The invention relates to a malignant hematological tumor chromosome translocation t (5; 8) detection reagent and application thereof

Abstract

The invention provides a malignant hematological tumor chromosome translocation t (5; 8) and application thereof, and belongs to the technical field of tumor diagnosis. According to the invention, a novel enhancer chromosome translocation is detected in a patient with multiple myeloma, specifically, the enhancer chromosome translocation is formed by reconnecting an upstream sequence formed by fracture of 127798852 site of a chromosome 8 and a downstream sequence formed by fracture of 173708142 site of a chromosome 5. The occurrence of chromosome translocation is verified through PCR and Saner sequencing, a dual luciferase report experiment is utilized to verify that an enhancer has a function of up-regulating gene expression, and a qPCR technology is utilized to verify that up-regulating expression of a CPEB4 gene is caused by chromosome translocation of a patient with multiple myeloma. Therefore, the invention provides a novel detection target and a novel detection mode for molecular typing of multiple myeloma.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and in particular relates to a detection reagent for chromosome translocation t(5;8) of malignant blood tumors and application thereof. Background Art

[0002] Multiple myeloma (MM) is the second largest hematological malignancy after lymphoma and is a malignant plasma cell disease with high heterogeneity. Current studies have shown that most MM cases have cytogenetic abnormalities, manifested as IgH gene enhancer translocation, hyperdiploid and hypodiploid karyotypes, among which the IgH gene enhancer translocation on chromosome 14 is the main one. The IgH gene enhancer can be translocated and fused with different chromosomes, and the result of its translocation is the overexpression of different oncogenes. At present, the treatment plan and prognosis evaluation of MM patients mainly rely on the genotyping of IgH gene enhancer translocation. However, the genotyping used in clinical practice to detect IgH gene enhancer translocation is very limited. Currently, specific markers reported for prognostic evaluation include t(4;14), t(11;14), t(14;16), 17p13 deletion, 13q14 deletion and 1q21 amplification. However, there are still many chromosomal translocations that have not been discovered clinically, and new chromosomal translocations are particularly important for accurate genotyping and the formulation of effective treatment strategies.

[0003] The NCCN Multiple Myeloma Clinical Practice Guidelines believe that bone marrow examination in the initial diagnosis should include routine chromosome karyotype analysis and fluorescence in situ hybridization (FISH) of cells obtained from bone marrow puncture. Although FISH is currently the most commonly used method for genotyping of IgH gene enhancer translocation in clinical practice, FISH testing is designed based on the specific sequence of known chromosome translocations. For unknown chromosome translocations, it is impossible to design detection probes in advance, resulting in a considerable portion of unknown chromosome translocations in patients being unable to be detected using existing technologies. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a new type of chromosomal translocation t(5;8) for patients with malignant hematological tumors, which is an enhancer on chromosome 8 translocated to the upstream of the CPEB4 gene on chromosome 5, thereby upregulating the expression of the CPEB4 gene, providing a new detection target for the molecular typing of multiple myeloma patients.

[0005] The present invention provides a chromosomal translocation t(5;8) for patients with malignant hematological tumors, which is based on the human genome version number GRCh38, and is formed by reconnecting an upstream sequence obtained by breaking chromosome 8 at position 127798852 and a downstream sequence obtained by breaking chromosome 5 at position 173708142;

[0006] The upstream sequence is a DNA sequence comprising a nucleotide sequence as shown in SEQ ID NO: 1;

[0007] The downstream sequence is a DNA sequence comprising a nucleotide sequence as shown in SEQ ID NO:2.

[0008] Preferably, the upstream sequence on chromosome 8 also includes an enhancer sequence;

[0009] The nucleotide sequence of the enhancer is shown in SEQ ID NO: 3;

[0010] The downstream sequence on chromosome 5 also contains the sequence of the CPEB4 gene promoter;

[0011] The nucleotide sequence of the CPEB4 gene promoter is shown in SEQ ID NO:4.

[0012] The present invention provides a reagent for detecting the chromosome translocation t(5;8) of the malignant blood tumor patient, including a reagent for detection based on PCR amplification and / or a reagent for detection based on FISH technology.

[0013] Preferably, the PCR-based amplification detection reagent includes primers for amplifying chromosomal translocation t(5;8) in patients with malignant hematological tumors.

[0014] Preferably, the primers for amplifying the chromosomal translocation t(5;8) of patients with malignant hematological tumors include at least one pair of primers: t58-F1 / t58-R1, t58-F3 / t58-R3 and t58-F4 / t58-R4;

[0015] The nucleotide sequence of t58-F1 is shown in SEQ ID NO:5;

[0016] The nucleotide sequence of t58-R1 is shown in SEQ ID NO:6;

[0017] The nucleotide sequence of t58-F3 is shown in SEQ ID NO:7;

[0018] The nucleotide sequence of t58-R3 is shown in SEQ ID NO:8;

[0019] The nucleotide sequence of t58-F4 is shown in SEQ ID NO:9;

[0020] The nucleotide sequence of t58-R4 is shown in SEQ ID NO:10.

[0021] The present invention provides a kit for detecting chromosome translocation t(5;8) in patients with malignant blood tumors, characterized in that it comprises the reagent and a detection reagent used in conjunction with the reagent.

[0022] Preferably, primers for detecting the expression level of CPEB4 gene by real-time fluorescence quantitative PCR are included.

[0023] Preferably, the nucleotide sequences of the primers for detecting the expression level of the CPEB4 gene by real-time fluorescence quantitative PCR are shown in SEQ ID NO:11 and SEQ ID NO:12.

[0024] The present invention provides the use of the chromosomal translocation t(5;8) of a malignant blood tumor patient as a detection target in the preparation of a kit for molecular typing of multiple myeloma.

[0025] The invention provides application of the reagent in preparing a kit for molecular typing of multiple myeloma.

[0026] The present invention provides a chromosomal translocation t(5;8) in patients with malignant hematological tumors, which is based on the human genome version number GRCh38, and is formed by reconnecting an upstream sequence obtained by breaking chromosome 8 at position 127798852 and a downstream sequence obtained by breaking chromosome 5 at position 173708142; the upstream sequence is a DNA sequence containing a nucleotide sequence as shown in SEQ ID NO:1; the downstream sequence is a DNA sequence containing a nucleotide sequence as shown in SEQ ID NO:2. The present invention uses bioinformatics technology to identify a new type of chromosomal translocation from sequencing data, specifically an upstream sequence obtained by breaking chromosome 8 at position 127798852 and a downstream sequence obtained by breaking chromosome 5 at position 173708142, that is, a chromosomal translocation t(5;8) in patients with malignant hematological tumors. The present invention uses PCR amplification and Sanger sequencing results to show that the upstream sequence at the reconnection point is completely matched with the chromosome 8 sequence, and the downstream sequence at the reconnection point is completely matched with the chromosome 5 sequence, proving the occurrence of the above-mentioned chromosomal translocation. Bioinformatics analysis shows that the reconnection point occurs near the enhancer of chromosome 8 and the CPEB4 gene of chromosome 5. Therefore, in order to verify that the chromosomal translocation t(5;8) in patients with malignant blood tumors causes up-regulation of potential oncogene expression, the present invention uses real-time fluorescence quantitative PCR to detect the expression level of the CPEB4 gene. The results show that compared with the control GM12878 cells and B lymphocytes, the mRNA expression of the CPEB4 gene in multiple myeloma patient cells is significantly up-regulated, indicating that the enhancer translocation of chromosome 8 increases the expression level of the CPEB4 gene in chromosome 5, and the up-regulated expression of the CPEB4 gene often occurs in the smoldering multiple myeloma (SMM) and monoclonal gammopathy of undetermined significance (MGUS) stages of multiple myeloma. Therefore, the chromosomal translocation t(5;8) in patients with malignant blood tumors can be used as a new detection target in the molecular typing of multiple myeloma. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the electropherogram of PCR amplification to detect the chr5-chr8 staining translocation;

[0028] Figure 2 The Sanger sequencing diagram of the chr5-chr8 staining translocation;

[0029] Figure 3 To analyze the up-regulation of oncogene expression caused by chr5-chr8 translocation using bioinformatics;

[0030] Figure 4 To verify the up-regulation of CPEB4 gene expression caused by chr5-chr8 translocation by qPCR;

[0031] Figure 5 The results of dual fluorescein reporter assay were used to detect the CPEB4 enhancer. DETAILED DESCRIPTION

[0032]

[0033] In the present invention, a novel enhancer chromosomal translocation was detected in multiple myeloma patients, specifically, an enhancer on chromosome 8 was translocated to the vicinity of the CPEB4 gene on chromosome 5, that is, the upstream sequence obtained by the break of chromosome 8 at site 127798852 was reconnected with the downstream sequence formed by the break of chromosome 5 (chr5) at site 173708142, abnormally regulating the CPEB4 gene to increase its expression.

[0034]

[0035] The present invention provides a reagent for detecting the chromosome translocation t(5;8) of the malignant blood tumor patient, including a reagent for PCR amplification detection.

[0036] In the present invention, the PCR-based amplification detection reagent preferably includes primers for amplifying chromosomal translocation t(5;8) in patients with malignant hematological tumors. The primers for amplifying chromosomal translocation t(5;8) in patients with malignant hematological tumors preferably include at least one pair of primers: t58-F1 / t58-R1, t58-F3 / t58-R3 and t58-F4 / t58-R. The nucleotide sequence of the t58-F1 is preferably as shown in SEQ ID NO:5 (ACGCAAAGCATGTTCTTCACC); the nucleotide sequence of the t58-R1 is preferably as shown in SEQ ID NO:6 (GTGACAGAGCCTAAACCCAGT). The nucleotide sequence of the t58-F3 is preferably as shown in SEQ ID NO:7 (ATATGATTGCTGGTCTGAAAACCT); the nucleotide sequence of the t58-R3 is preferably as shown in SEQ ID NO:8 (AACTGCAAATCCAGTGCTTTTTCT). The nucleotide sequence of the t58-F4 is preferably as shown in SEQ ID NO:9 (TCACTGCCCACATCAAATCAATTCC); the nucleotide sequence of the t58-R4 is preferably as shown in SEQ ID NO:10 (TCCCAGCAATGACAGTGGTTGT). The present invention does not impose any particular restriction on the source of the primers, and the sources of primers known in the art can be used. In the embodiment of the present invention, the primers were commissioned to Beijing Qingke Biotechnology Co., Ltd.

[0037] In the present embodiment, the somatic cell genome of a multiple myeloma patient was used as a template, and the above three pairs of primers were used to perform PCR amplification respectively, and the PCR amplification products were sequenced. The sequencing results showed that the PCR amplification products ( GCTGAGATTGCCAGTGCA CTCCTGCCTGG The upstream sequence of the target reconnection point (SEQ ID NO: 13) completely matches the chromosome 8 sequence (the underlined part in SEQ ID NO: 13), and one side completely matches the chromosome 5 sequence (the bold part in SEQ ID NO: 13), while no target band was detected in the genome of the control cell. This indicates that the chromosomal translocation t (5; 8) of malignant hematological tumor patients is indeed produced in the somatic cells of multiple myeloma patients, and at the same time proves that the primers have good amplification specificity and accuracy of prediction results.

[0038] The present invention provides a kit for detecting the chromosome translocation t(5;8) in patients with malignant blood tumors, comprising the reagent described in the above technical solution and a detection reagent used in conjunction with the reagent.

[0039] In the present invention, the detection reagent used in conjunction with the reagent refers to other detection reagents required when performing PCR amplification, such as PCR amplification premix and the like.

[0040] In the present invention, the kit preferably includes primers for detecting the expression level of CPEB4 gene by real-time fluorescence quantitative PCR. The primers for detecting the expression level of CPEB4 gene by real-time fluorescence quantitative PCR preferably include a forward primer with a nucleotide sequence as shown in SEQ ID NO: 11 (ACATCTAGCGCATCGTCTCTT) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 12 (ACAACAGAGCACCGTTATTAGC).

[0041] In the present invention, the chromosomal translocation t(5;8) in multiple myeloma patients causes the enhancer on chromosome 8 to be connected to the upstream sequence of the CPEB4 gene on chromosome 5. Bioinformatics analysis shows that it may cause the up-regulated expression of the potential oncogene CPEB4 gene. In the present embodiment, the expression level of the CPEB4 gene in the patient cells with chromosomal translocation was detected with B lymphocytes and GM12878 cell lines as controls. The results showed that the expression of the CPEB4 gene in the patient cells was significantly up-regulated compared with the control group. The CPEB4 gene is an mRNA binding protein that mediates cytoplasmic polyadenylation and translation of meiotic mRNA, plays a role in regulating the specific translation of mRNA, is overexpressed in pancreatic ductal adenocarcinoma and glioblastoma, supports tumor growth and invasion, and downregulation of CPEB4 in mouse xenograft models leads to a significant reduction in tumorigenicity, and its main effects are proliferation and angiogenesis, thereby improving tumor survival; in pancreatic cancer, the cancer-promoting function of CPEB4 originates from the translation activation of silent mRNA in normal tissues, including tissue plasminogen activator (TPA) mRNA, which is a key factor leading to pancreatic ductal adenocarcinoma. At the same time, existing technologies have shown that CPEB4 is upregulated in the SMM and MGUS stages of multiple myeloma. Knocking out the expression of the CPEB4 gene by CIRSPR technology can significantly inhibit the growth and proliferation of MM cells. The present invention experiments prove that chromosomal translocation leads to upregulation of CPEB4 gene expression level in patient cells, so the chromosomal translocation in the present invention provides a new molecular typing target for molecular typing of multiple myeloma, and provides a reference for molecular typing of clinical multiple myeloma. Therefore, the present invention provides the use of the chromosomal translocation t(5;8) of patients with malignant blood tumors as a detection target in the preparation of a kit for molecular typing of multiple myeloma. The multiple myeloma preferably includes a smoldering myeloma subtype.

[0042] Based on the fact that the reagent can detect chromosome translocation t(5;8) in patients with malignant blood tumors with high specificity and accuracy, the present invention provides the use of the reagent in preparing a kit for molecular typing of multiple myeloma.

[0043] In the present invention, the method for molecular typing of multiple myeloma preferably comprises the following steps:

[0044] Using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primer pair in the reagent, sequencing the amplified product, and obtaining a sequencing result;

[0045] The molecular typing results were determined based on the sequencing results: when the amplified product was a translocation connection of chromosome 8 and chromosome 5, the molecular typing was chromosome translocation t(5;8), CPEB4 high expression type;

[0046] When the target fragment is not amplified, the molecular typing is other typing.

[0047] The following is a detailed description of a detection reagent for chromosomal translocation t(5;8) of a malignant hematological tumor and its application provided by the present invention in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1

[0049] A method for detecting chromosome translocation t(5;8)

[0050] 1. Test sample: 1 multiple myeloma patient sample (No. PAT1).

[0051] 2. Detection Method

[0052] 1. The myeloma cells isolated from the above samples were commissioned to Berry Genomics for third-generation genome sequencing, and Fraser Genetics was commissioned to perform library sequencing based on the Illumina platform. After obtaining the sequencing data, chromosomal translocations were identified from the sequencing data, and the intersection was taken to obtain 1 chromosomal translocation, that is, an unknown chromosomal translocation t(5;8) was found in the PAT1 myeloma patient, that is, the chr5 site 173708142 of chromosome 5 and the chr8 site 127798852 of chromosome 8 were reconnected (see Table 1).

[0053] Table 1 Specific genomic loci of a translocation screened in Example 1

[0054] Myeloma samples Chr1 Pos1 Chr2 Pos2 PAT1 chr5 173708142 chr8 127798852

[0055] 2. Verification of Chr5-chr8 Translocation by PCR and Sanger Sequencing

[0056] Three pairs of primers were designed in NCBI-Blast for the sequences on both sides of the reconnection point analyzed above. In order to prevent breakpoint drift, the primer PCR product was controlled to be above 2 kb. Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the primers. The genome of the sample cells of multiple myeloma patients (PAT1) was extracted as a template, and PCR amplification was performed using the three pairs of designed primers. The amplification system is shown in Table 2.

[0057] Table 2 PCR reaction system

[0058]

[0059]

[0060] The primer sequences are as follows:

[0061] PAT1-t58-F1:ACGCAAAGCATGTTCTTCACC (SEQ ID NO:5);

[0062] PAT1-t58-R1:GTGACAGAGCCTAAACCCAGT (SEQ ID NO: 6);

[0063] PAT1-t58-F3:ATATGATTGCTGGTCTGAAAACCT(SEQ ID NO:7);

[0064] PAT1-t58-R3:AACTGCAAATCCAGTGCTTTTCT (SEQ ID NO:8);

[0065] PAT1-t58-F4:TCACTGCCCACATCAAATCAATTCC (SEQ ID NO:9);

[0066] PAT1-t58-R4: TCCCAGCAATGACAGTGGTTGT (SEQ ID NO: 10).

[0067] The PCR program was as follows: preliminary denaturation: 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 2 min, 30 cycles; final extension at 72°C for 10 min.

[0068] The obtained PCR amplification products were subjected to agarose gel electrophoresis, and the target bands were collected and commissioned to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to obtain sequencing results. In this embodiment, the genome extracted from the human B lymphocyte cell line GM12878 was also used as a control.

[0069] The electrophoresis of PCR amplification products is shown in Figure 1 Agarose gel electrophoresis results showed that the three pairs of primers spanning the breakpoints in the genomic DNA of the patient sample successfully amplified the sequence near the breakpoint, while the genome of the control cell line GM12878 could not be amplified, proving the specificity of the primers and the accuracy of the predicted results.

[0070] Sanger sequencing peak diagram (sequence see SEQ ID NO: 13) Figure 2 .Depend on Figure 2 It can be seen that the upstream sequence of the predicted rejoining point completely matches the sequence of chromosome 8, and the downstream sequence of the rejoining point completely matches the sequence of chromosome 5. This shows that the chr5-chr8 chromosome translocation predicted by the present invention is accurate.

[0071] 3. The verified chromosome translocation obtained in the previous step is further subjected to bioinformatics analysis to find the new loop generated due to the chromosome translocation.

[0072] 4. Entrust the above samples to Berry Genomics for ChIP-seq sequencing and RNA-seq sequencing to obtain ChIP-seq sequencing data and RNA-seq sequencing data for histone modification H3K27ac. Annotate the promoter-enhancer loop based on the ChIP-seq sequencing data of H3K27ac, and use RNA-seq data to screen target genes with Fold Change>2, that is, potential target genes caused by chromosomal translocation.

[0073] Figure 3 The chromosomal translocation t(5;8) was demonstrated, specifically an enhancer on chromosome 8 was translocated to the vicinity of the promoter of the CPEB4 gene on chromosome 5, and the enhancer-promoter loop caused by the t(5;8) translocation and its corresponding highly expressed oncogene CPEB4 were screened.

[0074] Example 4

[0075] Verification experiment based on up-regulated expression of CPEB4 gene caused by chr5-chr8 chromosome translocation

[0076] RNA was extracted from malignant plasma cells of multiple myeloma patients and reverse transcribed according to the system in Table 3. RNA was also extracted from a laboratory B lymphocyte cell line (GM12878) as a normal cell control group.

[0077] Table 3 Reverse transcription system

[0078] <![CDATA[RNase-freeddH2O]]> Add to 20 μL 5×All-in-oneqRTSupermix 4μL EnzymeMix 1μL Template RNA 2μg

[0079] Use a pipette to gently pipette 8-10 times to mix thoroughly, centrifuge briefly to collect the contents at the bottom of the tube, and perform reverse transcription in the following program: 37°C for 15 min, 85°C for 5 s.

[0080] After reverse transcription, the reverse transcription reaction system was used as a template and primers were used to prepare a qPCR amplification reaction system, as shown in Table 4.

[0081] Table 4 qPCR amplification reaction system

[0082] 2×SYBR qPCR Master Mix 10μL qPCR (10 μM) 0.4μL qPCR downstream primers (10 μM) 0.4μL DNA / cDNA 2μL <![CDATA[ddH2O]]> Add to 20 μL

[0083] Among them, CPEB4-qp-F: ACATCTAGCGCATCGTCTCTT (SEQ ID NO: 11);

[0084] CPEB4-qp-R:ACAACAGAGCACCGTTATTAGC (SEQ ID NO: 12).

[0085] Internal reference gene: CACCATTGGCAATGAGCGGTTC (SEQ ID NO: 14);

[0086] Downstream primer of internal reference gene: AGGTCTTTGCGGATGTCCACGT (SEQ ID NO: 15).

[0087] At the same time, this embodiment also sets a control and an internal reference, and sets 4 replicates in each group, and performs amplification and data capture on the machine; the program is set to 95°C for 30s; 95°C for 30s, 60°C for 30s, 40 cycles; 95°C for 30s, 60°C for 1min, and 95°C for 1s. Process the data.

[0088] Results Figure 4 The mRNA expression of CPEB4 gene in patient samples was significantly upregulated compared with that in control GM12878 cells.

[0089] Example 5

[0090] Dual luciferase reporter assay

[0091] The sequence (SEQ) of the CPEB4 enhancer defined by H3K27ac CUT&Tag IDNO: 3, GTCTGGACGGCTGAGGACCCCCGAGCTGTGCTGCTCGCGGCCGCCACCGCCGGGCCCCGGCCGTCCCTGGCTCCCCTCCTGCCTCGAGAAGGGCAGGGCTTCTCAGAGGCTTGGCGGGAAAAAGAACGGAGGGAGGGATCGCCTGAGTATAAAAGCCGGTTTTCGGGGCTTTTATCTAACTCGCTGTAGTAATTCCAGCGAGAGGCAGAGGGAGCGAGCGGGC GGCCGGCTAGGGTGGAAGAGCCGGGCGAGCAGAGCTGCGCTGCGGGCGTCCTGGGAAGGGAGATCCGGAGCGAATAGGGGGCTTCGCCTCTGGCCCAGCCCTCCCGCTGATCCCCCAGCCAGCGGTCCGCAACCCTTGCCGCATCCACGAAACTTTGCCCATAGCAGCGGGCGGGCACTTTGCACTGGAA) was double-digested with SacI and HindIII (purchased from NEB) and cloned into the upstream of min P promoter of pGL4.23 vector (purchased from Miaoling plasmid platform). The pGL4.23-CPEB4 enhancer plasmid vector and the control plasmid vector pGL4.23 were transfected into 293T cells respectively, and the internal reference plasmid sea cucumber luciferase plasmid was transfected at the same time; 48 hours after transfection, the luciferase reporter gene detection kit (purchased from Promega) was used to detect the ratio of firefly luciferase and sea renilla luciferase expression by detecting the fluorescence intensity. This ratio reflects the intensity of the enhancer's up-regulation of the promoter expression.

[0092] Results Figure 5 The results showed that compared with the control plasmid, the vector inserted with the CPEB4 enhancer significantly increased the promoter strength, proving the enhancer function of this sequence.

[0093] Example 6

[0094] The method for molecular typing of multiple myeloma using PCR technology comprises the following steps:

[0095] The genomic DNA of the sample to be tested (blood of a confirmed multiple myeloma patient, denoted as PAT10) was used as a template, and PCR amplification was performed using a primer pair (PAT1-t58-F1 / PAT1-t58-R1) according to the method of Example 3. The amplified product was entrusted to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing to obtain the sequencing results. According to the sequencing results, the molecular typing of the PAT10 patient was chromosomal translocation t(5;8), CPEB4 high expression type.

[0096] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A chromosomal translocation t(5;8) in a patient with a malignant hematological tumor, characterized in that: It is based on the human genome version number GRCh38, and is formed by reconnecting the upstream sequence obtained by the break of chromosome 8 at position 127798852 and the downstream sequence obtained by the break of chromosome 5 at position 173708142; The upstream sequence is a DNA sequence comprising a nucleotide sequence as shown in SEQ ID NO: 1; The downstream sequence is a DNA sequence comprising a nucleotide sequence as shown in SEQ ID NO:

2.

2. The chromosomal translocation t(5;8) in a patient with a malignant hematological tumor according to claim 1, characterized in that: The upstream sequence on chromosome 8 also contains sequences of enhancers; The nucleotide sequence of the enhancer is shown in SEQ ID NO: 3; The downstream sequence on chromosome 5 also contains the sequence of the CPEB4 gene promoter; The nucleotide sequence of the CPEB4 gene promoter is shown in SEQ ID NO:

4.

3. A reagent for detecting the chromosomal translocation t(5;8) in patients with malignant hematological tumors according to claim 1 or 2, characterized in that: It includes reagents for PCR amplification detection and / or reagents for FISH technology detection.

4. The reagent according to claim 3, characterized in that The PCR-based amplification detection reagent includes primers for amplifying chromosome translocation t(5;8) of patients with malignant hematological tumors.

5. The reagent according to claim 4, characterized in that The primers for amplifying the chromosome translocation t(5;8) of patients with malignant hematological tumors include at least one pair of primers: t58-F1 / t58-R1, t58-F3 / t58-R3 and t58-F4 / t58-R4; The nucleotide sequence of t58-F1 is shown in SEQ ID NO:5; The nucleotide sequence of t58-R1 is shown in SEQ ID NO:6; The nucleotide sequence of t58-F3 is shown in SEQ ID NO:7; The nucleotide sequence of t58-R3 is shown in SEQ ID NO:8; The nucleotide sequence of t58-F4 is shown in SEQ ID NO:9; The nucleotide sequence of t58-R4 is shown in SEQ ID NO:

10.

6. A kit for detecting the chromosomal translocation t(5;8) in patients with malignant hematological tumors according to claim 1 or 2, characterized in that: The invention comprises the reagent according to any one of claims 3 to 5 and a detection reagent used in conjunction with the reagent.

7. The kit according to claim 6, characterized in that Includes primers for real-time fluorescence quantitative PCR detection of CPEB4 gene expression levels.

8. The kit according to claim 7, characterized in that: The nucleotide sequences of the primers for detecting the expression level of the CPEB4 gene by real-time fluorescence quantitative PCR are shown in SEQ ID NO:11 and SEQ ID NO:

12.

9. Use of the chromosomal translocation t(5;8) of a patient with a malignant hematological tumor as claimed in claim 1 or 2 as a detection target in the preparation of a kit for molecular typing of multiple myeloma.

10. Use of the reagent according to any one of claims 3 to 5 in preparing a kit for molecular typing of multiple myeloma.

Images