Bacillus subtilis SHAN-1 with high yield of IAA and protease and application of bacillus subtilis SHAN-1

Abstract

The invention discloses a bacillus subtilis SHAN-1 capable of highly producing IAA (indoleacetic acid) and protease and application of the bacillus subtilis SHAN-1. The bacillus subtilis SHAN-1 provided by the invention can resist salt and has relatively strong capability of producing IAA (Indoleacetic Acid) and protease, and the bacillus subtilis SHAN-1 has a promoting effect on the growth of plants when being applied to a microbial fertilizer. In the aspect of a microbial fermentation technology, the bacillus subtilis SHAN-1 can utilize substances such as peanut bran as a fermentation substrate, and a fermentation product of the bacillus subtilis SHAN-1 can obviously promote growth of plants and increase sugar accumulation of plant fruits, especially citrus fruits.

Description

Technical Field

[0001] The invention relates to the technical field of microbial fermentation, and in particular to a Bacillus subtilis SHAN-1 with high IAA and protease production and application thereof. Background Art

[0002] Bacillus belongs to the Firmicutes, and is a bacillus that can form spores (endospores). They have strong resistance to external harmful factors. At present, the most studied Bacillus are: Bacillus subtilis, Bacillus cereus, Bacillus thuringiensis, Bacillus anthracis, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus licheniformis, etc. Among them, Bacillus subtilis is a multifunctional microorganism with multiple activities such as utilizing protein, fat, various sugars and starch. It has a wide range of applications in the fields of feed industry, sewage treatment, biological control, microbial fermentation technology, etc.

[0003] Auxin (indoleacetic acid, IAA) is an important hormone that regulates plant growth. Its chemical nature is indoleacetic acid, and it is the earliest hormone discovered to promote plant growth. IAA affects the division, elongation and differentiation of plant cells, controls the rooting and germination of plants, and affects the growth, maturity and aging of plant organs. Due to the low content of endogenous hormones in plants, it is impossible to extract them in large quantities and use them in agricultural production. Therefore, generating or synthesizing them through other pathways has become a development trend in contemporary agriculture. Protease is the most important industrial enzyme preparation that can catalyze the hydrolysis of proteins and polypeptides. It is widely present in animal viscera, plant stems and leaves, fruits and microorganisms. The industrial production of protease preparations is mainly prepared by fermentation of microorganisms such as Bacillus subtilis and Aspergillus terreus.

[0004] In existing research, a Chinese invention patent with publication number CN113549575A discloses a Bacillus subtilis FM-20 that can produce high levels of protease and applies it to the development of poultry feed, which has good effects of inhibiting harmful bacteria activities, tolerating gastric acid and high temperature, etc. A Chinese invention patent with publication number CN112980739A discloses a Bacillus subtilis that can produce high levels of IAA and cellulase, and finds that it has good application value in biological control of pepper gray mold. At present, the reported Bacillus subtilis are mostly used in biological control and feed development, and there are few studies reporting the application of Bacillus subtilis that can produce high levels of IAA and protease in the fermentation of protein agricultural and sideline products such as peanut bran and soybean meal. Therefore, Bacillus subtilis and its application are yet to be developed. Summary of the invention

[0005] The primary purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and to provide a salt-tolerant Bacillus subtilis strain SHAN-1 with high IAA and protease production.

[0006] The second object of the present invention is to provide a bacterial agent containing the above-mentioned Bacillus subtilis SHAN-1 and / or its fermentation product.

[0007] The third object of the present invention is to provide the use of the above-mentioned Bacillus subtilis SHAN-1 or bacterial agent.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] A strain of Bacillus subtilis SHAN-1 was deposited on March 3, 2023 at the General Microbiology Center of China Culture Collection Committee, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.26729.

[0010] The bacterial agent contains the above-mentioned Bacillus subtilis SHAN-1 and / or a fermentation product of Bacillus subtilis SHAN-1.

[0011] Furthermore, the fermentation product contains protease; further, the protease is neutral protease.

[0012] Furthermore, the fermentation product also contains auxin; the auxin has high activity; further, when the fermentation product also contains auxin, the substrate before fermentation contains L-tryptophan.

[0013] Furthermore, the fermentation product is obtained by fermenting peanut bran with Bacillus subtilis SHAN-1.

[0014] Furthermore, the fermentation product is obtained by fermenting peanut bran with Bacillus subtilis SHAN-1 and Saccharomyces cerevisiae.

[0015] Furthermore, the bacterial agent also contains pharmaceutically acceptable excipients.

[0016] The preparation of the fermentation product of the Bacillus subtilis SHAN-1 comprises the following steps:

[0017] The above-mentioned Bacillus subtilis SHAN-1 was inoculated into the fermentation substrate for fermentation.

[0018] Furthermore, the fermentation substrate includes a nitrogen source, a carbon source and metal ions, the nitrogen source includes at least one of skimmed milk powder and ammonium sulfate, the carbon source includes at least one of glucose and maltose, and the metal ions include Mg 2+ 、Zn 2+ and Ca 2+ At least one of; further, the nitrogen source includes skimmed milk powder, the carbon source includes glucose, and the metal ion includes Mg 2+ Furthermore, the nitrogen source comprises a concentration of 10 g·L -1 skimmed milk powder, wherein the carbon source comprises a carbon source having a concentration of 5 g·L -1 of glucose, wherein the metal ions include 1 g·L -1 Mg 2+ .

[0019] Furthermore, when the fermentation product contains growth hormone, the fermentation substrate contains L-tryptophan.

[0020] Furthermore, the fermentation substrate includes peanut bran; further still, the peanut bran is alkaline-hydrolyzed and enzymatically hydrolyzed peanut bran.

[0021] Furthermore, the preparation of the fermentation product of Bacillus subtilis SHAN-1 comprises the following steps:

[0022] (1) adding water and alkali to peanut bran for alkaline hydrolysis to obtain an alkaline hydrolysis product;

[0023] (2) taking the alkaline hydrolysis product, adjusting the pH to above 10, adding an enzyme, performing enzymolysis, and obtaining an enzymolysis product;

[0024] (3) Take the enzymatic hydrolysis product, adjust the pH to 6.5-7.5, add bacterial suspension and culture medium, and ferment.

[0025] Furthermore, the alkaline hydrolysis conditions in step (1) are: shaking culture at 50-70°C and 300-400rpm for 10-15h; and further shaking culture at 60°C and 350rpm for 12h.

[0026] Furthermore, the enzyme in step (2) includes at least one of alkaline protease and lipase.

[0027] Furthermore, the concentration of the enzyme in step (2) is 3-10 g / L.

[0028] Furthermore, the conditions for the enzymatic hydrolysis in step (2) are: shaking culture at 25-75°C and 250-350 rpm for 15-25 hours; and further shaking culture at 50°C and 300 rpm for 20 hours.

[0029] Furthermore, the bacterial suspension in step (3) includes a suspension of Bacillus subtilis SHAN-1; and further includes a suspension of Saccharomyces cerevisiae;

[0030] The preparation of the Bacillus subtilis SHAN-1 bacterial suspension comprises the following steps: inoculating Bacillus subtilis SHAN-1 into a liquid fermentation medium, and culturing the medium under shaking conditions of 30°C and 180 rpm for 48 hours; the liquid fermentation medium comprises 200 mg·L L-tryptophan; -1 , skim milk powder 6.0~10.0g·L -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O1g·L -1 and K2HPO4 1g·L -1 .

[0031] The preparation of the saccharomyces cerevisiae suspension comprises the following steps: inoculating saccharomyces cerevisiae into PDB culture medium, and culturing with shaking at 28° C. and 180 rpm for 24 hours.

[0032] Furthermore, the culture medium in step (3) includes a liquid fermentation medium; further includes a PDB medium; the liquid fermentation medium includes L-tryptophan 200 mg·L -1 , skim milk powder 6.0~10.0g·L -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 and K2HPO4 1g·L -1 .

[0033] Furthermore, the fermentation conditions described in step (3) are: temperature of 20-40°C, rotation speed of 300-400rpm, and fermentation for 40-60h; furthermore: temperature of 30°C, rotation speed of 350rpm, and fermentation for 48h.

[0034] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in the preparation of protease.

[0035] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in the preparation of auxin.

[0036] The application of the Bacillus subtilis SHAN-1 in preparing products for promoting plant growth.

[0037] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in promoting plant growth.

[0038] The application of the Bacillus subtilis SHAN-1 in the preparation of products for promoting seed germination.

[0039] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in promoting seed germination.

[0040] The application of the above-mentioned Bacillus subtilis SHAN-1 in the preparation of antioxidant products.

[0041] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in anti-oxidation.

[0042] The application of the Bacillus subtilis SHAN-1 in the preparation of products for increasing the sugar content of plant fruits.

[0043] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in increasing the sugar content of plant fruits.

[0044] The application of the Bacillus subtilis SHAN-1 in the preparation of products for reducing the acid content of plant fruits.

[0045] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in reducing the acid content of plant fruits.

[0046] The application of the Bacillus subtilis SHAN-1 in the preparation of products for reducing the acid content of plant fruits.

[0047] Application of the above-mentioned Bacillus subtilis SHAN-1 or the above-mentioned bacterial agent in reducing the acid content of plant fruits.

[0048] The auxin is indoleacetic acid.

[0049] Furthermore, the plant includes at least one of the cruciferous plants and the Rutaceae; and further at least one of the Chinese flowering cabbage and the citrus.

[0050] Furthermore, the plant fruits include Rutaceae plant fruits; further include citrus fruits.

[0051] Furthermore, the application of preparing protease includes the step of protease purification, and the protease purification adopts ammonium sulfate graded precipitation method to purify the protease produced by Bacillus subtilis SHAN-1; further comprising the following steps: adding a saturated ammonium sulfate solution to the fermentation product of Bacillus subtilis SHAN-1 under magnetic stirring conditions, standing and centrifuging after the ammonium sulfate crystals are completely dissolved, collecting the precipitate, placing it in a phosphate buffer solution and dialyzing it with a dialysis bag to obtain the purified protease.

[0052] Furthermore, the concentration of the saturated ammonium sulfate solution is 0-30%, 30%-50%, 50%-70% or 70%-90%; furthermore, it is 30%-50%.

[0053] Furthermore, the centrifugation conditions are: temperature of 4°C, rotation speed of 8000 rpm, and centrifugation for 10 minutes.

[0054] Furthermore, the phosphate buffer solution is a phosphate buffer solution with a pH of 7.0 and a concentration of 20 mmol / L.

[0055] Furthermore, the dialysis using a dialysis bag is: dialysis using a 4kDa molecular weight dialysis bag for 36 hours.

[0056] Compared with the prior art, the present invention has the following advantages and effects:

[0057] The Bacillus subtilis SHAN-1 provided by the present invention is salt-tolerant and has strong IAA and protease production capabilities. Applying Bacillus subtilis SHAN-1 to microbial fertilizer has a promoting effect on plant growth. In terms of microbial fermentation technology, Bacillus subtilis SHAN-1 can use peanut bran and other substances as fermentation substrates, and its fermentation products can promote plant growth and promote sugar accumulation in plant fruits, especially citrus fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 The morphological identification results of Bacillus subtilis SHAN-1 are shown in Figure 1, where A is the colony morphology, B is the Gram staining image, and C is the scanning electron microscope image.

[0059] Figure 2 This is the phylogenetic tree of Bacillus subtilis SHAN-1.

[0060] Figure 3 This is the growth curve and protease production curve of Bacillus subtilis SHAN-1.

[0061] Figure 4 The graphs show the effects of carbon source, nitrogen source and metal ions on the protease activity of Bacillus subtilis SHAN-1 and the effect of the concentration of the optimal substance on the enzyme activity; A is the result graph of different nitrogen sources, B is the result graph of different carbon sources, C is the result graph of different metal ions, D is the result graph of different skimmed milk powder concentrations, E is the result graph of different glucose concentrations, and F is the result graph of different magnesium ion concentrations; different lowercase letters in the figure indicate significant differences among treatments (P<0.05).

[0062] Figure 5 The results of the effects of culture medium pH, culture temperature and culture time on the protease activity of Bacillus subtilis SHAN-1; A is the result graph of pH, B is the result graph of different temperatures, and C is the result graph of different times; different lowercase letters in the figure indicate significant differences between treatments (P<0.05).

[0063] Figure 6 These are the colorimetric results of IAA production by Bacillus subtilis SHAN-1; A is a photo of a clean water control, B is a photo of the result of a LB blank culture medium without tryptophan, C is a photo of the result of a LB blank culture medium containing tryptophan, D is a photo of the result of a LB culture medium culture liquid without tryptophan, and E is a photo of the result of a LB culture medium culture liquid containing tryptophan.

[0064] Figure 7 These are the experimental results of the salt tolerance of Bacillus subtilis SHAN-1; the left figure is the result of Bacillus subtilis concentration under different NaCl concentrations, and the right figure is the result of IAA production under different NaCl concentrations.

[0065] Figure 8 The figure shows the effect of temperature and pH on the protease produced by Bacillus subtilis SHAN-1 and the SDS-PAGE result of the protease produced; A is the result of different temperatures, B is the result of different pH, and C is the SDS-PAGE result before and after the protease is purified.

[0066] Fig. 9 These are the fermentation broth results of two types of peanut bran fermented by Bacillus subtilis SHAN-1; A is the sample picture, and B is the SDS-PAGE result picture of the two types of fermented peanut bran.

[0067] Fig.10 This is the test result of peanut bran fermentation liquid of Bacillus subtilis SHAN-1 on germination and seedling stage of Chinese cabbage.

[0068] Fig.11 The results of the effect of peanut bran fermentation liquid of Bacillus subtilis SHAN-1 on citrus are shown in Figure 1, where A shows the effect of color change, and B shows a comparison of the effects of different treatment groups after citrus harvest. DETAILED DESCRIPTION

[0069] The present invention is further described in detail below in conjunction with the examples and drawings, but the embodiments of the present invention are not limited thereto. The experimental methods in the following examples where specific experimental conditions are not specified are usually carried out under conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents, etc. used, unless otherwise specified, can all be obtained commercially.

[0070] In the embodiment, the protease activity was determined by the Folin phenol method, and the specific steps are as follows:

[0071] (1) Take 1 mL of the fermentation broth to be tested and place it in a 1.5 mL centrifuge tube. Centrifuge at 12000 rpm for 1 min.

[0072] (2) Take two 1.5 mL test tubes and add 200 μL of casein substrate to each test tube. Add 600 μL of trichloroacetic acid solution to the control centrifuge tube. Then take 200 μL of the supernatant after centrifugation in (1) and add it to the two test tubes respectively. Then, place them in a 40°C water bath for 10 min.

[0073] (3) After the reaction is completed, centrifuge at 12000 rpm for 1 min, take two test tubes, add 2.5 mL of sodium carbonate, take 500 μL of the supernatant after centrifugation into the test tube, add 500 μL of Folin phenol reagent, let it stand for 30 min, and compare the color at 680 nm using an ultraviolet spectrophotometer.

[0074] Example 1: Isolation, screening and identification of Bacillus subtilis SHAN-1

[0075] 1. Isolation and Screening of Bacillus subtilis SHAN-1

[0076] 1. Culture medium formula

[0077] Beef extract peptone medium: beef extract 5.0 g·L -1 , peptone 10.0 g·L -1 , sodium chloride (NaCl) 5.0 g·L -1 , mass percentage 1.5% agar; the balance is deionized water.

[0078] LB liquid medium containing L-tryptophan: Tryptone 10.0 g L -1 , Yeast extract 5.0 g·L -1 、NaCl10.0 g·L -1 , L-tryptophan 200.0mg·L -1 ; The balance is deionized water.

[0079] Skim milk powder solid culture medium: Skim milk powder 6.0g·L -1 , mass percentage 1.5% agar; the balance is deionized water.

[0080] Salkowski colorimetric solution: 50mL 35% HClO4, 1mL 0.5mol·L -1 FeCl3.

[0081] 2. Enrichment

[0082] The strain of the present invention is derived from rhizosphere soil samples collected from the arboretum of South China Agricultural University. Take 10g of soil sample and add it to a triangular flask containing 100ml of sterile saline. After standing for 20min, shake it on a shaker at 28℃ and 180rpm for 30min. Take 1ml and add it to 9ml of sterile saline. Then dilute it 10 times. 2 , 10 3 , 10 4 , 10 5 , 10 6 times, dilute 10 4 , 10 5 , 10 6 100 μL of the soil suspension was evenly spread on a beef extract peptone medium plate, incubated in a 28°C incubator for 48 h, and single bacterial colonies of different morphologies were picked up with a sterile toothpick, streaked and purified, and stored for later use. A total of 96 bacterial strains were isolated.

[0083] 3. Initial screening

[0084] The isolated and purified strain was inoculated into a medium containing 200 mg L-tryptophan. -1 LB liquid medium was incubated at 30°C and 180 rpm for 24 h. 50 μL of bacterial suspension was dropped onto a white ceramic plate and an equal amount of Salkowski colorimetric solution was added for colorimetric reaction. -1 ) as a positive control. The white ceramic plate was placed at room temperature and protected from light for 30 minutes and then observed. If the color turned red, it indicated that IAA could be produced. The strains with a color close to the positive control, i.e., the darker color, were marked, a total of 17 strains were used for further rescreening.

[0085] 4. Rescreening

[0086] After the initial screening, the strains were purified and inoculated into skim milk powder solid culture medium, and then placed in a 30°C constant temperature incubator for 24 hours. If colonies were formed on the plate and transparent circles were formed around the colonies, it indicated that the strain could produce protease. The activity of the produced protease was judged according to the size of the transparent circle around the colonies, and the size of the transparent circle was measured, and the strain with the largest transparent circle was selected as the target strain.

[0087] After the above screening process, a strain that can produce high amounts of IAA and protease was finally isolated.

[0088] 2. Identification of Bacillus subtilis SHAN-1

[0089] 1. Morphological identification of strains

[0090] The strains screened were streaked on skimmed milk powder solid medium and cultured at 30°C for 24 h. The size and morphology of the colonies were observed. The morphology of the colonies and the results of Gram staining were observed under a microscope. Figure 1 shown. Figure 1 The culture medium in A is a solid culture medium with skimmed milk powder as the only nitrogen source. There is an obvious transparent circle around the colony, which means that the bacteria can produce protease and use skimmed milk powder as the nitrogen source for growth. Figure 1 The colony morphology of Bacillus subtilis SHAN-1 was observed in A. The colonies were white, not raised, with irregular edges, dry, and easy to pick up. Figure 1 The Gram stain in B was blue-purple, indicating that the strain was a Gram-positive bacterium. Figure 1 C is a scanning electron microscope image (SEM), which shows that the SHAN-1 strain is in the shape of a short rod under the electron microscope.

[0091] 2. Analysis of physiological and biochemical characteristics

[0092] According to Bergey's Manual of Bacterial Identification (8th Edition), sugar fermentation test, VP test, physiological and biochemical index test and other tests were carried out on Bacillus subtilis SHAN-1. The results are shown in Table 1.

[0093] Table 1 Test results of physiological and biochemical indicators of Bacillus subtilis SHAN-1

[0094]

[0095] Note: +: positive; -: negative

[0096] 3. Molecular identification

[0097] Scrape a small amount of the purified strain from a single colony grown on the culture medium, add it to 150 μL sterile water, mix well, boil for 10 minutes, centrifuge at 12000 r / min for 10 minutes, and take the supernatant for PCR amplification. The bacterial 16SrDNA universal primers (27F: 5′-AGAGTTTGATCCTGGTCAGAACGAACGCT-3′ and 1492R: 5′-TACGGCTACCTTGTTACGACTTCACCCC-3′) were used for PCR amplification. The amplification program was: 94°C 5min; 98°C 10s, 55°C 30s, 72°C 1kb / 1min, 35 cycles; 72°C 10min; 4°C storage. The obtained PCR product was verified by 1% agarose gel electrophoresis and then sequenced by Wuhan Tianyi Huiyuan Gene Technology Co., Ltd. The sequence of 16S rDNA is as follows:

[0098] CGGCGTGCTATACATGCAAGTCGAGCGGACAGATGGGAGCTTGCTCCCTGATGTTAGCGG

[0099] CGGACGGGTGAGTAACACGTGGGTAACCTGCCTGTAAGACTGGGATAACTCCGGGAAACCGG

[0100] GGCTAATACCGGATGGTTGTTTGAACCGCATGGTTCAAACATAAAAGGTGGCTTCGGCTACCA

[0101] CTTACAGATGGACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAACGA

[0102] TGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTA

[0103] CGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGT

[0104] GAGTGATGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGGGAAGAACAAGTACCGTTCGAAT

[0105] AGGGCGGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCG

[0106] GTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGCAGGCGGTTTC

[0107] TTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTG

[0108] AGTGCAGAAGAGGAGAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGA

[0109] ACACCAGTGGCGAAGGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTGGGG

[0110] AGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAAGTGTTAGGG

[0111] GGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGGTCGCA

[0112] AGACTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTC

[0113] GAAGCAACGCGAAGAACCTTACCAGGTCTTGACATCCTCTGACAATCCTAGAGATAGGACGT

[0114] CCCCTTCGGGGGCAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTT

[0115] GGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAGTTGGGCACTCT

[0116] AAGGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCTT

[0117] ATGACCTGGGCTACACACGTGCTACAATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTT

[0118] AAGCCAATCCCACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGCT

[0119] GGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCCGGGCCTTGTACACAC

[0120] CGCCCGTCACACCACGAGAGTTTGTAACACCCGAAGTCGGTGAGGTAACCTTTTAGGAGCCA

[0121] GCCGCCGAAG.

[0122] The sequencing results were submitted to the NCBI database, and the alignment was performed using its alignment program. The phylogenetic tree was constructed using the Neighbor-Joining method of MEGA11.0 software. The strain was identified as belonging to the genus Bacillus subtilis and named Bacillus subtilis SHAN-1. The phylogenetic tree constructed from the 16S rDNA sequence of this strain and its closely related strains is shown in Figure 2 Bacillus subtilis SHAN-1 was deposited on March 3, 2023 at the China General Microbiology Center (CGMCC) of the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 26729.

[0123] Example 2: Plotting of growth curve and enzyme production curve of Bacillus subtilis SHAN-1

[0124] (1) Strain activation: Bacillus subtilis SHAN-1 stored in glycerol at -80°C was inoculated into the seed culture medium and cultured at 30°C and 180 rpm for 36 h to obtain a strain in the logarithmic growth phase (OD 600=0.6~0.8) of seed liquid.

[0125] (2) Plotting of growth curve: The activated strain in (1) was inoculated into LB medium (100 mL / 250 mL), and cultured at 30°C and 180 rpm for 72 h. Samples were taken every 6 h, and the OD value was measured at 600 nm using an ultraviolet spectrophotometer. The growth curve of strain SHAN-1 was plotted. Figure 3 It can be seen that the strain is in the stagnant period from 0 to 6 hours, gradually enters the logarithmic period after 6 hours, reaches stability at 42 hours, the number of bacteria tends to balance, the OD value reaches the highest at 48 hours, and then gradually enters the decay period, at which time the metabolic activity of the strain decreases and autolysis occurs.

[0126] (3) Drawing of enzyme production curve: The activated strain in (1) was inoculated into skimmed milk powder liquid fermentation medium, and cultured at 30°C and 180 rpm for 72 h. 1 mL of sample was taken every 6 h, centrifuged at 10,000 rpm, and the protease activity in the supernatant was determined by the Folin phenol method. The enzyme production curve was drawn based on the determination results. The results are shown in FIG. Figure 3 As shown in the figure, the enzyme production curve of strain SHAN-1 is similar to the trend of its growth curve. The strain has low protease activity at 0-6h, then gradually increases and reaches the highest at 48h, when the enzyme activity is 815.79U / mL (before optimization of culture conditions). After 48h, the enzyme activity of the strain gradually decreases, which may be due to the fact that the protein in the culture medium has been basically consumed.

[0127] The formula of the seed culture medium in step (1) is: 10.0 g·L tryptone -1 , yeast extract 5.0g·L -1 , sodium chloride 10.0 g·L -1 , the balance is deionized water.

[0128] Formula of skim milk powder liquid fermentation medium in step (3): skim milk powder 8.0 g·L -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 、K2HPO4 1g·L -1 , the balance is deionized water.

[0129] Example 3: Study on Optimization of Medium Formula for Bacillus subtilis SHAN-1

[0130] (1) Strain activation: Bacillus subtilis SHAN-1 stored in glycerol at -80°C was inoculated into seed culture medium (tryptone 10.0 g L -1 , yeast extract 5.0g·L -1 , sodium chloride 10.0 g·L -1 , the balance was deionized water. ) was cultured at 30°C and 180 rpm for 36 h to obtain a culture medium in the logarithmic growth phase (OD 600 =0.6~0.8) of seed liquid.

[0131] (2) Fermentation medium optimization: The activated strain in step (1) was inoculated into a liquid fermentation medium. The liquid fermentation medium formula was: skimmed milk powder 6.0 g·L -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 、K2HPO4 1g·L -1 The balance is deionized water. By replacing the ingredients or adjusting the content, single factor experiments were conducted to investigate the effects of nitrogen sources (skim milk powder, urea, (NH4)2SO4, KNO3), carbon sources (glucose, sucrose, fructose, maltose, water-soluble starch, lactose) and metal ions (Mg 2+ , Cu 2+ 、Zn 2+ , Ca 2+ , Fe 3+ , Mn 2+ ) on the enzyme activity of the strain. The pH of the culture medium was 7.0, and the culture was shaken at 30°C and 180 rpm for 36 h. The optimal nitrogen source, carbon source and metal salt ion were selected by measuring the protease activity. The optimal concentration test was then carried out to further optimize the fermentation medium.

[0132] The results are as follows Figure 4 As shown by Figure 4 A shows that the order of protease activity of strain SHAN-1 in culture medium with different nitrogen sources is skim milk powder> ammonium sulfate> potassium nitrate> urea. The protease activity in the culture medium with skim milk powder as the only nitrogen source is the highest. Figure 4 D) found that when the concentration of skim milk powder in the culture medium was 10 g·L -1 When the enzyme activity of SHAN-1 reaches the highest level. Figure 4 B shows that the protease activity of the strain in the medium with glucose as the only carbon source is higher than that in the medium with the other five carbon sources, and when the concentration of glucose is 5 g·L -1 When Figure 4 E), therefore glucose was selected as the optimal carbon source for the enzyme production medium. Figure 4 C is the effect of different metal ions on the protease activity of Bacillus subtilis SHAN-1, Cu 2+ , Fe 3+ , Mn 2+ The enzyme activity of SHAN-1 was inhibited by Mg 2+ 、Zn 2+ , Ca 2+ It can promote the enzyme production of the strain, and Mg 2+ >Ca 2+ >Zn 2+ When the concentration of MgSO4·7H2O is 1.0 g·L -1 When the enzyme activity was higher than that of the control group, SHAN-1 had the highest enzyme activity, reaching 795.88 U / mL.

[0133] Example 4: Study on the culture conditions for enzyme production of Bacillus subtilis SHAN-1

[0134] (1) Strain activation: Bacillus subtilis SHAN-1 stored in glycerol at -80°C was inoculated into seed culture medium (tryptone 10.0 g L -1 , yeast extract 5.0g·L -1 , sodium chloride 10.0 g·L -1 , the remainder was deionized water), and cultured at 30°C and 180 rpm for 36 h to obtain the logarithmic growth phase (OD 600 =0.6~0.8) of seed liquid.

[0135] (2) Optimization of culture conditions: The seed solution obtained in step (1) was inoculated into an optimized liquid fermentation medium (10.0 g / L skim milk powder). -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 、K2HPO41g·L -1, the remainder being deionized water), and the pH of the culture medium (5.5, 6, 6.5, 7, 7.5, 8) was changed through a single factor experiment, and the reaction temperature was set at 30°C and the reaction time was 36h to explore the optimal reaction time; after determining the optimal reaction pH value (i.e. 7.0), the optimal culture temperature (26, 28, 30, 32, 34, 36°C) for enzyme production of the strain was explored, and the reaction time was set to 36h; finally, under the conditions of optimal reaction pH (7.0) and optimal culture temperature (32°C), the effect of culture time (24, 36, 48, 60, 72h) on enzyme production of the strain was explored, and the appropriate conditions were selected by measuring the protease activity of the fermentation broth obtained by the single factor experiment.

[0136] The results are as follows Figure 5 As shown in the results of variance analysis, when the pH value of the culture medium was 7.0, the protease activity produced by strain SHAN-1 was significantly higher than that under other pH conditions (P<0.05), reaching 837.48 U / mL. Figure 5 -B shows that the enzyme activity of the strain is the highest when the culture temperature is 30-32℃, and the enzyme activity at 32℃ is 3.7% higher than that at 30℃, indicating that the optimal enzyme production temperature of strain SHAN-1 should be 32℃. When the temperature is lower than 28℃ and higher than 36℃, the enzyme activity of the strain decreases significantly, indicating that too high or too low temperature will inhibit the enzyme production of the strain. Figure 5 -C shows that the enzyme activity is the highest when the culture time is 48h, up to 906.89U / mL, and significantly higher than the enzyme activity when the culture time is 36h (P<0.05), 4.05% higher, and when the strain is cultured for 60h, the enzyme activity is significantly reduced, which may be due to the consumption of nutrients in the culture medium and the inability of the strain to survive normally. The protease activity of the fermentation broth of the strain cultured under the optimal conditions in Example 4 is 906.89U / mL.

[0137] Example 5: Synthesis of IAA using Bacillus subtilis SHAN-1

[0138] (1) Prepare LB medium containing L-tryptophan. Formula: 10 g / L tryptone -1 , yeast extract 5g·L -1 , sodium chloride 10g·L -1 , L-Tryptophan 200mg·L -1 , the balance is deionized water. Prepare Salkowski colorimetric solution. Formula: 50mL 35% HClO4, 1mL 0.5mol·L -1 FeCl3, the balance is deionized water.

[0139] (2) The activated strain was inoculated into LB medium and 200 mL LB medium containing L-tryptophan at a 1.5% inoculum amount, and three replicate experiments were set up. The culture conditions were 32° C. and 180 rpm in a shaker for 48 h.

[0140] (3) UV spectrophotometer method to measure IAA content:

[0141] ① Draw an IAA standard curve. Accurately weigh 10 mg of IAA, dissolve it in a small amount of ethanol, and then add water to make up to 100 mL. -1 (Concentration 100 μg mL -1 ) as the stock solution; the stock solution was used to prepare 0, 0.5, 1.0, 5.0, 10.0, 15.0, 20.0, 25.0 μg mL -1 A series of standard solutions were prepared and mixed with Salkowski colorimetric solution at a volume ratio of 1:1, and kept at room temperature in the dark for 30 minutes; a mixed solution of equal volumes of distilled water and Salkowski colorimetric solution was used as a control, and the OD of each concentration was measured using a spectrophotometer. 530 Value; with IAA concentration as the horizontal axis, OD 530 The value is plotted as the ordinate, which is the IAA standard curve.

[0142] ② Centrifuge the bacterial suspension at 10,000 rpm for 10 min, take 2 mL of the supernatant and add 2 mL of Salkowski colorimetric solution, shake well, and let it stand in the dark at room temperature for 30 min. Use an equal volume mixture of uninoculated liquid culture medium and Salkowski colorimetric solution as a control and measure the OD using a spectrophotometer. 530 The corresponding IAA content was calculated using the IAA standard curve. Figure 6 Among them, the bacterial solution in the LB culture medium without tryptophan and the bacterial solution in the LB culture medium containing tryptophan are both light red, and the latter is redder than the former. The reason may be that the strain can convert L-tryptophan into IAA, while in ordinary LB culture medium, the strain will decompose the nitrogen source in the culture medium, and the tryptophan in the metabolite will be used by the strain again to generate IAA. Therefore, in the LB culture medium without tryptophan, the colorimetric result is light red.

[0143] Finally, according to the standard curve, it was calculated that Bacillus subtilis SHAN-1 could produce IAA under the culture conditions, and the IAA content determined by colorimetry was 71.80 μg mL -1 .

[0144] (4) Determination of IAA content by high performance liquid chromatography:

[0145] ① Centrifuge the bacterial suspension at 10,000 rpm for 10 min, filter 1 mL of the supernatant through a 0.45 μm nylon filter membrane and place in a high performance liquid phase bottle for testing.

[0146] ② The detection conditions were set as follows: the detection wavelength was 210 nm, the column temperature was 35°C, the mobile phase was methanol (v): acetonitrile (v): pH citric acid buffer (v) = 20:20:60, and the flow rate was 1.0 mL / min.

[0147] ③ Draw the IAA standard curve. Accurately weigh 10 mg of IAA, dissolve it in a small amount of ethanol, and then add water to make up to 100 mL. -1 (Concentration 100 μg mL -1 ) as the stock solution; the stock solution was used to prepare 0, 0.5, 1.0, 5.0, 10.0, 15.0, 20.0, 25.0 μg mL -1 A series of standard solutions. The standard curve of IAA was obtained by high performance liquid chromatography. The corresponding IAA content was calculated by the IAA standard curve to be 72.57 μg mL -1 .

[0148] Example 6: Study on salt tolerance of Bacillus subtilis SHAN-1

[0149] (1) Strain activation: Bacillus subtilis SHAN-1 stored in glycerol at -80°C was inoculated into seed culture medium (tryptone 10.0 g L -1 , yeast extract 5.0g·L -1 , sodium chloride 10.0 g·L -1 , the remainder was deionized water), and cultured at 30°C and 180 rpm for 36 h to obtain the logarithmic growth phase (OD 600 =0.6~0.8) of seed liquid.

[0150] (2) Salt tolerance of strains: The activated strain in (1) was inoculated into LB medium containing 2, 6, 10, 14, 18, or 20% (w / v) NaCl at a volume percentage of 2.5%, and cultured in a constant temperature shaker at 32°C and 180 rpm for 48 h. The uninoculated LB medium was used as a blank control. Each treatment was repeated 3 times. After the culture was completed, the OD 600 The result is Figure 7As shown, the strain can survive in the concentration range of 1-24% (w / v). When the salt concentration is less than 10%, the OD value of the bacterial solution is above 0.8, indicating that the strain SHAN-1 can survive well in this concentration range and reach the logarithmic growth phase. When the NaCl concentration is greater than 10%, the OD value of the bacterial solution shows a downward trend, indicating that the strain is subjected to salt stress within this range, and the stress is aggravated with the increase of salt concentration, but it is not lethal in the highest concentration (20%) set in this experiment, and can still survive, which can indicate that the strain has a high salt tolerance.

[0151] (3) Effect of high salt conditions on protease production of SHAN-1 strain: The activated strain in (1) was inoculated into a liquid fermentation medium containing 2, 6, 10, 14, 18, and 20% (w / v) NaCl. Each treatment was repeated 3 times. After the culture was completed, the protease activity in the fermentation broth was determined according to the method for determining protease activity in Example 4. The relative enzyme activity at each NaCl concentration was calculated. The results are shown in FIG. Figure 7 As shown in the figure, when the salt concentration is 0-10%, the relative activity of the strain's protease production is above 73.75%, indicating that the strain can survive normally within this salt concentration range and can still produce enzymes normally. When the concentration is 14%, the relative enzyme activity is 42.80%, and when the NaCl concentration is greater than 14%, the strain can also produce enzymes, but the enzyme activity is reduced, indicating that the strain's enzyme production ability is inhibited by high salt concentration at this time.

[0152] (4) Effect of high salt conditions on IAA production by SHAN-1 strain: The activated strain in (1) was inoculated into a solution containing 200 mg L-tryptophan. -1 The NaCl concentration was set to 2, 6, 10, 14, 18, and 20% (w / v) in the LB medium, and the culture was carried out in a constant temperature shaker at 32°C and 180 rpm for 48 h. After the culture was completed, the IAA concentration in the fermentation broth was determined by the method for determining the IAA content in Example 5. The results are as follows: Figure 7 As shown. From the overall trend, as the salt concentration of the culture medium increases, the concentration of IAA produced by the bacteria gradually decreases, indicating that the ability of the bacteria to produce IAA is stressed by the salt concentration. However, when the NaCl concentration is between 0 and 10%, the concentration of IAA produced can still reach more than 44.67μg / mL, and IAA can still be produced at a high level, indicating that the SHAN-1 strain can still maintain a high activity under high salt conditions.

[0153] Liquid culture medium formula in step (3): skimmed milk powder 10.0 g·L -1 , glucose 5.0 g·L -1 、MgSO4·7H2O1g·L -1 、K2HPO4 1g·L -1 , the balance is deionized water.

[0154] Example 7: Preparation of protease using Bacillus subtilis SHAN-1

[0155] (1) Strain activation: Bacillus subtilis SHAN-1 stored in glycerol at -80°C was inoculated into the seed culture medium and cultured at 30°C and 180 rpm for 36 h to obtain a strain in the logarithmic growth phase (OD 600 =0.6~0.8) of seed liquid.

[0156] (2) The seed solution in step (1) is inoculated into a liquid fermentation medium at an inoculum rate of 3% (v / v), placed in a constant temperature shaker, and shaken and cultured at 32° C. and 180 rpm for 48 h to obtain a fermentation broth containing protease.

[0157] (3) The fermentation liquid after culturing for 48 hours in step (2) is centrifuged at 10000-12000 rpm and 4° C. for 10 minutes, the supernatant is collected, and the bacteria in the supernatant are removed with a filter membrane with a pore size of 0.22 μm. The filtrate is the crude protease enzyme solution fermented by Bacillus subtilis SHAN-1.

[0158] The seed culture medium in step (1) is 10.0 g·L tryptone. -1 , yeast extract 5.0g·L -1 , sodium chloride 10.0 g·L -1 .

[0159] The formula of the liquid fermentation medium in step (2) is skimmed milk powder 10.0 g·L -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 、K2HPO4 1g·L -1 , the balance is deionized water; pH is 7.0.

[0160] Example 8: Purification and enzymatic properties of protease produced by Bacillus subtilis SHAN-1

[0161] (1) Purification of protease: The protease produced by Bacillus subtilis SHAN-1 was purified by ammonium sulfate graded precipitation method. The specific steps are as follows: Place the beaker containing the crude enzyme solution in a magnetic stirrer, and slowly add ammonium sulfate crystals to it under magnetic stirring to make the saturated concentration of ammonium sulfate range from 0 to 30%, 30% to 50%, 50% to 70%, and 70% to 90%, respectively; After the ammonium sulfate crystals are completely dissolved, centrifuge at 4°C for 10 minutes with the speed set to 8000 rpm to collect the precipitate; Place the collected precipitate in a pH 7.0, 20 mmol / L phosphate buffer solution to completely dissolve, dialyze it at 4°C using a 14 kDa dialysis bag for 36 hours and measure its protease activity.

[0162] (2) Determination of molecular weight: The enzyme protein with the highest activity in the ammonium sulfate saturation concentration range in (1) was subjected to polyacrylamide gel electrophoresis (SDS-PAGE) test. The results are as follows: Figure 8 -C, after alignment with the marker, it was found that the molecular weight of the target protein was approximately 75 kDa.

[0163] (3) Effect of temperature on enzymatic reaction: A single-factor experiment was used to explore the optimal reaction temperature of the protease produced by Bacillus subtilis SHAN-1 by changing the reaction temperature in the protease activity assay (i.e., the water bath temperature in step (2)). The reaction temperature was set to 20, 25, 30, 35, 40, 45, 50, 55, and 60°C, and the substrate pH was 7.0. The results are shown in Figure 2. Figure 8 -A shows that the activity of the protease reaches the highest at 40°C, and temperatures above or below this temperature will inhibit the activity of the enzyme. Therefore, 40°C is determined to be the optimal temperature for the protease produced by this strain.

[0164] (4) Effect of pH on enzymatic reaction: A single factor experiment was used to explore the optimal reaction temperature of the protease produced by Bacillus subtilis SHAN-1 by changing the pH value of the substrate. Casein substrates with different pH values ​​were prepared, and the pH values ​​were set to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12. The enzyme activity determination steps were the same as in Example 4. The results are shown in FIG. Figure 8 -B. As shown in the figure, the protease is active in weak acid, weak base and neutral environment, but the protease is almost inactivated in strong acid (pH <4) or strong base (pH >9) environment, and at pH 7, it shows the highest enzyme activity. Therefore, it is determined that pH 7 is the optimal pH for the protease reaction produced by this strain.

[0165] Example 9: Method for fermenting peanut bran using Bacillus subtilis SHAN-1

[0166] The method for fermenting peanut bran using Bacillus subtilis SHAN-1 screened in Example 1 is as follows:

[0167] (1) Sample preparation: The peanut bran used in the present invention was purchased from an oil press workshop in Meizhou City, Guangdong Province. First, the peanut bran was placed in an oven at 60°C for 2 hours for drying, and then ground into powder using a grinding machine, passed through a 60-mesh sieve, and placed in a sealed bag for later use.

[0168] (2) Preparation of bacterial suspension: Bacillus subtilis SHAN-1 preserved in glycerol at -80°C was inoculated into a liquid fermentation medium at a rate of 3% (v / v). The volume of each bottle was 30% by volume. 150 mL was prepared for standby use. The suspension was cultured at 30°C and 180 rpm for 48 h to obtain a bacterial suspension containing the protease produced by the strain.

[0169] (3) Alkaline hydrolysis: Weigh 20% peanut bran by mass and place it in a biological fermentation tank, inject 70% secondary water by mass, and stir at 300 rpm and 30° C. Accurately weigh 2% NaOH by mass and add it to the fermentation tank, set the alkaline hydrolysis conditions to 60° C., 350 rpm, and alkaline hydrolysis for 12 h.

[0170] (4) Enzymatic hydrolysis: adjust the pH of the fermentation tank contents to above 10, accurately weigh 5 g / L alkaline protease, add it to the fermentation tank, set the enzymatic hydrolysis temperature to 50°C, the rotation speed to 300 rpm, and perform enzymatic hydrolysis for 20 h.

[0171] (5) Bacterial hydrolysis: The pH value of the liquid in the fermentation tank is measured and adjusted to a range of 6.5 to 7.5. The bacterial suspension prepared in step (2) is then inoculated into the fermentation tank at an inoculum amount of 5% by volume, and a liquid fermentation medium containing L-tryptophan is added thereto according to the total volume of the system. The fermentation temperature is set to 32° C., the rotation speed is set to 350 rpm, and the bacterial hydrolysis is performed for 48 hours to obtain peanut bran fermentation liquid 1. The sample liquid is as follows: Fig. 9 -A.

[0172] The liquid fermentation medium containing L-tryptophan in step (5) is 200 mg / L L-tryptophan. -1 , skim milk powder 6.0g·L -1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 、K2HPO4 1g·L -1 , the balance is deionized water.

[0173] Example 10: Method for fermenting peanut bran using Bacillus subtilis SHAN-1

[0174] The method for fermenting peanut bran using Bacillus subtilis SHAN-1 screened in Example 1 is as follows:

[0175] (1) Sample preparation: The peanut bran used in the present invention was purchased from an oil press workshop in Meizhou City, Guangdong Province. First, the peanut bran was placed in an oven at 60°C for 2 hours for drying, and then ground into powder using a grinding machine, passed through a 100-mesh sieve, and put into a sealed bag for later use.

[0176] (2) Preparation of bacterial suspension: Bacillus subtilis SHAN-1 preserved in glycerol at -80°C was inoculated into liquid fermentation medium at a volume of 3% (v / v), and the volume of each bottle was 30%, and 150 mL was prepared for standby use. The suspension was cultured at 30°C and 180 rpm for 48 hours to obtain a bacterial suspension containing the protease produced by the strain. Saccharomyces cerevisiae was inoculated into PDB medium, and the volume of each bottle was 30%, and 150 mL was prepared for standby use. The suspension was cultured at 28°C and 180 rpm for 24 hours to obtain a bacterial suspension of Saccharomyces cerevisiae.

[0177] (3) Alkaline hydrolysis: Weigh 20% peanut bran by mass and place it in a biological fermentation tank, inject 70% secondary water by mass, and stir at 300 rpm and 30° C. Accurately weigh 2% NaOH by mass and add it to the fermentation tank, set the alkaline hydrolysis conditions to 60° C., 350 rpm, and alkaline hydrolysis for 12 h.

[0178] (4) Enzymatic hydrolysis: adjust the pH of the fermentation tank contents to above 10, accurately weigh 5 g / L alkaline protease and 5 g / L lipase, add them to the fermentation tank, set the enzymatic hydrolysis temperature to 50°C, the rotation speed to 300 rpm, and perform enzymatic hydrolysis for 20 h.

[0179] (5) Bacterial hydrolysis: The pH value of the liquid in the fermentation tank was measured and adjusted to a range of 6.5 to 7.0. The SHAN-1 bacterial suspension and the saccharomyces cerevisiae suspension prepared in step (2) were inoculated into the fermentation tank at an inoculation rate of 5% by volume, and the liquid fermentation medium containing L-tryptophan and the PDB medium were added thereto according to the total volume of the system. The fermentation temperature was set to 30° C., the rotation speed was set to 350 rpm, and the bacterial hydrolysis was performed for 48 hours to obtain the peanut bran fermentation liquid, sample liquid 2, as shown in FIG. Fig. 9 -A.

[0180] The liquid fermentation medium containing L-tryptophan in step (5) is 200 mg / L L-tryptophan. -1 , skim milk powder 6.0g·L-1 , glucose 5.0 g·L -1 、NaCl 4.0g·L -1 、MgSO4·7H2O 1g·L -1 、K2HPO4 1g·L -1 , the balance is deionized water.

[0181] Example 11: Determination of protein molecular weight, yield and nutritional components of the fermentation broth of peanut bran fermented by Bacillus subtilis SHAN-1

[0182] The peanut bran fermentation broth in Example 9 and Example 10 was used to carry out SDS-PAGE, organic matter content determination, protein content determination, polypeptide content determination, and water-soluble sugar content determination.

[0183] (1) Determination of Molecular Weight: The peanut bran fermentation broths of Examples 9 and 10 were subjected to polyacrylamide gel electrophoresis (SDS-PAGE) test, with the following treatments: unfermented peanut bran suspension, peanut bran fermentation broth 1 (the peanut bran fermentation broth of Example 9), and peanut bran fermentation broth 2 (the peanut bran fermentation broth of Example 10). The results are shown in Table 1. Fig. 9 -B, after comparison with the marker, it was found that the protein molecular weight of the fermented peanut bran was more concentrated below 15 kDa, and the band corresponding to the peanut bran fermentation broth 2 was longer and more intense, indicating that the fermentation method can degrade the peanut bran more thoroughly and degrade it into small molecular weight proteins. In addition, the bands of the two fermentation broths are relatively close, and there are two clear bands between 30 and 35 kDa.

[0184] (2) Degradation yield determination: The peanut bran fermentation solution of Example 9 and Example 10 was filtered with filter paper, and the filter residue and the filter paper were placed in an oven, dried at 60° C. for 18 h, and then weighed. The mass of peanut bran dissolved in the solution was calculated based on the mass of the remaining peanut bran residue and the mass of the peanut bran raw material, and the yield of the peanut bran was obtained. The results are shown in Table 2.

[0185] (3) Determination of organic matter content: Referring to the industry standard "Determination of organic matter content of water-soluble fertilizers NY / T1976-2010", the specific steps are as follows: Centrifuge the peanut bran fermentation liquid of Example 8 and Example 9 at 3000rpm for 10min, take 1.0000g of the supernatant and place it in a 100mL volumetric flask, dilute with water, and mix well. Immediately draw 5.0mL of the sample solution into the digestion tube, add 5.0mL of potassium dichromate solution and 10.0mL of sulfuric acid thereto, and place a curved funnel at the mouth of the tube. Place the digestion tube in a digestion furnace preheated to 200-230°C, open the fume hood, start timing when a drop of condensate falls from the lower end of the curved funnel, digest for 10min±0.5min, remove the small main pipe, rinse the inner wall of the condensation tube with water, and transfer all the liquid in the digestion tube to a 200mL triangular flask. Add 3 to 5 drops of o-phenanthroline indicator to the conical flask and titrate with ferrous sulfate solution. When the solution color turns brown-red, the titration endpoint is reached. Record the volume of ferrous sulfate solution consumed and perform data analysis. The experiment was set up with clean water as the blank control. Each treatment and blank were repeated 3 times. The results are shown in Table 2.

[0186] (4) Protein content determination: Prepare a standard protein solution (10 mg mL -1 ), used to draw a standard curve. The peanut bran fermentation broth of Example 8 and Example 9 was centrifuged at 3000rpm for 5min, and the supernatant was collected for testing. 1mL of the test solution was taken into a test tube, 4mL of biuret reagent was added and mixed thoroughly, and then placed at room temperature for 15min and then colorimetric determination was performed at a wavelength of 540nm, and the absorbance was recorded. The results are shown in Table 2.

[0187] (5) Determination of amino acid content: Prepare 5 μg·mL amino acid standard solution -1 , used to draw a standard curve. Centrifuge the peanut bran fermentation broth of Example 8 and Example 9 at 3000rpm for 5min, and collect the supernatant. Take 1mL of supernatant in a 20mL test tube, add 1ml of distilled water, 3ml of ninhydrin hydrate, 0.1ml of 0.1% ascorbic acid, seal it with a stopper and heat it in boiling water for 15min. After taking it out, cool it quickly with cold water and shake it from time to time. When the solution turns blue-purple, use 60% ethanol to make up to 20ml, shake it well and compare the color at a wavelength of 570nm. The μg number of each amino acid is known from the standard curve, and the favorable amino acid content is calculated. The results are shown in Table 2.

[0188] (6) Determination of water-soluble sugar content: The peanut bran fermentation broth of Example 8 and Example 9 was centrifuged at 3000 rpm for 5 min, and the supernatant was collected for testing. 50 mL of the test solution was placed in a 100 mL volumetric flask, and 6 mol·L -1HCl5mL, place in a water bath and heat for 10min. After cooling, add 2-3 drops of phenolphthalein indicator to a concentration of 6mol·L -1 Neutralize the NaOH solution until it just turns light red, add water to make up the volume, transfer to a burette, and use it to titrate the boiling Fehling's reagent.

[0189] As shown in Table 2, fermentation broth 1 is a peanut bran fermentation broth prepared by the method of Example 10, and fermentation broth 2 is a peanut bran fermentation broth prepared by the method of Example 11. From the results, it can be seen that the yield of peanut bran extracted by the fermentation process is greatly improved, and the organic matter content is also significantly higher than that of fermentation broth 1. The reason may be that under the action of lipase and yeast, substances such as fat and polysaccharides are degraded into small molecules and enter the solution. In addition to the yield, compared with the blank control extracted only by water, the contents of various substances in fermentation broth 1 and fermentation broth 2 were increased. The organic matter content was 204.35% and 247.65% higher than the blank, respectively; the protein content was 444.06% and 483.81% higher, respectively; the free amino acid content was 296.46% and 274.90% higher, respectively; the water-soluble sugar content was 44.21% and 52.01% higher, respectively. This shows that the method for fermenting peanut bran provided by this study can well degrade peanut bran into highly soluble functional substances, which provides a powerful condition for the better application of peanut bran fermentation broth in agriculture.

[0190] Table 2 The yield and nutrient content of peanut bran fermentation liquid

[0191]

[0192] Note: Different lowercase letters after the data in the same column indicate significant differences (P<0.05).

[0193] Example 12: Study on the Antioxidant Activity of Fermentation Broth of Peanut Bran Fermented by Bacillus subtilis SHAN-1

[0194] (1) DPPH oxidation test: 2 mL of the peanut bran fermentation broth of Example 8 and Example 9 were mixed with an equal volume of 0.1 mmol·L -1 The DPPH methanol solution (80% methanol) was mixed vigorously and kept at room temperature in the dark for 30 minutes. The optical density of the solution was measured at 517 nm, and the control was prepared by replacing the peanut bran fermentation liquid with methanol. The DPPH free radical scavenging rate (%) was calculated.

[0195] (2) ABTS oxidation test: prepare 2.6 mmol L -1 Potassium persulfate solution 50mL and 7.4mmol·L -1Mix with 50mL of ABTS· solution, refine at room temperature in the dark for 24h to make ABTS· stock solution, and store at 4°C in the dark. When using, the above stock solution needs to be diluted into a working solution so that its absorbance at 734nm is 0.700±0.020. Take 0.2mL of the peanut bran fermentation broth of Example 8 and Example 9, add 3.8mL of ABTS· working solution, stand at room temperature in the dark for 10min, and measure the absorbance at 734nm. Calculate the free radical scavenging rate (%) of ABTS·.

[0196] (3) Superoxide anion free radical (O2 - ) Oxidation test: Take 10 mg mL -1 0.2 mL of sample solution was added, pH 8.2, 50 mmol·L -1 4.5mL of Tris-HCl buffer and 4mL of distilled water were mixed and kept at 27℃ for 10min as reagent A. 3mmol / L pyrogallol solution was prepared with 10mmol / L HCl solution and kept at 25℃ for 10min as reagent B. Reagent A was mixed with 0.3mL of 10mmol / L HCl solution as blank and zeroed. Reagent A and 0.3mL of reagent B were mixed and the absorbance was measured at 320nm within 3min; the above process was repeated with deionized water instead of sample as control to obtain the slope K0 of absorbance change. Calculate O2· - Free radical scavenging rate (%).

[0197] The test results are shown in Table 3. The results show that the three free radical scavenging rates of fermentation broth 1 and fermentation broth 2 are higher than those of the control (water extraction), especially the ABTS free radical scavenging rate, which is 235.56% and 317.49% higher than that of the control, respectively. This shows that after extraction by alkaline hydrolysis, enzymatic hydrolysis and other processes, most of the macromolecular proteins are degraded into small molecular polypeptides and amino acids, which greatly improves the antioxidant capacity of the fermentation broth. In addition, the three free radical scavenging rates of fermentation broth 2 are higher than those of fermentation broth 2, which may be due to the fact that the fermentation method of Example 11 produces more soluble antioxidant active substances, thereby improving the antioxidant capacity of the fermentation broth.

[0198] Table 3 Antioxidant activity of peanut bran fermentation broth

[0199]

[0200] Note: Different lowercase letters after the data in the same column indicate significant differences (P<0.05).

[0201] Example 13: Effect of Bacillus subtilis SHAN-1 bacterial suspension on germination of Chinese cabbage seeds

[0202] Youqing 49 was used as the experimental material. Seeds of Chinese cabbage with full grains were selected and soaked in sterile water and bacterial resuspension respectively. The bacterial resuspension was resuspended in a bacterial solution grown to the logarithmic phase with a concentration of 1.0×10 6 CFU / mL, 1.0×10 7 CFU / mL and 1.0×10 8 CFU / mL bacterial suspension, soaking time was 24h, dosage was 50mL, each group of seeds had 50 seeds, 3 replicates were set for each treatment, the germination standard was the whitening of seeds, the germination was observed after soaking, and the germination rate was calculated. The results are shown in Table 4. The treatments using the strain resuspension for germination were all higher than the clear water control, indicating that the fermentation liquid of Bacillus subtilis SHAN-1 has a promoting effect on the germination of crops. Among them, the concentration is 1.0×10 6 The germination rate of CFU / mL was significantly higher than that of the other three groups (P<0.05), and was 6.5% higher than that of the water control, while 1.0×10 7 CFU / mL and 1.0×10 8 There was no significant difference in the CFU / mL of bacterial suspension between the treatments, so the concentration was 1.0×10 6 The fermentation liquid of strain SHAN-1 with CFU / mL has a good promoting effect on crop seed germination.

[0203] Table 4 Effects of SHAN-1 fermentation liquid on germination and growth of Chinese cabbage seeds

[0204]

[0205] Note: Different lowercase letters after the data in the same column indicate significant differences (P<0.05).

[0206] Example 14: Effect of Bacillus subtilis SHAN-1 on the growth of Chinese cabbage seedlings

[0207] Youqing 49 was used as the test material. Germinated seeds of the same size and shape were inoculated in a square plastic culture dish, with one seed in each grid. 6 CFU / mL, 1.0×10 7 CFU / mL and 1.0×10 8CFU / mL resuspended bacterial suspension was used to culture Chinese cabbage seeds. 15mL was added to each dish. The bacterial suspension was supplemented every 3 days, and 1 / 6 Hochland nutrient solution was added to 1 / 3 of the culture dish every day. A clear water control group (CK) cultured with only clear water and a control group cultured with only 1 / 6 Hochland nutrient solution were set up. Three replicates were set for each treatment and cultured in a 28°C incubator. After 15 days of culture, the plant height and root length of each Chinese cabbage were measured. The results are shown in Table 4, and photos were taken and recorded. At the same time, the activity of IAA oxidase in Chinese cabbage was determined. 0.5g of fresh Chinese cabbage plants were weighed in a sterile mortar, and 5mL of pre-cooled phosphate buffer (pH=6.1) was quickly added. Grind in an ice bath, centrifuge at 4°C, 4000rpm for 10min, and then centrifuge the supernatant at 4°C, 4000rpm for 10min. The resulting supernatant was the crude enzyme solution. The IAA oxidase activity of Chinese flowering cabbage was determined according to the colorimetric method in the Plant Physiology Guide edited by Zhang Zhiliang. Three replicates were set for each treatment. The results are shown in Table 4.

[0208] The experimental results are shown in Table 4 and Fig.10 Compared with the water control group, the growth rate of Chinese cabbage treated with bacterial suspension was faster, the leaf color was greener and the leaf area was larger. Compared with the 1 / 6 Hoagland's nutrient solution treatment, the concentration of 1.0×10 7 CFU / mL and 1.0×10 8 CFU / mL bacterial suspension treated with Chinese cabbage heart growth similar to the naked eye, but the concentration of 1.0×10 6 The growth rate of Chinese cabbage treated with CFU / mL bacterial suspension was the best. From the plant height and root length data in Table 6, we can see that 1.0×10 6 The plant height treated with bacterial suspension of 1.0×10 / mL was higher than that of the blank and nutrient solution groups, 1.9 times that of the water control, and higher than that of 1.0×10 7 CFU / mL and 1.0×10 8 CFU / mL bacterial suspension treatment was 26.69% and 29.29% higher, respectively, while the root length had no significant difference with the other two groups of bacterial suspension treatment. 7 The root length and plant height of Chinese cabbage seedlings treated with CFU / mL were slightly higher than 1.0×10 8 CFU / mL bacterial suspension treatment was 0.81% and 2.05% higher, respectively, and was also slightly higher than the 1 / 6 Hoagland's nutrient solution treatment. In addition, from the IAA oxidase data of the choy sum treated with water control and 1 / 6 Hoagland's nutrient solution treatment, it can be seen that the IAA oxidase activity of the plants treated with bacterial suspension was higher, and the IAA oxidase activity of the plants treated with bacterial suspension was lower, and the bacterial suspension concentration was 1.0×10 6 The activity of CFU / mL was as low as 1.79mgIAA·g -1 DW h -1The results showed that the SHAN-1 suspension can effectively reduce the IAA oxidase activity of plants, reduce the oxidative decomposition of IAA, and promote the absorption of IAA by plants, thereby achieving the effect of promoting plant growth. Based on the above results, the IAA and other substances contained in the fermentation liquid of the strain SHAN-1 have a promoting effect on the growth of crops, and the concentration of 1.0×10 6 The effect of bacterial suspension with CFU / mL is more obvious.

[0209] Example 15: Effect of the fermentation broth of peanut bran fermented by Bacillus subtilis SHAN-1 on the color change and sugar increase of citrus

[0210] The peanut bran fermentation liquid prepared in Example 9 and Example 10 was used during the color change period of citrus fruits to explore the effect of the peanut bran fermentation liquid on the color change of citrus fruits.

[0211] Test location: Wanguo Town, Zengcheng District, Guangzhou City, Guangdong Province

[0212] Test crop: Golden Autumn Tangerine

[0213] The experimental treatments are shown in Table 5 below.

[0214] Table 5 Experimental treatments and application methods

[0215]

[0216] Take photos to record the color changes after each treatment, such as Fig.11 As shown. Citrus samples were collected during the harvest period to determine the peel color difference LAB value, soluble solid content, soluble sugar content, titratable acid, vitamin C content and other indicators. The peel color difference LAB value was determined using a colorimeter (3nh SC-10). The determination of soluble solid content was carried out in accordance with the standard "NY / T2637-2014 Fruit and Vegetable Soluble Solid Content Determination Refractometer Method". The determination of soluble sugar content was carried out in accordance with the standard "NY / T 2742-2015 Fruit and Product Soluble Sugar Determination 3,5-Dinitrosalicylic Acid Colorimetric Method". The determination of titratable acid content was carried out using the indicator titration method in the national standard "Citrus Fresh Fruit Inspection Method" (GB / T8210-2011) to determine the acid content. The method for determining the vitamin C content refers to Method 3, 2,6-dichloroindophenol method, in "Determination of Ascorbic Acid in Foods" (GB 5009.86-2016).

[0217] The color change of single fruit by different treatments ( Fig.11A) It can be seen that the treatment of spraying peanut bran fermentation liquid changes color faster and more evenly than the control group. Among them, the effect of applying 300 times of peanut bran fermentation liquid in Example 9 is better than 500 times, and the effect of 500 times is equivalent to that of commercially available competitive products. The color change of the peanut bran fermentation liquid in Example 10 is the best, the epidermis color is uniform and shiny, and the effect of spraying 300 times is more obvious than 500 times, which is consistent with the peanut bran fermentation liquid in Example 9. Fig.11 B is a method for comparing the appearance of citrus fruits after different treatments are collected at the same time. It can be clearly seen that the citrus fruits in the clear water control group are small and the peels change color unevenly, while the fruit diameter of the peanut bran fermentation liquid 2 (i.e., the peanut bran fermentation liquid of Example 10) is large, the color is uniform, and the size of the fruit sprayed 300 times is more uniform than that sprayed 500 times. In addition, the effect of 500 times spraying of peanut bran fermentation liquid 1 (i.e., the peanut bran fermentation liquid of Example 9) is worse than 300 times, but it is comparable to commercially available competitive products. This is consistent with the situation of single fruit color change, indicating that the peanut bran fermentation liquid developed by this institute has a certain promoting effect on the color change and growth of citrus.

[0218] The quality indicators of citrus fruits after each treatment are shown in Table 6. Overall, T3 has a significant effect on promoting the accumulation of sugar in citrus fruits. Compared with commercially available competing products, the soluble solids content of T3 is 20.29% higher, T4 is 10.43% higher than competing products, and the soluble solids content of T1 and T2 are 12.79% and 12.56%, respectively, which are 4.24% and 2.36% higher than competing products, indicating that the peanut bran fermentation liquid of Example 10 can have a positive effect on increasing the soluble sugar content of citrus. Vitamin C, also known as ascorbic acid, is beneficial to human health when consumed in moderation and is also an important indicator for determining fruit quality. In this study, the results of vitamin C content determination showed that the four treatments were significantly higher than the competing products, and T3 was 19.13% higher than the competing products, and T1 and T2 were 7.17% and 3.76% higher than the competing products, respectively, indicating that the peanut bran fermentation developed in this study can effectively increase the vitamin C content of citrus fruit, and enhance its flavor and nutritional value. As for whether the peanut bran fermentation liquid of strain SHAN-1 affects the sugar increase of citrus fruit, soluble sugar and soluble acid are important considerations. As shown in Table 6, the soluble sugar content of citrus fruit after spraying with peanut bran fermentation liquid was significantly higher than that of commercially available competing products, and the titratable acid content was lower than that of commercially available competing products. Among them, T3 and T4 were reduced more, with soluble sugar content 15.96% and 12.02% higher, respectively, and titratable acid content 15.00% and 9.52% lower than that of competing products, respectively. The reason why the fermentation broth prepared in Example 10 is better than the fermentation broth prepared in Example 9 may be that the lipase and yeast added in the fermentation method can degrade substances such as fat and polysaccharides into small molecules and enter the solution, and these substances have a promoting effect on the quality and nutritional value of citrus. In summary, the peanut bran fermentation broth prepared in this study has a promoting effect on reducing acid and increasing sugar in citrus, and has a certain improvement on the quality and flavor of the fruit.

[0219] Table 6 Effect of peanut bran fermentation liquid of strain SHAN-1 on sugar content of citrus fruit

[0220]

[0221] Note: Different lowercase letters after the data in the same column indicate significant differences (P<0.05).

[0222] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A strain of Bacillus subtilis SHAN-1, characterized in that: It was deposited on March 3, 2023 at the General Microbiology Center of the China Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.26729.

2. A bacterial agent, characterized in that: Containing the Bacillus subtilis SHAN-1 according to claim 1 and / or a fermentation product of the Bacillus subtilis SHAN-1 according to claim 1.

3. The bacterial agent according to claim 2, characterized in that The fermentation product of Bacillus subtilis SHAN-1 contains protease.

4. The bacterial agent according to claim 3, characterized in that The fermentation product of Bacillus subtilis SHAN-1 also contains auxin.

5. The bacterial agent according to claim 2, characterized in that The fermentation product of Bacillus subtilis SHAN-1 is obtained by fermenting peanut bran with Bacillus subtilis SHAN-1.

6. The bacterial agent according to claim 5, characterized in that The fermentation product is obtained by fermenting peanut bran with Bacillus subtilis SHAN-1 and Saccharomyces cerevisiae.

7. The method for preparing the fermentation product of Bacillus subtilis SHAN-1 according to claim 1, characterized in that: The following steps are involved: The above-mentioned Bacillus subtilis SHAN-1 was inoculated into the fermentation substrate for fermentation.

8. The method according to claim 7, characterized in that The fermentation substrate includes a nitrogen source, a carbon source and a metal ion, wherein the nitrogen source includes at least one of skimmed milk powder and ammonium sulfate, the carbon source includes at least one of glucose and maltose, and the metal ion includes Mg 2+ 、Zn 2+ and Ca 2+ At least one of .

9. The method according to claim 7, characterized in that: When the fermentation product contains growth hormone, the fermentation substrate contains L-tryptophan.

10. Application, characterized in that: The application is any one of the following A1) to A14): A1) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in the preparation of protease; A2) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in the preparation of auxin; A3) Use of the Bacillus subtilis SHAN-1 according to claim 1 in preparing a product for promoting plant growth; A4) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in promoting plant growth; A5) Use of the Bacillus subtilis SHAN-1 according to claim 1 in preparing a product for promoting seed germination; A6) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in promoting seed germination; A7) Use of the Bacillus subtilis SHAN-1 according to claim 1 in the preparation of antioxidant products; A8) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in anti-oxidation; A9) Use of the Bacillus subtilis SHAN-1 according to claim 1 in preparing a product for increasing the sugar content of plant fruits; A10) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in increasing the sugar content of plant fruits; A11) Use of the Bacillus subtilis SHAN-1 according to claim 1 in preparing a product for reducing the acid content of plant fruits; A12) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in reducing the acid content of plant fruits; A13) Use of the Bacillus subtilis SHAN-1 according to claim 1 in preparing a product for reducing the acid content of plant fruits; A14) Use of the Bacillus subtilis SHAN-1 according to claim 1 or the bacterial agent according to any one of claims 2 to 6 in reducing the acid content of plant fruits.

Images