Quality evaluation method for DNA in sample

Abstract

The invention belongs to the technical field of biology, particularly relates to a DNA quality evaluation method, and more particularly relates to a quality evaluation method of DNA in an FFPE sample applied to library construction. By using the evaluation method provided by the invention, the nucleic acid quality of the sample can be more accurately evaluated, and particularly, the quality of the sample can be more intuitively and accurately evaluated by using the method provided by the invention, so that a library building scheme is guided, the library building success rate is improved, and meanwhile, the waste of the sample is reduced to the greatest extent.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular, relates to a method for evaluating the quality of DNA, and more particularly, to a method for evaluating the quality of DNA in FFPE samples used for library construction. Background Art

[0002] FFPE samples refer to samples that have been fixed with formalin and embedded in paraffin. Formalin fixation can easily cause nucleic acids in tissues to degrade to varying degrees and cause cross-linking between molecules. The high-temperature infiltration of paraffin further accelerates the degradation of nucleic acids. The storage time and environment also have a huge impact on the nucleic acids in the samples. This results in the nucleic acid quality in different FFPE samples often being quite different. When constructing a library, different library construction methods need to be used for samples of different qualities in order to improve the success rate of library construction and the quality of the data off the machine. Usually, reasonable and effective quality control of the samples is required before library construction, and only samples that pass the quality control can be used for subsequent library construction.

[0003] Currently, the most common method for DNA integrity testing is to directly judge the DNA integrity of the sample through agarose gel electrophoresis or Agilent 2200 bioanalyzer. Among them, agarose gel electrophoresis is simple to operate, but the judgment is very subjective and has low repeatability; the bioanalyzer will be affected by impurities such as protein and DNA cross-linking, resulting in reduced accuracy of the results.

[0004] In addition, the quality of DNA can be assessed based on the difference between templates after template quantification by qPCR or ddPCR. This method requires a high amount of samples, has relatively complicated steps, and has a relatively low throughput.

[0005] Therefore, there is still a need to provide a more effective DNA quality assessment method to more intuitively and accurately assess the quality of samples, thereby guiding library construction plans, improving the success rate of library construction, and minimizing sample waste. Summary of the invention

[0006] In view of this, in a first aspect, the present invention provides a method for assessing the quality of DNA in a sample, comprising the following steps:

[0007] S1. Amplification of sample nucleic acid, wherein the amplification of sample nucleic acid includes amplifying the sample nucleic acid using upstream and downstream primers to obtain an amplification product, wherein the amplification product includes 4 amplification fragments, wherein the 4 amplification fragments are 90-110 bp, 180-220 bp, 280-330 bp, and 370-430 bp, respectively, from small to large;

[0008] S2. Evaluation of the sample DNA quality, wherein the concentration and quantity of the amplified fragments are obtained and evaluated according to the following evaluation criteria:

[0009] 1) When the sum of the concentrations of the four amplified fragments is less than 0.10 ng / μL, the quality of the DNA of the sample is unqualified;

[0010] 2) When the sum of the concentrations of the four amplified fragments is greater than 0.35 ng / μL, the quality of the DNA of the sample is qualified;

[0011] 3) When the sum of the concentrations of the four amplified fragments is 0.10-0.35 ng / μL, an evaluation is performed based on the number of amplified fragments obtained by amplification, wherein when the number of amplified fragments is 2-4, the quality of the sample DNA is qualified; when the number of amplified fragments is 0 or 1, the quality of the sample DNA is unqualified.

[0012] The evaluation method of the present invention can more accurately evaluate the nucleic acid quality of the sample. In particular, the method of the present invention can distinguish some samples that are considered to be unable to be library-built in the fully automatic nucleic acid analysis system (such as Qsep400 fragment analyzer and other similar products), and these samples can be library-built normally. In addition, the present invention only requires 5ng DNA to complete the quality evaluation, and the demand for sample DNA is very low. At the same time, the entire evaluation process does not exceed two hours, which is efficient and convenient.

[0013] Furthermore, in step S1, the target amplified by the upstream and downstream primers is a highly conserved gene of the species to which the sample belongs. Furthermore, the species is human.

[0014] In some specific embodiments, the ratio of the primers for amplifying the above four fragments is 5-10%, 8-12%, 15-18%, and 15-25% of the whole primers, respectively, according to the size of the amplified fragment, from small to large.

[0015] In some specific embodiments, the ratio of the primers for the amplified fragment is 5%, 10%, 15%, and 20% of the total primers, respectively, according to the size of the amplified fragment, from small to large.

[0016] In some specific embodiments, the highly conserved genes may be GAPDH, ACTB.

[0017] In a specific embodiment, the upstream and downstream primers are shown as SEQ ID NOs. 1-8.

[0018] Furthermore, in step S1, the four amplified fragments are 100 bp, 212 bp, 325 bp, and 430 bp, respectively, from small to large.

[0019] In some specific embodiments, the ratio of primers for the amplified fragment is SEQ ID NO.1 and SEQ ID NO.2 respectively accounting for 5-10% of the entire primer, SEQ ID NO.3 and SEQ ID NO.4 respectively accounting for 8-12% of the entire primer, SEQ ID NO.5 and SEQ ID NO.6 respectively accounting for 15-18% of the entire primer, and SEQ ID NO.7 and SEQ ID NO.8 respectively accounting for 15-25% of the entire primer.

[0020] In some specific embodiments, the ratio of primers for the amplified fragment is SEQ ID NO.1 and SEQ ID NO.2 respectively accounting for 5% of the whole primer, SEQ ID NO.3 and SEQ ID NO.4 respectively accounting for 10% of the whole primer, SEQ ID NO.5 and SEQ ID NO.6 respectively accounting for 15% of the whole primer, and SEQ ID NO.7 and SEQ ID NO.8 respectively accounting for 20% of the whole primer.

[0021] Furthermore, in step S1, the amplification procedure of the sample nucleic acid is:

[0022]

[0023] Furthermore, the step S1 further comprises diluting the amplified product. Furthermore, the dilution ratio is amplified product: sterile water = 1: (8-10), preferably, amplified product: sterile water = 1:9.

[0024] Using the above ratio for dilution can not only better eliminate the impact of macromolecules and metal ions on the fully automatic nucleic acid analysis system, but also meet the instrument's requirements for nucleic acid concentration.

[0025] Furthermore, in step S2, obtaining the concentration of the amplified fragment may be performed by capillary electrophoresis.

[0026] Furthermore, in step S2, if the DNA quality is qualified, it is evaluated that the library can be constructed.

[0027] Furthermore, the method comprises step S3: constructing a library.

[0028] Furthermore, the library includes a sequencing library, and further, may include whole genome sequencing, whole exome sequencing, target region amplicon sequencing, etc.

[0029] In a second aspect, the present invention provides use of the above method in preparing a kit for evaluating the quality of DNA in a sample.

[0030] Furthermore, the present invention provides use of the above method in preparing a kit for evaluating the quality of DNA in FFPE samples for library construction.

[0031] In a third aspect, the present invention provides a composition for evaluating the quality of sample DNA, comprising:

[0032] The nucleotide sequences are shown as upstream and downstream primers in SEQ ID NO.1-8.

[0033] The composition of the present invention can simultaneously amplify four fragments in one tube, and evaluate the quality of DNA in FFPE samples according to the evaluation instructions, so as to facilitate the normal development of subsequent library construction.

[0034] Furthermore, the ratio of the primers for the amplified fragment is 5-10% of the whole primers by SEQ ID NO.1 and SEQ ID NO.2, 8-12% of the whole primers by SEQ ID NO.3 and SEQ ID NO.4, 15-18% of the whole primers by SEQ ID NO.5 and SEQ ID NO.6, and 15-25% of the whole primers by SEQ ID NO.7 and SEQ ID NO.8.

[0035] In some specific embodiments, the ratio of primers for the amplified fragment is SEQ ID NO.1 and SEQ ID NO.2 respectively accounting for 5% of the whole primer, SEQ ID NO.3 and SEQ ID NO.4 respectively accounting for 10% of the whole primer, SEQ ID NO.5 and SEQ ID NO.6 respectively accounting for 15% of the whole primer, and SEQ ID NO.7 and SEQ ID NO.8 respectively accounting for 20% of the whole primer.

[0036] Furthermore, the composition also includes nuclease-free water.

[0037] In a fourth aspect, the present invention provides a kit for evaluating the quality of DNA in a sample, comprising any of the above-mentioned compositions.

[0038] Furthermore, the kit also includes nuclease-free water.

[0039] Furthermore, the kit also includes: at least one of a nucleic acid extraction reagent, a nucleic acid purification reagent, a library construction reagent, or a reagent required for sequencing.

[0040] Furthermore, the kit also includes an internal reference quality control product. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The present invention shows the direct capillary electrophoresis results of DNA from different samples (A to F are samples 1 to 6, respectively);

[0042] Figure 2 The capillary electrophoresis results and the concentration values ​​of each fragment of the method of the present invention (A to F are samples 1 to 6 respectively);

[0043] Figures 3 to 6 These are the library construction results of the samples of the present invention (samples 2 to 5, respectively). DETAILED DESCRIPTION

[0044] The present invention will be specifically described below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are used to illustrate the present invention, but not to limit the present invention. In the examples, if specific techniques or conditions are not indicated, they are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. If the manufacturer is not indicated for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0045] Example 1. Reagents used in the present invention

[0046] The upstream and downstream primers used in the present invention are shown in Table 1.

[0047] Table 1

[0048] Primer name sequence SEQ IN NO 100-F GTTCCAATATGATTCCACCC SEQ IN NO:1 100-R CTCCTGGAAGATGGTGATGG SEQ IN NO:2 200-F AGGTGGAGCGAGGCTAGC SEQ IN NO:3 200-R TTTTGCGGTGGA AATGTCCT SEQ IN NO:4 300-F AGGTGAGACATTCTTGCTGG SEQ IN NO:5 300-R TCCACTAACCAGTCAGCGTC SEQ IN NO:6 400-F ACAGTCCATGCCATCACTGC SEQ IN NO: 7 400-R GCTTGACAA AGTGGTCGTTG SEQ IN NO:8

[0049] The amplification system is as shown in Table 2.

[0050] Table 2

[0051]

[0052]

[0053] Example 2: Specific steps of the method of the present invention

[0054] Sample processing

[0055] FFPE (Formalin-fixed paraffin-embedding) is a formalin-fixed paraffin-embedded sample. DNA from 6 FFPE samples was extracted using QIAGEN's AllPrep DNA / RNA FFPE Kit. The concentration was determined by Qubit, and 1 μL was taken for direct capillary electrophoresis by Qsep400 to determine the DNA quality score (DQN value) as the integrity assessment result of the comparison method. If the Qubit concentration is higher than 10 ng / μL, it is diluted to less than 10 ng / μL with nuclease-free water, and then the following steps are followed.

[0056] Multiplex Amplification

[0057] In a 200 μl PCR tube, add 0.5 μL of mixed primers, 5 ng of DNA from the extracted FFPE sample, 12.5 μL of mixed enzyme, and fill to 25 μL with nuclease-free water. After mixing, centrifuge briefly, place in a PCR instrument, and amplify according to the PCR program shown in Table 3 below.

[0058] Table 3

[0059]

[0060] Dilution of amplification product

[0061] The amplified product was diluted ten-fold with nuclease-free water.

[0062] Fully automated capillary electrophoresis

[0063] The amplified product was subjected to fully automatic capillary electrophoresis using a Qsep400 fragment analyzer (Houze Bio) and its matching S2 standard cartridge, with a specific dosage of 2 μL. The diluted product was added with 18 μL of the 1X dilution buffer provided in the S2 cartridge, mixed evenly, and then centrifuged.

[0064] DNA integrity assessment

[0065] The number of electrophoresis bands was determined based on the concentration value given by the Qsep400 fragment analyzer. The concentration and number of the amplified fragments were obtained and evaluated based on the following evaluation criteria:

[0066] When the sum of the concentrations of the four amplified fragments is less than 0.10 ng / μL, the DNA level of the sample can be directly judged as 5 (the quality is unqualified);

[0067] When the sum of the concentrations of the four amplified fragments is > 0.35 ng / μL, the DNA level of the sample can be directly judged to be 1 (qualified quality);

[0068] When the concentration range is 0.10-0.35 ng / μL, the evaluation is based on the number of amplified fragments obtained:

[0069] Number of amplified fragments DNA Level Is the quality qualified? 4 1 qualified 3 2 qualified 2 3 qualified 1 4 Failure 0 5 Failure

[0070] Specifically, when the concentration value corresponding to a certain amplified fragment is greater than 0.02 ng / μL, it is recorded as the presence of one band at the fragment, with a maximum of 4 bands and a minimum of 0 bands. The obtained number of bands is then compared for DNA integrity according to the above comparison.

[0071] Library construction

[0072] In order to verify the effectiveness of the above-mentioned DNA integrity assessment method, four samples with different ratings were used to construct libraries using a DNA enzyme digestion library construction kit (Shengxiang Biotechnology, DNA library construction kit), the double-stranded concentration of the library was detected using the Qubit4.0 instrument, and the fragment size was quality checked using the Qsep400 instrument.

[0073] Example 3: The method of the present invention specifically evaluates the sample

[0074] First, the sample DNA and the amplified product after multiple amplification by this method were directly used for capillary electrophoresis. The results of direct capillary electrophoresis of the sample DNA and the results of capillary electrophoresis after multiple amplification by this method were as follows: Figure 1 and 2 Then, the results are summarized according to the concentration and the number of amplified fragments, and the summary results are shown in Table 4. As can be seen from the table, according to the conventional evaluation method, the DQN values ​​of samples 1 to 6 are all less than 3, so samples 1 to 6 are not suitable for library construction, but according to the evaluation method of the present invention, samples 1 to 4 are suitable for library construction.

[0075] Table 4

[0076]

[0077] Example 4: Sample library construction

[0078] According to Example 3, samples 1 to 4 are suitable for library construction. Therefore, samples 2, 3, 4, and 5 were selected for library construction in the same manner. The resulting libraries were quality checked. The results showed that when the DNA rating was 1 / 2 / 3, the library construction could be successfully completed. When the rating was 4, the library construction failed. The specific quality control data are shown in Tables 5 and Figures 3 to 6 shown.

[0079] Table 5

[0080]

[0081]

[0082] From the above library construction results, it can be known that for DNA extracted from FFPE samples, if direct capillary electrophoresis is used for quality control, the DQN is less than 3.0. It is known that the full score of DQN is 10 points. The lower the score, the lower the integrity. According to experience, this batch of samples is unqualified and cannot be used for subsequent library construction. However, after evaluation according to the present invention, it was found that there are some samples with DQN < 3.0, and the integrity reaches the library construction level. The DNA rating can be 1, 2, and 3. According to the quality control results of the library constructed by this type of sample, it can be found that it can be used for library construction, which shows that the present invention is more accurate in evaluating DNA integrity.

Claims

1. A method for assessing the quality of DNA in a sample, comprising the following steps: S1. Amplification of sample nucleic acid, wherein: The amplification of the sample nucleic acid includes using upstream and downstream primers to amplify the sample nucleic acid to obtain an amplification product, wherein the amplification product includes 4 amplification fragments, wherein the 4 amplification fragments are 90-110 bp, 180-220 bp, 280-330 bp, and 370-430 bp from small to large, respectively; S2. Evaluation of the sample DNA quality, wherein the concentration and quantity of the amplified fragments are obtained and evaluated according to the following evaluation criteria: 1) When the sum of the concentrations of the four amplified fragments is less than 0.10 ng / μL, the quality of the DNA of the sample is unqualified; 2) When the sum of the concentrations of the four amplified fragments is greater than 0.35 ng / μL, the quality of the DNA of the sample is qualified; 3) When the sum of the concentrations of the four amplified fragments is 0.10-0.35 ng / μL, an evaluation is performed based on the number of amplified fragments obtained by amplification, wherein when the number of amplified fragments is 2-4, the quality of the sample DNA is qualified; when the number of amplified fragments is 0 or 1, the quality of the sample DNA is unqualified.

2. The quality assessment method according to claim 1, characterized in that: In step S1, the target amplified by the upstream and downstream primers is a highly conserved gene of the species to which the sample belongs.

3. The quality assessment method according to claim 2, characterized in that: The nucleotide sequences of the upstream and downstream primers are shown in SEQ ID NOs. 1 to 8.

4. The quality assessment method according to claim 3, characterized in that: In step S1, the four amplified fragments are 100 bp, 212 bp, 325 bp, and 430 bp, respectively, from small to large.

5. The quality assessment method according to claim 4, characterized in that: The step S1 also includes diluting the amplification product, and the dilution ratio is amplification product: sterile water = 1: (8-10).

6. The quality assessment method according to claim 1, characterized in that: In the step S2, the concentration of the amplified fragment is obtained by capillary electrophoresis.

7. The quality assessment method according to claim 1, characterized in that: The method comprises step S3: constructing a library and conducting quality inspection; wherein, if the DNA quality is qualified, it is evaluated as being capable of library construction.

8. Use of the method according to any one of claims 1 to 7 in the preparation of a kit for evaluating the quality of DNA in a sample.

9. A composition comprising: The nucleotide sequences are shown as upstream and downstream primers in SEQ ID NO.1-8.

10. A kit for evaluating the quality of DNA in a sample, comprising the composition according to claim 9.

Images