room temperature. Discard the supernatant, drain the remaining liquid, and collect the precipitated bacteria.

[0148] ② Add 500 μL of Buffer P1 to which RNase A has been added, resuspend the bacteria by vortexing, and transfer them into a labeled 2 mL sterile centrifuge tube.

[0149] ③ Add 500 μL Buffer P2 and mix gently by inverting up and down 20 times.

[0150] ④ Add 500 μL Buffer P4 (perform within 5 minutes after completing step ③), gently invert up and down to mix 20 times, let stand at room temperature for 10 minutes, and centrifuge at 12000 rpm for 10 minutes.

[0151] ⑤ Pipette 700 μL of supernatant into filter column CS. Centrifuge at 12000 rpm for 2 min at room temperature, collect the filtrate in a clean 2 mL centrifuge tube and record the filtrate volume.

[0152] ⑥ Add 0.3 times the volume of isopropanol to the filtrate, mix by inversion, Vortex, flash, and transfer the filtrate to the CP4 adsorption column in batches. Let it stand at room temperature for 1 minute, then centrifuge at 12000 rpm for 1 minute and discard the waste liquid.

[0153] ⑦ Add 500 μL of deproteinized solution PD to the adsorption column and let it stand at room temperature for 1 min. Centrifuge at 12000 rpm for 1 min and discard the waste liquid.

[0154] ⑧ Add 600 μL of rinse solution PW and let stand at room temperature for 5 min. Centrifuge at 12000 rpm for 1 min and discard the waste liquid. Repeat this step. Then centrifuge at 12000 rpm for 2 min.

[0155] ⑨Place the CP4 adsorption column in a clean 1.5mL centrifuge tube and air dry for 10 minutes. Add 50μL tris HCl buffer, let it stand at room temperature for 5 minutes, centrifuge at 12000rpm for 2 minutes, and discard the adsorption column CP4.

[0156] ⑩After measuring the concentration, freeze at -20℃.

[0157] Example 2: Preparation, purification and concentration of AAV

[0158] The plasmids extracted in step 3 of Example 1 were respectively packaged and purified and concentrated according to the following methods to obtain:

[0159] gScrambled viral vector (with pAAV-U6-gScrambled-Scaffold-EF1α-Cre as the destination plasmid);

[0160] L1+R1 viral vector (pAAV-U6-gRNAL1-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre is the target plasmid);

[0161] L1+R2 viral vector (pAAV-U6-gRNAL1-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre is the target plasmid);

[0162] L2+R1 viral vector (pAAV-U6-gRNAL2-Scaffold-U6-gRNAR1-Scaffold-EF1α-Cre is the target plasmid);

[0163] L2+R2 viral vector (pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre is the target plasmid).

[0164] Virus packaging system: three-plasmid system, plasmid pAAV2 / 8, plasmid pAAV-Helper and target plasmid (one of the plasmids extracted in step 3 of Example 1).

[0165] 1. Operation:

[0166] (1) First, HEK293T cells reaching 90% cell density were passaged at a ratio of 1:4 to ensure that the cell density reached about 85% after 24 hours. During this process, Hyclone high-glucose DMEM medium containing 10% FBS was used for cell culture.

[0167] (2) 2 hours before transfection, the culture medium was replaced with serum-free medium. Subsequently, the transfection plasmids (plasmid pAAV2 / 8, plasmid pAAV-Helper and target plasmid) were added to DMEM without FBS to prepare Mix 1. At the same time, PEI was added to another portion of DMEM without FBS to prepare Mix 2.

[0168] (3) Mix Mix 1 and Mix 2 separately, and then add Mix 2 dropwise to Mix 1. Incubate at room temperature for 30 minutes, and then drip into the culture dish dropwise.

[0169] (4) 24 hours after transfection, replace the medium with serum-free medium. Repeat this step every 24 hours until 60 hours after transfection.

[0170] (5) 60 hours after transfection, collect the cells and culture medium into a 50 mL centrifuge tube and centrifuge at 2000 rpm for 15 minutes. After discarding the supernatant, lyse the cells, retain the precipitate after cell lysis, and extract the virus from it.

[0171] (6) Prepare 15%, 25%, 40% and 60% iodixanol solutions respectively. Place the ultrafiltration tube on a tube rack, and use an electric pipette to slowly add different concentrations of iodixanol to the ultrafiltration tube layer by layer, and finally add the virus lysis solution. After balancing, perform ultracentrifugation.

[0172] (7) After centrifugation, remove the ultrafiltration tube and insert a syringe needle into the bottom of the ultrafiltration tube. Use the needle to puncture the bottom of the 40% iodixanol solution layer in the ultrafiltration tube and collect the AAV virus into a 15 mL centrifuge tube. Subsequently, inject the collected virus solution into the concentration column, add PBS to the column until full, mix well, and centrifuge at 4000 rpm for 1 hour at 4°C.

[0173] (8) The remaining liquid in the ultrafiltration tube was repeatedly blown and then aspirated into the virus storage tube, and then the virus storage solution was added, and the virus name and preparation time and other related information were marked. The concentrated virus solution was vortexed to mix and then centrifuged. 10 μL of the virus solution was taken out for qPCR virus titer detection. If the titer is 2.0×10 13 -5.0×10 13 VG / mL, store the virus in a -80℃ refrigerator and mark the information until use.

[0174] Example 3: Subretinal injection

[0175] The gScrambled viral vector, L1+R1 viral vector, L1+R2 viral vector, L2+R1 viral vector, and L2+R2 viral vector obtained in Example 2 were respectively taken for subretinal injection modeling of Cas9 transgenic mice according to the following steps.

[0176] (1) After weighing and anesthetizing the Cas9 transgenic mice, adjust the head position of the mice so that the eyeballs of the mice remain at the level of the corneal limbus.

[0177] (2) Using Vannas straight scissors, make an incision of approximately 1.5 mm along the closed eyelid.

[0178] (3) Use curved dressing forceps to spread the eyelids apart to support the eye and pinch the eyelid slightly under the eye to lift it for injection.

[0179] (4) Make a small scleral incision at or behind the equator of the eyeball, just enough to allow the tip of the injection needle to pass through.

[0180] (5) Carefully insert the injection needle into the incision site and parallel to the outer wall of the eye into the subretinal space.

[0181] (6) Adjust the syringe needle and slowly inject 2 μl of the viral vector to be investigated. Leave the needle in place for 15 seconds to prevent virus reflux and quickly remove the needle.

[0182] (7) After the injection, the cornea was gently pressed to allow the eyeball to enter the eye socket. After applying erythromycin eye ointment, the mouse was placed on a heating pad to recover and observed. After the mouse woke up, it was returned to the cage for feeding.

[0183] Example 4: Immunofluorescence staining of retinal sections and data analysis

[0184] 1. Operation:

[0185] Retinal cryosections

[0186] (1) Perfusion: The mice were weighed, and then deeply anesthetized with a 300 mg / kg intraperitoneal injection of tribromoethanol solution, and fixed in a supine position. Disinfect with 75% alcohol, cut the skin along the midline of the mouse abdomen with tissue scissors, remove the mouse sternum to open the chest cavity, and fully expose the heart. Use vascular forceps to bluntly separate the soft tissue and pericardium around the heart, cut a small incision in the right atrial appendage, hold the heart with forceps in the left hand, hold the cannula in the right hand and insert it into the left ventricle from the apex of the heart, remove the inner core of the cannula, and connect it to a 4% paraformaldehyde solution for perfusion. After the perfusion is completed, the eyeballs are removed.

[0187] (2) Fixation: Place the mouse eyeball in a dissecting dish filled with 1×PBS for dissection, and cut off the cornea, retinal pigment epithelium, and excess tissue outside the eyeball wall with a dissecting instrument under a microscope. Then transfer to 4% PFA solution and fix for 30 minutes at room temperature.

[0188] (3) Dehydration: After the retina is fixed, it is transferred to PBS, the lens is removed, and then transferred to 30% sucrose solution for dehydration at 4°C for 12 hours.

[0189] (4) Tissue embedding: The retina obtained in step (3) was placed in a mixture of sucrose and OCT (1:1) and an OCT solution, respectively, and allowed to stand for 2 h.

[0190] (5) Tissue freezing: Place the embedding box on dry ice and add OCT to the embedding box. Place the retina in the embedding box and quickly adjust the retina to the appropriate position. Let it stand for 30 minutes. After the embedding agent is completely solidified, transfer the fixed sample block to a -20℃ refrigerator for short-term storage. If not used temporarily, the sample should be transferred to a -80℃ refrigerator for long-term storage.

[0191] (6) Sectioning: Heat the slicer to -13°C and slice the sample block continuously at a thickness of 20 μm.

[0192] Immunofluorescence staining

[0193] (1) PBS permeation treatment: Take the slices out of the -20℃ refrigerator and dry them at room temperature for 5-10 minutes. Use an immunohistochemistry pen to draw lines around the tissue to prevent leakage in subsequent experimental staining. Then soak the slices in PBS for 5 minutes to remove the OCT embedding solution, and then use a paper towel to absorb the remaining liquid.

[0194] (2) Permeabilization: Before staining, tissue samples need to be permeabilized. If the target protein is located in cells, permeabilization of cells is particularly important. Samples fixed with acetone do not need to be permeabilized. Incubate the samples with blocking buffer (containing 0.5% Triton X-100) for 2 hours.

[0195] (3) Primary antibody staining: The primary antibody that specifically binds to the target antigen is diluted with blocking buffer and added to the slide. It is then incubated overnight at 4°C to allow the antibody to bind to the target antigen. The primary antibody is usually conjugated to a fluorescent marker for easy observation under a microscope.

[0196] (4) PBS washing: Wash three times with PBS to remove unbound primary antibody.

[0197] (5) Secondary antibody staining: Dilute the secondary antibody with blocking buffer and add it to the slide, incubate at room temperature for 1 h.

[0198] (6) PBS washing: Wash three times with PBS to remove unbound secondary antibody.

[0199] (7) Sealing: Add appropriate mounting medium to the slide, seal it with a coverslip, and after it is completely dry, seal it all around with transparent nail polish and observe under a microscope.

[0200] Confocal imaging and data analysis

[0201] All confocal images were acquired by Olympus FV3000. All images were acquired under non-saturating conditions, and images to be compared were acquired under the same settings. The retinal ONL area on the images was quantified by using ImageJ. All images from each individual experiment were appropriately thresholded to eliminate background signals in the images before mean fluorescence intensity analysis. The threshold tool settings used for quantification of staining in the positive control specimen were repeated in each image for comparison.

[0202] 2. Results:

[0203] In vivo screening of gRNA combinations: In order to verify the knockout effect of the selected gRNA in vivo, different gRNA combinations were constructed into plasmid vectors and packaged with AAV. AAV was injected subretinaly at 14 days of age, and the retinal tissue of mice was immunofluorescently stained at P180 (180 days after birth). After comparison with DAPI and Rhodopsin antibody staining, it was found that the ONL thickness of the L2+R2 viral vector group was reduced (because Rpgr knockout can cause ONL layer cell death and thus reduce ONL layer thickness, so the knockout effect of Rpgr can be judged by ONL layer thickness), and the knockout effect was the most obvious (results see Figure 6 and Figure 7 ), and selected L2+R2 viral vector for subsequent experiments.

[0204] 3. Conclusion:

[0205] Immunofluorescence staining results showed that the L2+R2 gRNA combination was the best knockout combination and was used for subsequent experiments.

[0206] Example 5: Histological detection of knockout mice

[0207] 1. Operation

[0208] 14 days after the birth of Cas9 transgenic mice, the control group of Cas9 transgenic mice were injected with gScrambled viral vectors, and the experimental group of Cas9 transgenic mice were injected with L2+R2 viral vectors. Then, the retina of Cas9 transgenic mice was stained with DAPI, Rhodopsin, and PNA antibodies at 40, 90, 120, and 180 days after birth; and the thickness of the outer nuclear layer (ONL) was examined at 40, 90, 120, and 180 days after birth (see the results). Fig.10 ).

[0209] 2. Results:

[0210] The outer nuclear layer (ONL) is mainly composed of photoreceptor cell bodies. The DAPI staining results of the control group mice showed that the cells of the ONL were tightly arranged and had a uniform thickness with an average value of 61.6 μm. The DAPI staining of the experimental group mice revealed retinal structural damage. The thickness of the ONL decreased with the increase of time after injection. The average thickness was only 23.9 μm at P180 (see Fig.10 ), the reduction of ONL thickness indicates a massive death of photoreceptor cells.

[0211] Compared with the control group Cas9 transgenic mice of P180, it was found that the Rhodopsin and PNA of the experimental group Cas9 transgenic mice decreased with the increase of injection days, and the cone and rod cells gradually decreased and degenerated (see Figure 8 and Fig. 9). This is consistent with the phenotype of other RPGR model mice.

[0212] 3. Conclusion:

[0213] The results of immunofluorescence staining showed that the degeneration process was similar to that of spontaneous Rpgr mutant mice and other Rpgr knockout model mice currently available on the market, and the final degeneration manifestations at P180 were consistent with those of spontaneous Rpgr mutant mice and other Rpgr knockout model mice currently available on the market.

[0214] Example 6: ERG test (full-field electroretinogram test)

[0215] The ERG of the Cas9 transgenic mice in the control group and the Cas9 transgenic mice in the experimental group of Example 5 was detected at 40 days, 90 days, 120 days, and 180 days after the Cas9 transgenic mice were born.

[0216] 1. Operation:

[0217] Take Cas9 transgenic mice that have been dark-adapted for more than 12 hours, and then use tribromoethanol 300mg / kg intraperitoneal injection to anesthetize the Cas9 transgenic mice. The Cas9 transgenic mice breathe slowly after anesthesia, and 0.5% prilocaine hydrochloride eye drops are used for corneal surface anesthesia. Midori is added to dilate the pupil, and the mice are fixed on a movable animal experimental table. Then place the corneal electrode, where the recording electrode is a ring platinum electrode, fixed at the corneal margin of both eyes, and then place the reference electrode and the ground electrode on the forehead and tail, respectively. All operations are performed under dim red light. After the baseline of the display screen is stable, record the amplitude changes of the a wave and b wave of the electroretinogram.

[0218] 2. Results:

[0219] Results Fig.11 .

[0220] 14 days after birth, mice in the control group were injected with gScrambled virus vector, and mice in the experimental group were injected with L2+R2 virus vector. Fig.11 As shown, during the 180-day follow-up, under both light and dark adaptation conditions, the amplitudes of the a-wave and b-wave in the experimental group were lower than those in the control group.

[0221] The knockout of the gene affected the function of rods and cones. Compared with the control group, the amplitudes of the a-wave and b-wave of Rpgr knockout mice were significantly reduced at P40, and the amplitudes became smaller as the experiment lasted longer. At P180, ERG results showed that the retinal function of both dark and light vision was significantly impaired.

[0222] 3. Conclusion:

[0223] ERG data showed that the degeneration process was consistent with that of spontaneous Rpgr mutant mice and other Rpgr knockout model mice currently available on the market. At P180, the final degeneration performance was consistent with that of spontaneous Rpgr mutant mice and other Rpgr knockout model mice currently available on the market.

[0224] The method of the present invention has been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein within the content, spirit and scope of the present invention to implement and apply the technology of the present invention. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention.

Claims

1. A gRNA expression cassette, characterized in that Including a gRNA L2 sequence shown in SEQ ID NO.3 or a functional variant having at least 80% identity with SEQ ID NO.3 and a gRNA R2 sequence shown in SEQ ID NO.4 or a functional variant having at least 80% identity with SEQ ID NO.

4.

2. The gRNA expression cassette according to claim 1, further comprising a Scaffold sequence shown in SEQ ID NO.6 or a functional variant having at least 80% identity with SEQ ID NO.

6.

3. A recombinant gRNA expression vector, characterized in that: The recombinant gRNA expression vector is an expression vector comprising the gRNA expression cassette according to claim 1.

4. The recombinant gRNA expression vector according to claim 3, wherein the expression vector is an adeno-associated virus.

5. The recombinant gRNA expression vector according to any one of claims 3 to 4, wherein the preparation method of the recombinant gRNA expression vector comprises: (1) Annealing to prepare gRNA L2 fragment and gRNA R2 fragment respectively; (2) Enzyme digestion of pAAV-U6-Scaffold-EF1α-Cre vector; (3) inserting the gRNA L2 fragment and the gRNA R2 fragment obtained in step (1) into the pAAV-U6-Scaffold-EF1α-Cre vector obtained after enzyme digestion in step (2) using a ligase, respectively, to obtain pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid and pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid, respectively; (4) Recovering the U6-gRNAR2-Scaffold fragment in the pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid by enzyme digestion, or recovering the U6-gRNAL2-Scaffold fragment in the pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid by enzyme digestion; (5) digesting the pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid and inserting the U6-gRNAR2-Scaffold fragment into the digested pAAV-U6-gRNAL2-Scaffold-EF1α-Cre plasmid using a ligase to obtain the pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre plasmid; Alternatively, the pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid is digested with enzymes and the U6-gRNAL2-Scaffold fragment is inserted into the digested pAAV-U6-gRNAR2-Scaffold-EF1α-Cre plasmid using ligase to obtain the pAAV-U6-gRNAL2-Scaffold-U6-gRNAR2-Scaffold-EF1α-Cre plasmid; Optionally, the preparation method further comprises plasmid transformation and extraction, virus packaging, and purification and concentration.

6. The gRNA expression vector according to any one of claims 3 to 5, wherein the gRNA expression vector contains a plasmid having a nucleotide sequence as shown in SEQ ID NO.8 or a functional variant having at least 80% identity with SEQ ID NO.

8.

7. A reagent, characterized in that It comprises the expression cassette according to any one of claims 1 to 2, the recombinant gRNA expression vector according to any one of claims 3 to 6, or the recombinant gRNA expression vector according to any one of claims 3 to 6 and an expression vector containing a nucleotide sequence expressing Cas9.

8. A kit, characterized in that: A reagent comprising a recombinant gRNA expression vector according to any one of claims 3 to 6 and a reagent comprising an expression vector containing a nucleotide sequence expressing Cas9.

9. A method for constructing an Rpgr gene knockout mouse model, characterized in that: The following steps are involved: Injecting the recombinant gRNA expression vector according to any one of claims 3 to 6 and the expression vector containing the nucleotide sequence expressing Cas9 into mice by subretinal injection, and using CRISPR / Cas9 gene editing technology to obtain an Rpgr gene knockout mouse model; Alternatively, the recombinant gRNA expression vector according to any one of claims 3 to 6 is injected into a mouse by subretinal injection, and the CRISPR / Cas9 gene editing technology is used to obtain an Rpgr gene knockout mouse model; the mouse is a CRISPR / Cas9 transgenic mouse.

10. Use of the expression cassette according to any one of claims 1-2, the recombinant gRNA expression vector according to any one of claims 3-6, the reagent according to claim 7, the kit according to claim 8 or the Rpgr gene knockout mouse model obtained by the construction method according to claim 9 in screening or developing drugs for preventing or treating retinitis pigmentosa or X-linked retinitis pigmentosa.

Images