Screening method of antiviral drug

Abstract

The invention discloses a method for screening an antiviral drug, which comprises the following steps: acquiring a genome of a virus, calculating the dN / dS ratio of a gene in the genome, and selecting the gene with the dN / dS ratio greater than 1 or the dN / dS ratio less than 0.5 as a target gene; predicting a three-dimensional structure of a target gene encoding protein, and screening a drug combined with the three-dimensional structure through a molecular docking technology to obtain the antiviral drug, carrying out expression purification on the target gene, and carrying out surface plasma resonance experiment on the target gene and the screened antiviral drugs to remove inapplicable antiviral drugs; according to the screening method of the antiviral drug, the molecular evolution theory and docking of protein and the drug are utilized, the antiviral drug can be rapidly screened from drugs sold in the market, the screening method is suitable for all viruses, vaccines are avoided, the research and development time is shortened, the cost is reduced, and the screening method is suitable for large-scale popularization and application. The screening method is rapid and reliable, has no side effect, is relatively low in price, and can rapidly find an antiviral specific medicine.

Description

Technical Field

[0001] This invention relates to the field of antiviral drug technology, and more specifically to a method for screening antiviral drugs. Background Technology

[0002] According to the theory of molecular evolution, viral epidemics are the result of viruses adaptively spreading more widely within a population (environment), representing adaptive evolution. In this evolutionary process, two types of genes play crucial roles: genes that promote viral transmission and genes that maintain normal function. The proteins encoded by these two types of genes have important functions in enhancing viral infectivity and spread.

[0003] Viruses spread rapidly, causing widespread infection; therefore, finding antiviral drugs to stop their spread is extremely urgent. Traditional laboratory methods, involving the design and development of drugs from scratch, are time-consuming and costly. The lengthy process and high failure rate make it extremely difficult to obtain effective new antiviral drugs in a short period. However, repurposing existing approved drugs can significantly shorten the time required for antiviral drug development.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a method for screening antiviral drugs. This method can screen antiviral drugs from existing drugs, and can obtain antiviral drugs in about a week. It is fast, reliable, has no side effects, and requires no development costs, resulting in low cost.

[0006] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted:

[0007] The first aspect of this invention provides a method for screening antiviral drugs, the method comprising the following steps:

[0008] (a) Identification of target genes:

[0009] Obtain the viral genome, calculate the dN / dS ratio of genes in the genome, and select genes with dN / dS ratio > 1 or dN / dS ratio < 0.5 as target genes.

[0010] (b) Screening of antiviral drugs:

[0011] The three-dimensional structure of the protein encoded by the target gene is predicted, and then drugs that bind to the three-dimensional structure are screened using molecular docking technology to obtain antiviral drugs.

[0012] (c) Rescreening for antiviral drugs:

[0013] The target gene was expressed and purified, and then subjected to surface plasmon resonance experiments with screened antiviral drugs to remove unsuitable antiviral drugs.

[0014] Preferably, in step (c), the molar ratio of the target gene expression protein to the antiviral drug in the surface plasmon resonance experiment is 1:(0.8-1.2).

[0015] Preferably, in step (c), the concentration of the target gene expression protein in the surface plasmon resonance experiment is 10–50 μg / ml, and the pH value is 4.0–4.5.

[0016] Preferably, in step (a), the genome of the virus is obtained from the PAML.

[0017] Preferably, in step (b), AlphaFold2 is used to predict the three-dimensional structure of the protein encoded by the target gene.

[0018] Preferably, in step (b), AutoDock4 software is used to screen antiviral drugs that are compatible with the three-dimensional structure.

[0019] Preferably, the viruses include monkeypox virus, SARS-CoV-2, adenovirus A, adenovirus B, adenovirus C, influenza A virus, coronavirus B, and hepatitis B.

[0020] Preferably, in step (b), the drug includes venetoclax, nilotinib, eltrombopag, ARV-110 reagent (Bavdegalutamide), hypericin, digitoxin, cidofovir, thiazoflurin, ribavirin, dutasteride, irinotecan hydrochloirde, tecovirimat, and brincidofovir.

[0021] Compared with the prior art, the beneficial effects of the present invention include at least the following:

[0022] The antiviral drug screening method of this invention utilizes molecular evolution theory and protein-drug docking to rapidly (approximately one week) screen antiviral drugs from commercially available drugs. This screening method is applicable to all viruses; its speed depends on the speed of genome sequencing, resulting in a short screening time. Furthermore, this invention's screening method can select drugs from commercially available pharmaceuticals, bypassing vaccines, shortening research and development time and reducing costs. This screening method is fast, reliable, has no side effects, is inexpensive, and can quickly identify effective antiviral drugs. Detailed Implementation

[0023] The embodiments of the technical solution of the present invention will be described in detail below with reference to the examples. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore only examples, and should not be used to limit the scope of protection of the present invention.

[0024] It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0025] This invention provides a method for screening antiviral drugs, which includes the following steps:

[0026] (a) Identification of target genes:

[0027] Obtain the viral genome, calculate the dN / dS ratio of genes in the genome, and select genes with dN / dS ratio > 1 or dN / dS ratio < 0.5 as target genes.

[0028] (b) Screening of antiviral drugs:

[0029] The three-dimensional structure of the protein encoded by the target gene is predicted, and then drugs that bind to the three-dimensional structure are screened using molecular docking technology to obtain antiviral drugs.

[0030] (c) Rescreening for antiviral drugs:

[0031] The target gene was expressed and purified, and then subjected to surface plasmon resonance experiments with screened antiviral drugs to remove unsuitable antiviral drugs.

[0032] The antiviral drug screening method of this invention utilizes molecular evolution theory and protein-drug docking to rapidly (about one week) screen antiviral drugs from commercially available drugs. This screening method is applicable to all viruses, and its speed depends on the speed of genome sequencing, resulting in a short screening time. Furthermore, this invention's screening method can select drugs from commercially available pharmaceuticals, bypassing vaccines, shortening research and development time and reducing costs. This screening method is fast, reliable, has no side effects, is inexpensive, and can quickly identify effective antiviral drugs.

[0033] In one embodiment, in step (c), the molar ratio of the target gene expression protein to the antiviral drug in the surface plasmon resonance experiment is 1:(0.8-1.2).

[0034] In one embodiment, in step (c), the concentration of the target gene expression protein in the surface plasmon resonance experiment is 10–50 μg / ml, and the pH value is 4.0–4.5.

[0035] In one embodiment, in step (a), the genome of the virus is obtained from the PAML.

[0036] In one embodiment, in step (b), AlphaFold2 is used to predict the three-dimensional structure of the protein encoded by the target gene.

[0037] In one embodiment, in step (b), AutoDock4 software is used to screen antiviral drugs that bind to the three-dimensional structure.

[0038] In one embodiment, the viruses include monkeypox virus, SARS-CoV-2, adenovirus A, adenovirus B, adenovirus C, influenza A virus, coronavirus B, and hepatitis B.

[0039] In one embodiment, in step (b), the drug includes venetoclax, nilotinib, eltrombopag, ARV-110 reagent (Bavdegalutamide), hypericin, digitoxin, cidofovir, tiazofurin, ribavirin, dutasteride, irinotecan hydrochloirde, tecovirimat, and brincidofovir.

[0040] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0041] Example

[0042] This embodiment describes a method for screening anti-monkeypox virus drugs, which includes the following steps:

[0043] (a) Identification of target genes:

[0044] Using PAML (https: / / github.com / abacus-gene / paml), the genome of monkeypox virus was obtained, and the dN / dS ratio of genes in the genome was calculated. Genes with dN / dS ratio > 1 or dN / dS ratio < 0.5 were selected as target genes. The selection results are shown in Table 1 and Table 2.

[0045] Table 1. Target genes of positive selection in monkeypox virus (i.e., dN / dS ratio > 1)

[0046] Gene dN / dS ratio OPG198 2.00053 OPG027 1.57917 OPG199 1.46944 OPG120 1.27024 OPG031 1.26484 OPG021 1.21863 OPG204 1.15188 OPG154 1.14929 OPG036 1.09634 OPG174 1.04391 OPG205 1.03797 OPG092 1.03167 OPG173 1.02248 OPG200 1.00287

[0047] Table 2. Target genes of negative selection in monkeypox virus (i.e., dN / dS ratio < 0.5)

[0048]

[0049]

[0050] (b) Screening of antiviral drugs:

[0051] AlphaFold2 was used to predict the three-dimensional structure of the target gene encoded protein, and then molecular docking technology (AutoDock4 software) was used to screen for drugs that bind to the three-dimensional structure to obtain antiviral drugs. Among them, taking OPG027, OPG198 and OPG112 as examples, the drugs that bind to the target gene OPG027, OPG198 and OPG112 expressed proteins are shown in Table 3.

[0052] Table 3

[0053] OPG027 OPG112 OPG198 Hypericin Hypericin Hypericin Tecovirimat Ribavirin Tecovirimat Bavdegalutamide Tiazofurin Bavdegalutamide Tiazofurin Bavdegalutamide Tiazofurin Dutasteride Digitoxin Eltrombopag Venetoclax / Venetoclax BrinCidofovir / Cidofovir Cidofovir / Nilotinib Ribavirin / Irinotecan hydrochloirde Velpatasvir / Ribavirin

[0054] (c) Rescreening for antiviral drugs:

[0055] The target gene was expressed and purified, and then surface plasmon resonance experiments were performed with the screened antiviral drugs. The experimental results are shown in Tables 5 to 7.

[0056] The methods for expressing and purifying the target gene are as follows:

[0057] 1. Experimental materials

[0058] Tris / Bide Pharmaceuticals / Cat#BD17159; Imidazole / Bide Pharmaceuticals / Cat#BD40902; IPTG / Yeasen / Cat#10902ES60; NaCl / China National Pharmaceutical Group / Cat#10019318; Glycerin / China National Pharmaceutical Group / Cat#10010618; FastPAGE™ Protein Precast Gel / 4-20% / Cat#TSP024-15.

[0059] 2. Experimental Methods

[0060] 2.1 Plasmid construction is shown in Table 4.

[0061] Table 4

[0062]

[0063] 2.2 Plasmid Transformation

[0064] (1) Prepare LB agar plates.

[0065] LB medium (containing Agar): tryptone 10g / L, NaCl 10g / L, yeast extract 5g / L, Agar 15g / L; after autoclaving, add kanamycin 50μg / ml quickly when the medium temperature drops to about 60℃;

[0066] (2) Remove Rosetta2(DE3)plysS / BL21(DE3) competent cells and thaw them on ice.

[0067] (3) Use a pipette to transfer 100 μl of competent cells into a 1.5 ml EP tube.

[0068] (4) Gently add 1 μl of recombinant plasmid to each competent cell and gently tap the tube wall to mix it.

[0069] (5) Place on ice for 30 minutes.

[0070] (6) Let it stand in a 42℃ circulating water bath for 90 seconds.

[0071] (7) Quickly place on ice for 3 minutes.

[0072] (8) Add 500-900 μl of LB medium to the tubes above.

[0073] (9) Place the EP tube on a 37°C shaker (225 rpm) for 40 min.

[0074] (10) Dilute the above bacterial solution with LB medium, add an appropriate amount of diluent to LB plates, and spread evenly.

[0075] (11) Incubate at 37℃ for 24 hours.

[0076] 2.3 Try to express

[0077] (1) Pick 3 single clones from the transformed plate and inoculate them into 1 ml of the corresponding resistant LB, and incubate at 37℃ and 200 rpm for 3-4 h.

[0078] (2) When the OD value reaches 0.6, take out 500 μl of glycerol-containing bacteria, mix by blowing and then freeze at -80℃.

[0079] (3) Take 250 μl and add 200 μM IPTG to induce, and use the remaining 250 μl without IPTG as a control. Incubate at 37℃ and 200 rpm for 3 h.

[0080] (4) SDS-PAGE identification.

[0081] 2.4 Expression

[0082] (1) Pick a single colony from the freshly transformed colony and transfer it to 100 mL of LB medium (resistance: kanamycin), and culture it in a shaker at 37°C and 220 rpm.

[0083] (2) When the OD600 reaches 0.6, inoculate 1% of the bacterial solution into the corresponding LB (resistance: kanamycin), and culture on a shaker at 37°C and 220 rpm.

[0084] (3) Cool the bacterial culture to 18°C, and when the OD600 is 0.6, add IPTG at a final concentration of 0.2 mM for overnight induction (O / N: 20 hours).

[0085] 2.5 Purification

[0086] 2.5.1 OPG protein by Ni affinity chromatography

[0087] Pre-filled column: HisTrap HP (Cytiva / Cat#17524802), 5ml;

[0088] (1) Buffer solution:

[0089] Buffer A: 50mM Tris, pH 8.0, 150mM NaCl;

[0090] Buffer B: 50mM Tris, pH 8.0, 150mM NaCl, 500mM imidazole;

[0091] (2) Centrifuge the cells expressing E. coli (4000 rpm, 10 min) to collect the cells, resuspend the cell pellet with lysis buffer (Buffer A), sonicate in an ice bath (380 W, 3 s working, 7 s interval, 30 min total), centrifuge at 13000 rpm, 4℃ for 50 min, collect the supernatant, and prepare for sample loading.

[0092] (3) Procedure: Wash the pre-packed column with water, clean the pre-packed column with buffer B, equilibrate the pre-packed column with buffer A, load the sample, continue washing with buffer A, and collect the flow-through fraction. Elute according to a linear gradient of 0-100% B, collect each fraction according to UV280, and perform SDS-PAGE detection.

[0093] 2.5.2 OPG protein was purified using Superdex 75.

[0094] Pre-filled column: HiLoad™ 16 / 60 Superdex™ 75 prep grade, 120ml;

[0095] (1) Buffer: PBS

[0096] (2) Sample: Ni column elution fraction, concentrated and loaded.

[0097] (3) Operation steps: Equilibrate the column with PBS buffer, then load the sample, continue washing with PBS buffer, collect each component according to the UV value and perform SDS-PAGE detection.

[0098] (4) Collect the target components, combine and concentrate them, and quantify them.

[0099] Table 5

[0100]

[0101]

[0102] Table 6

[0103]

[0104] Table 7

[0105]

[0106]

[0107] Based on the data in Tables 5 to 7, antiviral drugs that are not applicable (N / A) were removed, and anti-monkeypox virus drugs were screened out.

[0108] Experimental Example

[0109] Viral inhibition tests were performed on the antiviral drugs screened in the above examples; specifically, the inhibitory effect of the drugs on the Wuhan strain of monkeypox virus was verified using the Vero E6 cell line derived from monkeys; the monkeypox virus cells were cultured on Vero E6 cells. Cells were grown on modified Dulbecco medium (Dulbecco's modified minimal essential medium containing 2mM L-glutamine, 100 units / ml penicillin, 100 μg / ml streptomycin, and 2% or 10% fetal bovine serum (FBS; Gibco)) at 37°C in a CO2 incubator (containing 5% CO2).

[0110] Vero E6 cell monolayers were grown in 48-well plates and infected with monkeypox virus (MOI 0.05) for 72 h at an infection concentration of 30 μM. Three replicates were used for each test concentration; the blank control was without antiviral drug. Infected microplates were frozen and properly processed before being taken out of the P3 laboratory. DNA was then extracted and the monkeypox virus count was determined by RT-qPCR to calculate the inhibition rate. The tested gene was G2R, and the primers used were F: CACACCGTCTCTTCCACAGA; R: GATACAGGTTAATTTCCACATCG; TaqMan probe was 5′FAM-AAGCCGTAATCTATGTTGTCTATCGTGTCC-3′BHQ1.

[0111] Inhibition rate = (number of viruses in the blank control group - number of viruses in the antiviral drug group) / number of viruses in the blank control group × 100%;

[0112] The calculated inhibition rates of antiviral drugs vena cava, nilotinib, irdrappa, ARV-110 reagent, hypericin, digoxin, cidofovir, thiazolidin and brincidofovir against monkeypox virus are shown in Table 8.

[0113] Table 8

[0114]

[0115]

[0116] Based on the data in Table 8, the drugs obtained by the screening method of this invention all have a certain inhibitory effect on monkeypox virus, and the screening effectiveness rate is 100%.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A method for screening antiviral drugs, characterized in that: The antiviral drug screening method comprises the following steps: (a) Determination of target genes: Obtain the genome of the virus, calculate the dN / dS ratio of the genes in the genome, and select genes with a dN / dS ratio > 1 or a dN / dS ratio < 0.5 as target genes; (b) Antiviral drug screening: Predict the three-dimensional structure of the protein encoded by the target gene, and then screen drugs that bind to the three-dimensional structure through molecular docking technology to obtain antiviral drugs; (c) Antiviral drug rescreening: The target gene is expressed and purified, and then subjected to surface plasmon resonance experiments with the screened antiviral drugs to remove unsuitable antiviral drugs.

2. The method for screening antiviral drugs according to claim 1, characterized in that: In the step (c), the molar ratio of the target gene expression protein to the antiviral drug in the surface plasmon resonance experiment is 1: (0.8-1.2).

3. The method for screening antiviral drugs according to claim 1, characterized in that: In the step (c), the concentration of the target gene expression protein in the surface plasmon resonance experiment is 10 to 50 μg / ml, and the pH value is 4.0 to 4.

5.

4. The method for screening antiviral drugs according to claim 1, characterized in that: In the step (a), the viral genome is obtained from PAML.

5. The method for screening antiviral drugs according to claim 1, characterized in that: In the step (b), AlphaFold2 is used to predict the three-dimensional structure of the protein encoded by the target gene.

6. The method for screening antiviral drugs according to claim 1, characterized in that: In the step (b), AutoDock4 software is used to screen antiviral drugs that bind to the three-dimensional structure.

7. The method for screening antiviral drugs according to claim 1, characterized in that: The viruses include monkeypox virus, new coronavirus, adenovirus A, adenovirus B, adenovirus C, influenza A virus, coronavirus B and hepatitis B.

8. The method for screening antiviral drugs according to claim 1, characterized in that: In the step (b), the drugs include venetola, nilotinib, itripap, ARV-110 agent, hypericin, digitoxin, cidofovir, thiazofurine, ribavirin, dutasteride, irinotecan hydrochloirde, tecovirimat and brincidofovir.

Images