An InDel molecular marker tightly linked to wax gourd peel color change gene and its application

Abstract

The invention discloses an InDel molecular marker closely linked to a wax gourd peel color change gene and its application, belonging to the technical field of plant molecular breeding. The InDel molecular marker is located on chromosome 5 of the wax gourd genome. Ms.pf3chr5g483 The promoter region of the gene; the InDel molecular marker is the nucleotide sequence shown in SEQ ID NO.3, and the 80th to 172nd bases of the nucleotide sequence are inserted or deleted. The InDel molecular marker provided by the present invention can quickly and high-throughput identify the peel color change phenotype of the offspring of the wax gourd hybrid combination at the seedling stage, and can be used for the identification of the peel color change genotype in large-scale wax gourd germplasm resources; the present invention can be applied to the molecular breeding and genetic improvement of the wax gourd peel color change trait, effectively improving the breeding efficiency, shortening the breeding cycle and saving resources.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular breeding, and in particular to an InDel molecular marker tightly linked to a wax gourd peel color change gene and an application thereof. Background Art

[0002] Winter melon( Benincasa hispida Cogn., 2n = 2 x = 24) It is an economical and edible vegetable with high yield, good storage and transportation resistance, rich nutrition and wide application. It plays an important role in increasing farmers' income and regulating the year-round supply of vegetables. Winter melon peel color change refers to the process in which the skin color of the fruit gradually changes from green to black (dark green) as the fruit matures. Winter melon that has successfully changed color is the common black-skinned winter melon, which is very popular in the market and loved by consumers.

[0003] As an important appearance quality trait of wax gourd fruit, peel color change can only be observed and identified in the late stage of fruit development. Therefore, it is particularly important to screen molecular markers closely linked to this trait for genotype identification and selection in the seedling stage. However, the research on gene cloning and molecular mechanism of this trait has been slow. So far, there has been no report on clear regulatory genes and molecular markers for this trait that can be directly applied to molecular marker-assisted selection breeding. Therefore, the development of molecular markers closely linked to wax gourd peel color change traits can be used for molecular marker-assisted breeding in the seedling stage, thereby improving breeding efficiency, accelerating the breeding process, and reducing breeding costs. Summary of the invention

[0004] The purpose of the present invention is to provide an InDel molecular marker tightly linked to the wax gourd peel color change gene and its application, so as to solve the problems existing in the above-mentioned prior art. The present invention provides an InDel molecular marker tightly linked to the trait based on the precise positioning of the wax gourd peel color change gene. This marker can be used as an auxiliary selection means in the breeding process of new wax gourd varieties for peel color change, which can greatly improve the breeding efficiency, accelerate the breeding process, and reduce the breeding cost.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] One of the technical solutions of the present invention is an InDel molecular marker related to the color change trait of wax gourd peel, wherein the InDel molecular marker is located on chromosome 5 of the wax gourd genome Bh.pf3chr5g483 The promoter region of a gene;

[0007] The InDel molecular marker is a nucleotide sequence shown in SEQ ID NO.3, and the 80th to 172nd bases of the nucleotide sequence are inserted or deleted.

[0008] The Indel molecular marker is designed based on the insertion / deletion variation of 93 bp at the 13,783,681 bp on chromosome 5 of the wax gourd reference genome Wax gourd cv. pf3_v1.0 version.

[0009] The second technical solution of the present invention is that the specific primers for amplifying the InDel molecular marker include a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2.

[0010] The third technical solution of the present invention is a kit, comprising the specific primers.

[0011] A fourth technical solution of the present invention is the use of the InDel molecular marker, the specific primer or the kit in identifying the color change trait of wax gourd peel.

[0012] A fifth technical solution of the present invention is a method for identifying the color change trait of wax gourd peel, comprising the following steps: detecting the genotype of the InDel molecular marker in the genomic DNA of the wax gourd sample to be tested, and determining the color change trait based on its genotype.

[0013] The sixth technical solution of the present invention is the use of the InDel molecular marker, the specific primer or the kit in cultivating a new variety of wax gourd with a fruit peel that changes color.

[0014] The seventh technical solution of the present invention is the application of the InDel molecular marker, the specific primer or the kit in identifying peel color-changing wax gourd germplasm resources.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] The present invention discloses for the first time an InDel molecular marker that is closely linked to a wax gourd peel color change gene, and designs a pair of specific amplification primers based on the molecular marker. By using the primers for PCR amplification, and further detecting the length of the amplified band by agarose gel electrophoresis, the genotype of the wax gourd material to be tested can be quickly determined, and the peel color change phenotype can be predicted based on the genotype. Specifically, when a single band of 211 bp or a double band of 211 bp and 118 bp is amplified, it indicates that the genotype of the wax gourd material to be tested is AA or Aa, and its commercial fruit peel changes color; when a single band of 118 bp is amplified, it indicates that the genotype of the wax gourd material to be tested is aa, and its commercial fruit peel does not change color. In general, the advantages and application potentials of the present invention are as follows: (1) The InDel molecular marker reported in the present invention is closely linked to the wax gourd peel color change gene, and the molecular marker has high accuracy and stability, and can be detected only by PCP amplification and agarose gel electrophoresis, which is simple to operate, low cost, efficient, non-toxic and has a low application threshold; (2) The method of the present invention can quickly and high-throughput identify the peel color change phenotype of the offspring of wax gourd hybrid combination at the seedling stage, and can be used for the identification of the peel color change genotype in large-scale wax gourd germplasm resources; (3) The method of the present invention can be applied to the molecular breeding and genetic improvement of wax gourd peel color change traits, effectively improving breeding efficiency, shortening the breeding cycle and saving resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 These are the commercial melon fruits of the advanced inbred lines S1 and S14 of winter melon, which have significant differences in the color change characteristics of the fruit skin.

[0019] Figure 2 The map-based cloning of the wax gourd peel color change gene. A is the genome-wide association analysis result of the wax gourd peel color change trait, B is the BSA-Seq analysis result of the wax gourd peel color change trait, C is the preliminary positioning of the wax gourd peel color change gene, D is the fine positioning of the wax gourd peel color change gene, and E is the coding gene in the candidate interval.

[0020] Figure 3 for Bh.pf3chr5g482 and Bh.pf3chr5g483 The expression pattern analysis of Bh.pf3chr5g482 and Bh.pf3chr5g483 Expression analysis in different tissues of wax gourd, B is Bh.pf3chr5g483Expression analysis in the peel of wax gourd fruit at different developmental stages. In the figure, YD1 refers to S1, P170 refers to S14, and the same below.

[0021] Figure 4 The purpose is to develop an InDel molecular marker that is tightly linked to the wax gourd peel color change gene and verify its linkage with the peel color change trait in a genetic population. Bh.pf3chr5g483 The promoter sequence of B is displayed differently, and B is based on Bh.pf3chr5g483 To develop InDel molecular markers based on promoter sequence variations and verify their linkage degree with the fruit skin color change trait in genetic populations.

[0022] Figure 5 This is to verify the linkage between the InDel molecular marker and the fruit skin color change trait in 165 natural wax gourd germplasms. DETAILED DESCRIPTION

[0023] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0025] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0026] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0027] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0028] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0029] The embodiment of the present invention provides an InDel molecular marker related to the color change trait of wax gourd peel, wherein the InDel molecular marker is located on chromosome 5 of the wax gourd genome Bh.pf3chr5g483 The promoter region of a gene;

[0030] The InDel molecular marker is a nucleotide sequence shown in SEQ ID NO.3, and the 80th to 172nd bases of the nucleotide sequence are inserted or deleted.

[0031] The embodiment of the present invention also provides specific primers for amplifying the InDel molecular marker, including a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.2.

[0032] The embodiment of the present invention further provides a kit, comprising the specific primers.

[0033] The embodiment of the present invention also provides the use of the InDel molecular marker, the specific primer or the kit in identifying the color change trait of wax gourd peel.

[0034] The embodiment of the present invention also provides a method for identifying the color change trait of wax gourd peel, comprising the following steps: detecting the genotype of the InDel molecular marker in the genomic DNA of the wax gourd sample to be tested, and determining the color change trait according to the genotype.

[0035] In some specific embodiments, the specific primers or the kit are used to amplify the winter melon gene DNA to be tested as a template;

[0036] If only a single band of 211 bp or double bands of 211 bp and 118 bp are amplified, it indicates that the genotype of the tested wax gourd material is AA or Aa;

[0037] If only a single band of 118 bp is amplified, it indicates that the genotype of the wax gourd material to be tested is aa.

[0038] In some specific embodiments, when the genotype of the wax gourd material to be tested is AA or Aa, its peel shows color change; when the genotype of the wax gourd material to be tested is aa, its peel shows no color change.

[0039] The embodiments of the present invention also provide the use of the InDel molecular marker, the specific primer or the kit in cultivating a new variety of wax gourd with a fruit peel that changes color.

[0040] The embodiments of the present invention also provide the use of the InDel molecular marker, the specific primer or the kit in identifying peel color-changing wax gourd germplasm resources.

[0041] Example 1

[0042] Obtaining InDel Molecular Markers Tightly Linked to Wax Gourd Peel Color Change Gene

[0043] This example provides a method for obtaining an InDel molecular marker that is closely linked to the wax gourd peel color change gene, and the specific steps are as follows:

[0044] 1) Materials and reagents

[0045] Materials: S1 and S14 are advanced inbred lines of winter melon with significant differences in fruit peel color change phenotypes selected by the inventors in the early stage (Jiao Xianxian et al., Molecular Plant Breeding, 2019, 17(1):161-168). The fruit peel of S1 changes color, while the fruit peel of S14 does not change color ( Figure 1 ).

[0046] The above two wax gourd materials are propagated and preserved in the inventor's laboratory and can be provided upon appropriate request.

[0047] Reagents: The primers used in this example were synthesized by Shanghai Shenggong Biotechnology Co., Ltd., and were all PAGE-grade purified and passed HPLC quality inspection. The remaining reagents used mainly included Taq enzyme, agarose gel, CTAB, DNA marker, nucleic acid dye, etc., all of which were purchased from Beijing PolyBeauty Biotechnology Co., Ltd.

[0048] 2) Analysis of the genetic law of wax gourd peel color change trait

[0049] In this invention, in order to explore the genetic law of wax gourd peel color change trait, the project team used S1 (color change) and S14 (no color change) as parents, constructed a six-generation genetic population, and investigated and analyzed the genetic law of wax gourd peel color change trait:

[0050] All F 1 and BC 1 P 1 The fruits of the backcross population all showed the same color change phenotype as S1; BC 1 P 2 The ratio of plants with fruit skin color change to those without color change in the population was 1.13∶1 (36∶32), which was confirmed to be 1∶1 by the chi-square test (χ2 = 0.1176 < χ20.05 = 3.841). 2In the population, the ratio of plants with fruit skin color change to those without color change was 2.92∶1 (242∶83), which was confirmed by chi-square test to be 3∶1 (χ2 = 0.0188 < χ2 0.05 = 3.841) (Table 1). The above results indicate that the fruit skin color change trait in the tested materials is a quality trait controlled by a single gene, and color change is dominant over non-color change.

[0051] Table 1 F constructed by S1 and S14 1 , backcross and F 2 Trait segregation survey of populations

[0052]

[0053] 3) Fine localization of wax gourd peel color change gene

[0054] Based on the resequencing data of more than 300 different wax gourd germplasms, the research team initially located the wax gourd peel color change gene to the 3.7Mb interval of chromosome 5 through GWAS analysis ( Figure 2 Middle A). Subsequently, BSA-seq and genetic map analysis located the wax gourd peel color change gene between the molecular markers InDel36 and InDel39 ( Figure 2 B, C, D in the figure). This interval is consistent with the previous GAWS results, and its physical distance is 147.9kb. In the Bh_pf3 reference genome, this interval contains 2 coding genes: Bh.pf3chr5g482 and Bh.pf3chr5g483 ( Figure 2 Further spatiotemporal gene expression analysis results showed Bh.pf3chr5g482 It is not expressed in the pericarp, but Bh.pf3chr5g483 is highly expressed in the pericarp ( Figure 3 A). And Bh.pf3chr5g483 The expression level in the pericarp of S1 at different developmental stages was always significantly higher than that in S14 ( Figure 3 This result indicates that Bh.pf3chr5g483 It may be the target gene that regulates the color change of wax gourd peel.

[0055] 4) Development of InDel molecular markers closely linked to wax gourd peel color change genes

[0056] Subsequently, the present invention cloned the genomic DNA sequence of the above-mentioned localization interval from materials S1 and S14 and sequenced it. The sequencing results showed Bh.pf3chr5g483 The promoter region of the gene (2899 bp upstream of ATG) had an insertion / deletion variation of 93 bp in both parental materials ( Figure 4A in the middle). Subsequently, the present invention designed a pair of specific amplification primers to detect the InDel molecular marker based on the insertion / deletion variation of 93 bp at 13,783,681 bp on chromosome 5 of the wax gourd reference genome Waxgourd cv. pf3_v1.0 version to detect the InDel molecular marker. Further analysis found that the InDel molecular marker was closely linked to the wax gourd peel color change trait in the genetic population ( Figure 4 Middle B).

[0057] The sequences of the specific amplification primer pairs are shown in SEQ ID NO.1-2, and the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.3.

[0058] SEQ ID NO.1: GTCTTACATCGATTGAGTTATGTTCTT;

[0059] SEQ ID NO.2: GTCATCAAACCGATGTTAAGTTTCCA;

[0060] SEQ ID NO.3: GTCTTACATCGATTGAGTTATGTTCTTGTTGACTTAAATGGATAGATTTAACCATAAATATTTATTAGCCATAGAATTA TAAGTGGAATAAAATATTACTTATATTTTAAGTAAAATGGATTAAATGAAACG ACTTTTACAGTATAGAAGCCTATAAAAAAGTTATAAAATA CGAAAGCTTACTTTGGAAACTTAACATCGGTTTGATGAC.

[0061] Note: Positions 80-172 in the sequence, i.e. the underlined sequence, are the 93 bp insertion / deletion (a) / variation (A) described in the present invention.

[0062] When a single band of 211bp or double bands of 211bp and 118bp are amplified, it indicates that the genotype of the wax gourd material to be tested is AA or Aa, and its commercial fruit peel changes color; when a single band of 118bp is amplified, it indicates that the genotype of the wax gourd material to be tested is aa, and its commercial fruit peel does not change color.

[0063] Example 2

[0064] Application of the InDel molecular marker in identifying wax gourd peel color change genotype and predicting its peel color change phenotype

[0065] 165 wax gourd inbred line materials (see Table 2) were used as the validation population to verify the association between the InDel molecular marker and the wax gourd peel color change trait.

[0066] The specific primer pairs of SEQ ID NO. 1-2 were used to clone and the linkage degree of the above Indel molecular marker with the wax gourd peel color change trait in natural populations was tested by agarose gel electrophoresis. Figure 5 As shown, Bh.pf3chr5g483 The 93bp insertion / deletion variation in the gene promoter region is closely linked to the wax gourd peel color change trait in natural population materials, and its prediction phenotype accuracy reaches 95.8%. Therefore, this InDel molecular marker can be effectively used to identify the genotype of the wax gourd peel color change gene and predict its peel color change phenotype, thereby improving breeding efficiency.

[0067] The genotype identification method is as follows: first, extract the whole genome DNA of the wax gourd material to be tested; the DNA of the wax gourd material to be tested is extracted using the improved CTAB method.

[0068] Secondly, PCR amplification was performed using the specific primer pairs of SEQ ID NO.1~2; the DNA polymerase used for PCR amplification was 2×M5 PAGE Taq PCR Mix of Beijing PolyMei Biotechnology Co., Ltd., and the amplification speed was 60 seconds / 1kb; the specific procedures for PCR amplification included: pre-denaturation: 95°C for 3 minutes; cycling: denaturation at 94°C for 25 seconds, annealing at 58°C for 25 seconds, and extension at 72°C for 30 seconds, for a total of 35 cycles; extension: extension at 72°C for 5 minutes; storage: storage at 4°C.

[0069] Finally, the length of the amplified band was detected by agarose gel electrophoresis to determine its genotype. When only a single band of 211 bp or double bands of 211 bp and 118 bp were amplified, it indicated that the genotype of the wax gourd material to be tested was AA or Aa. When only a single band of 118 bp was amplified, it indicated that the genotype of the wax gourd material to be tested was aa.

[0070] The fruit peel color change phenotype is predicted as follows: when the genotype of the wax gourd material to be tested is AA or Aa, the fruit peel of the commercial melon changes color; when the genotype of the wax gourd material to be tested is aa, the fruit peel of the commercial melon does not change color.

[0071] Table 2 Statistics of the sources, peel color change phenotypes and genotyping of 165 natural wax gourd germplasms (from some provinces and cities in China)

[0072] ;

[0073] ;

[0074] ;

[0075] ;

[0076] ;

[0077] ;

[0078] ;

[0079] ;

[0080] Table 3 Statistics of the sources, peel color change phenotypes and genotyping of 165 natural wax gourd germplasms (foreign sources)

[0081] ;

[0082] Note: The above 165 wax gourd natural germplasms are propagated and preserved in the applicant's laboratory and can be provided upon appropriate request.

[0083] In summary, the present invention uses a pair of high-generation wax gourd recombinant inbred lines S1 and S14 with significant differences in fruit peel color change as parents to construct an F 2 Separate the population, and based on this, use the separation population mixed pool sequencing analysis and map-based cloning technology to identify the key variation site that affects the color change of wax gourd peel. This site corresponds to the insertion / deletion variation of 93bp at the 13,783,681bp position on chromosome 5 of the wax gourd reference genome. The sequence of this variation site is the InDel molecular marker reported in the present invention. Further research found that this molecular marker is significantly correlated with the peel color change trait of wax gourd during the commercial melon period. Therefore, it can be used for seedling identification of wax gourd peel color change traits and auxiliary selection breeding, improve the genetic improvement efficiency of wax gourd peel color change traits, shorten the breeding period, and reduce breeding costs. In addition, this molecular marker can be detected by PCR amplification and further agarose gel electrophoresis, with low equipment and technical requirements, non-destructive, simple operation, high efficiency, low cost and other advantages, and has broad application prospects in wax gourd fruit color breeding practice.

[0084] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. An InDel molecular marker related to wax gourd peel color change trait, characterized in that: The InDel molecular marker is located on chromosome 5 of the wax gourd genome; The InDel molecular marker is a nucleotide sequence shown in SEQ ID NO.3, and the 80th to 172nd bases of the nucleotide sequence are inserted or deleted.

2. A specific primer for amplifying the InDel molecular marker according to claim 1, characterized in that: It includes a forward primer as shown in SEQ ID NO.1 and a reverse primer as shown in SEQ ID NO.

2.

3. A kit, characterized in that: The method comprises the specific primer as claimed in claim 2.

4. Use of the specific primers according to claim 2 or the kit according to claim 3 in identifying the color change trait of wax gourd peel.

5. A method for identifying the color change trait of wax gourd peel, characterized in that: The following steps are involved: Detecting the genotype of the InDel molecular marker in the genomic DNA of the wax gourd sample to be tested, and determining the color change trait according to the genotype; Using the specific primers described in claim 2 or the kit described in claim 3, amplification is performed using the winter melon gene DNA to be tested as a template; If only a single band of 211 bp or double bands of 211 bp and 118 bp are amplified, it indicates that the genotype of the tested wax gourd material is AA or Aa; If only a single band of 118 bp is amplified, it means that the genotype of the tested wax gourd material is aa; When the genotype of the wax gourd material to be tested is AA or Aa, its peel shows color change; when the genotype of the wax gourd material to be tested is aa, its peel shows no color change.

6. Use of the specific primers according to claim 2 or the kit according to claim 3 in cultivating new varieties of wax gourd with peel color change.

7. Use of the specific primers according to claim 2 or the kit according to claim 3 in identifying wax gourd germplasm resources with peel color change.

Images