Monoclonal antibody of canine coronavirus N protein, immune colloidal gold test strip and preparation method of immune colloidal gold test strip

Abstract

The invention discloses a monoclonal antibody of canine coronavirus N protein, an immune colloidal gold test strip and a preparation method of the immune colloidal gold test strip, and belongs to the technical field of biological detection. The invention provides a hybridoma cell strain, the hybridoma cell strain is named as 4A8, the preservation number of the 4A8 is CCTCC (China Center For Type Culture Collection) NO: C2024304, and the monoclonal antibody 4A8 is secreted by the hybridoma cell strain. The invention also discloses an application of the hybridoma cell strain or the monoclonal antibody 4A8 in preparation of a detection reagent or a detection kit for canine coronavirus. Besides, the invention further discloses an immune colloidal gold test strip for detecting the canine coronavirus N protein and a preparation method of the immune colloidal gold test strip, and in 47 detected clinical samples, the total coincidence rate of the colloidal gold test strip is 89.36%. The CCoV colloidal gold test strip detection method established by the invention is convenient and good in sensitivity, and has important significance on diagnosis, prevention and control of canine coronavirus diseases.

Description

Technical Field

[0001] The invention relates to the technical field of biological detection, in particular to a monoclonal antibody of canine coronavirus N protein, an immune colloidal gold test strip and a preparation method thereof. Background Art

[0002] Canine coronavirus (CCoV) disease is an acute intestinal infectious disease caused by canine coronavirus. It is widely distributed around the world, and the genotype prevalent in China is mainly CCoV-IIa. At present, the number of pets raised in my country is increasing year by year, and CCoV is often mixed with canine parvovirus (CPV), canine rotavirus (CRV), canine distemper virus (CDV), etc., which makes diagnosis difficult and easily causes large-scale spread. Therefore, it is of great public health significance to establish a rapid diagnosis method for canine coronavirus disease. At present, there are several methods available for the detection of CCoV. Elia et al. established an ELISA test method using the recombinant M protein (rMP) of type II CCoV. However, this method is time-consuming and labor-intensive and is not suitable for rapid and on-site detection. Decaro et al. developed an RT-qPCR test method targeting the M gene for the detection and quantification of CCoV RNA in dog feces. This method is highly sensitive, but usually requires specific primers, skilled technicians, and specific equipment.

[0003] Therefore, it is of great significance to develop a rapid and sensitive detection technology. The technologies currently used to detect CCoV in China are usually RT-qPCR, colloidal gold immunochromatography technology and RT-PCR. Among them, there is little research and development on colloidal gold test strips for canine coronavirus, and the test strips are expensive and costly. Therefore, it is of great significance to reduce the detection cost, realize the localization of technology, and establish a rapid detection method. Summary of the invention

[0004] The purpose of the present invention is to provide a monoclonal antibody and an immune colloidal gold test strip for canine coronavirus N protein and a preparation method thereof, so as to solve the problems existing in the above-mentioned prior art. The sensitivity of the test strip prepared by the present invention is better than that of the commercial test strip.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] Technical solution 1: A hybridoma cell line, the hybridoma cell line is named 4A8 (Hybridoma cellline 4A8), the preservation number of 4A8 is CCTCC NO: C2024304, the preservation date is October 18, 2024, and it is preserved in the China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China.

[0007] Technical solution 2: A monoclonal antibody 4A8 secreted by the hybridoma cell line.

[0008] Furthermore, the heavy chain subtype of the monoclonal antibody 4A8 is IgG2a, and the light chain subtype is κ chain.

[0009] Technical Solution 3: The method for preparing the monoclonal antibody 4A8 is produced by secretion of the hybridoma cell line 4A8.

[0010] Technical Solution 4: An application of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a detection reagent or a detection kit for canine coronavirus.

[0011] Technical Solution 5: An application of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a drug for preventing and treating diseases caused by infection with canine coronavirus.

[0012] Technical Solution 6: An application of the hybridoma cell line or the monoclonal antibody 4A8 in the preparation of a canine coronavirus vaccine.

[0013] Technical Solution 7: An immune colloidal gold test strip for detecting canine coronavirus N protein, wherein the immune colloidal gold test strip uses the monoclonal antibody 4A8 described in claim 2 or 3 as a gold-labeled antibody.

[0014] Technical Solution 8: The preparation method of the immune colloidal gold test strip comprises the step of spraying monoclonal antibody 4B6 on the NC membrane as a detection line, wherein the monoclonal antibody 4B6 is secreted by the 4B6 hybridoma cell line, and the 4B6 hybridoma cell line (Hybridoma cell line 4B6) has a preservation number of CCTCCNO: C2024305, a preservation date of October 18, 2024, and is preserved in the China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China; the heavy chain subtype of the monoclonal antibody 4B6 is IgG1, and the light chain subtype is κ chain.

[0015] Furthermore, the preparation method further comprises the step of diluting goat anti-mouse IgG with a streak diluent and spraying it on the NC membrane below the detection line at 1.0 mL / cm as a quality control line.

[0016] The present invention discloses the following technical effects:

[0017] The present invention immunizes mice with prokaryotically expressed and purified CCoV-N protein, and further screens out specific anti-CCoV-N monoclonal antibodies. Through paired screening, 4A8 was selected as the gold-labeled antibody, and 4B6 was selected as the interception antibody, and a CCoV colloidal gold test strip detection method was established. The method is convenient, sensitive, and has a high compliance rate. It can be used for rapid detection of clinical CCoV infection, in order to provide a basis for early diagnosis of CCoV infection. The colloidal gold test strip developed by the present invention is easy to operate, and can save time and cost at the same time, because they do not require skilled technicians or special equipment, and the results can be directly determined within 15 minutes. Compared with the PCR method, the colloidal gold test strip is simple and quick to operate, and the results are visible to the naked eye. It can be used in animal hospitals, large-scale dog farms, small outpatient institutions, remote areas, etc., to achieve rapid detection in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1 It is the amplification of CCoV-N gene, where M: DL 2000Marker; 1: CCoV-N gene amplification product;

[0020] Figure 2 For the identification of pET-30a-CCoV-N recombinant plasmid, A: M: DL2000Marker; 1-5: positive clone PCR identification; 6: negative control; B: M: DL10000Marker; 1: pET-30a-CCoV-N recombinant plasmid double enzyme digestion identification;

[0021] Figure 3 For the expression of recombinant N protein, A: M: protein marker; 1: pET-30a empty vector induced by IPTG; 2: pET-30a-CCoV-N transformed bacteria not induced by IPTG; 3: pET-30a-CCoV-N transformed bacteria induced by IPTG; B: M: protein marker; 1: pET-30a empty vector induced by IPTG; 2: supernatant of pET-30a-CCoV-N transformed bacteria induced by IPTG; 3: precipitate of pET-30a-CCoV-N transformed bacteria induced by IPTG; 4: pET-30a-CCoV-N transformed bacteria induced by IPTG;

[0022] Figure 4To optimize the induction temperature for recombinant N protein expression, M: protein marker; 1: supernatant of pET-30a-CCoV-N transformed bacteria without IPTG induction; 2-6: supernatant of pET-30a-CCoV-N transformed bacteria with induction temperatures of 16°C, 37°C, 20°C, 24°C, and 30°C, respectively;

[0023] Figure 5 To optimize the induction time of recombinant N protein expression, M: protein marker; 1-5: supernatant of pET-30a-CCoV-N transformed bacteria with induction time of 2h, 4h, 6h, 8h, and 10h, respectively; 6: supernatant of pET-30a-CCoV-N transformed bacteria without IPTG induction;

[0024] Figure 6 This is the optimization of recombinant N protein expression induced by different concentrations of IPTG, where M: protein marker; 1: supernatant of pET-30a-CCoV-N transformed bacteria without IPTG induction; 2-6: supernatant of pET-30a-CCoV-N transformed bacteria with IPTG induction concentrations of 0.2 mmol / mL, 0.6 mmol / mL, 1 mmol / mL, 1.5 mmol / mL, and 2 mmol / mL, respectively;

[0025] Figure 7 This is the purification analysis of CCoV-N recombinant protein, where M: protein marker; 1: supernatant of pET30a-CCoV-N transformed bacteria with large-scale expression; 2: flow-through; 3: washing solution; 4: purified protein eluted with 100% Elution Buffer; 5: purified protein eluted with 80% Elution Buffer; 6: purified protein eluted with 60% Elution Buffer; 7: purified protein eluted with 40% Elution Buffer;

[0026] Figure 8 This is the antigen specificity analysis of CCoV-N recombinant protein, where M: protein marker; 1: pET-30a empty vector; 2: purified CCoV-N recombinant protein;

[0027] Fig. 9 is the antibody titer of immunized mouse serum;

[0028] Fig.10 The morphology of fusion hybridoma cells, A: 3d; B: 6d; C: 10d; D: after subcloning;

[0029] Fig.11For identification of chromosome number of hybridoma cells, A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6;

[0030] Fig.12 is the titer of hybridoma cell supernatant;

[0031] Fig.13 is the ascites titer of the mAb;

[0032] Fig.14 IFA identification of monoclonal antibodies, including A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6; G: MOCKA: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6; G: MOCK;

[0033] Fig.15 For WB identification of monoclonal antibodies, A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6;

[0034] Fig.16 For the purification analysis of ascites, M: protein Marker; 1: 3D10; 2: 4A8; 3: 6D9; 4: 5B7; 5: 7E2; 6: 5A6M: protein Marker; A: 3D10; B: 4A8; C: 6D9; D: 5B7; E: 7E2; F: 5A6;

[0035] Fig.17 For the quality identification of colloidal gold solution; wherein, A: naked eye observation of colloidal gold solution; B: ultraviolet absorption spectrum of colloidal gold solution;

[0036] Fig.18 Selection of the best antibody pair for colloidal gold;

[0037] Fig.19 For the selection of the best NC membrane;

[0038] Fig. 20 Determination of the optimal addition volume for gold-labeled conjugates;

[0039] Fig.21 The optimal concentration for intercepting antibodies;

[0040] Fig. 22 The optimal concentration of quality control antibody;

[0041] Fig.23 To determine the optimal reaction time;

[0042] Fig.24 For sensitivity testing;

[0043] Fig.25 For specific detection;

[0044] Fig.26 To test the stability of colloidal gold test strips;

[0045] Fig. 27 These are the RT-PCR test results of 47 clinical samples;

[0046] Fig.28 Comparison of the test results of the test strip developed by the present invention and the commercial test strip; wherein, A: the test strip developed by the present invention; B: the commercial test strip;

[0047] Fig.29 The results of 4H2 and 4B6 reacting with CCoV infected cells under an inverted fluorescence microscope;

[0048] Fig.30 It is a specific protein band for 4H2 and 4B6 to identify viruses, with a molecular weight of 70 kDa;

[0049] Fig.31 The morphology of 4H2 (A) and 4B6 (B) positive hybridoma cells;

[0050] Fig.32 is the chromosome number of 4H2 (A) and 4B6 (B);

[0051] Fig.33 These are the identification results of 4H2(1) and 4B6(2). DETAILED DESCRIPTION

[0052] CCoV isolates and pET-30a prokaryotic expression vectors were provided by Wuhan Keqian Biological Co., Ltd., which promised to distribute them to the public within 20 years from the date of application. RNA extraction kits were purchased from Wuhan Keqian Biological Co., Ltd.; BeyoECLStar (ultra-sensitive ECL chemiluminescence kit) was purchased from Shanghai Biyuntian Biological Co., Ltd.; Page gel rapid preparation kit was purchased from Shanghai Yazyme Biological Co., Ltd.; DNA gel recovery kit was purchased from Magen; small-scale plasmid extraction kit was purchased from Omega. Other experimental materials, unless otherwise specified, can be obtained through conventional purchase.

[0053] Example 1

[0054] 1 Construction and identification of recombinant plasmid pET-30a-CCoV-N

[0055] 1.1N gene amplification

[0056] The N gene sequence of the laboratory CCoV isolate and the sequence of the prokaryotic expression vector pET-30a were optimized and analyzed, and primer sequences with vector homology arms were designed and sent to Qingke Biotechnology for gene synthesis.

[0057] Table 1 Primers for amplification and identification of CCoV-N

[0058] Primer name Primer sequences pET-30a-CCoV-F GAAGGAGATATACATATGATGGCCAACCAGGGAC(SEQ ID NO.1) pET-30a-CCoV-R ATTGATGAGGTAACGAACCTCGAGCACCACCACCACCACCA(SEQ ID NO.2)

[0059] The N gene was amplified using the cDNA of the CCoV-N gene as a template.

[0060] 1.2 Rubber recycling

[0061] The PCR product was identified by agarose gel electrophoresis, the target band of CCoV-N was cut, and the PCR product was recovered according to the instructions of the DNA gel recovery kit.

[0062] 1.3 Connection of CCoV-N gene to pET-30a linearized vector

[0063] Prepare the following 20μl reaction system on ice: CCoV-N gene 1μl (20ng), pET-30a linearized vector 1μl (100ng), 5×CE Multis Buffer 4μl, Exnase Multis 2μl, ddH2O 12μl. Then use a pipette to gently mix, and centrifuge briefly to collect the reaction solution to the bottom of the tube. React at 37℃ for 30min, then cool to 4℃ or immediately place on ice to cool.

[0064] 1.4 Transformation of recombinant products

[0065] Thaw BL21 competent cells on ice, take 10 μL of the recombinant product and add it to 100 μL of competent cells, flick the tube wall to mix, and place on ice for 30 minutes. Heat shock in a 42℃ water bath for 45 seconds, and immediately place on ice to cool for 2-3 minutes. Add 900 μL LB liquid culture medium (without antibiotics) and shake at 37℃ and 200-250 r / min for 1 hour. + Preheat the LB solid medium plate in a 37℃ incubator, take out the bacterial solution after shaking, centrifuge at 5000r / min for 5min, and discard 900μL of supernatant. Resuspend the bacteria with the remaining medium and spread it with a sterile coating stick on a plate containing K + Gently spread the plate evenly and culture upside down in a 37°C incubator for 12-16 hours.

[0066] 1.5 Identification of bacterial culture by PCR

[0067] Take the bacterial bottle, mark it, add 4mL LB liquid medium and 4μL K +(final concentration 50 μg / mL), mix well, pick five single colonies, and culture at 37°C, 200r / min overnight. Take the cultured bacterial solution and use the identification primers of CCoV-N for colony PCR identification.

[0068] 1.6 Extraction and identification of recombinant plasmid pET-30a-CCoV-N

[0069] The positive bacterial solution in the bacterial solution PCR was picked for expansion culture. The recombinant plasmid in Escherichia coli DH5α was extracted according to the instructions of the small-scale extraction plasmid kit and the plasmid concentration was determined. The positive recombinant plasmid was named pET-30a-CCoV-N. 10 ng of recombinant plasmid pET-30a-CCoV-N was used to double-digest the plasmid using NdeI enzyme and XhoI enzyme. The identification result should be that the size of the CCoV-N gene is about 1149 bp, and the size of the pET-30a linearized vector is about 5238 bp. In addition, 5 μL of the recombinant plasmid was sent to Wuhan Qingke Biological Company for sequencing.

[0070] 1.6.1 Small-scale expression and optimization of CCoV-N

[0071] 1.6.2 Small-scale expression of pET-30a-CCoV-N

[0072] The correctly sequenced recombinant plasmid pET-30a-CCoV-N was transformed into BL21 competent cells according to the transformation method, and the transformation bacterial solution was coated with K + Gently spread it evenly on the plate, culture it in a 37℃ incubator for 12h, pick a single colony and inoculate it in K + LB liquid medium, 37℃180r / min overnight culture. After overnight culture, dilute the overnight bacteria at 1:100 and transfer to K-containing + (50 ng / mL) in liquid LB at 37°C and 180 rpm until OD 600nm=0.6-0.8. Then take out 1mL of bacterial solution as the uninduced control, add the inducer IPTG to the remaining culture solution to a final concentration of 1mmol / mL, and continue to culture at 37℃ for 3-5h. Pour the induced bacterial solution and the uninduced bacterial solution into a centrifuge tube, centrifuge at 12000r / min for 1min, discard the supernatant, centrifuge instantly, use a pipette to suck up the LB, collect the bacterial solution at 4℃, resuspend with 1×PBS after collecting the bacteria, wash away the excess culture medium: add PBS and resuspend according to 1:10 (PBS: bacterial solution). Then ultrasonically disrupt (650W, disrupt for 5s, stop for 5s, amplitude 30%, a total of 6min), after disruption, centrifuge at 4℃, 12000r / min for 10min, collect the supernatant into another tube, and resuspend the precipitate with the same volume of PBS. Then, SDS-PAGE electrophoresis was used to detect the expression and solubility of the target protein. Protein gel was prepared according to the gel preparation instructions, and SDS-PAGE electrophoresis was used to detect the content of the target protein in the supernatant and precipitate.

[0073] 1.6.3 Optimizing induction temperature

[0074] Take 5 bacterial bottles and mark them, add 20mL LB medium, add 200μL of recombinant plasmid transformed bacterial solution to each bottle at a ratio of 1:100, culture at 37℃, 200r / min until OD600nm=0.6, take out and add IPTG with a final concentration of 1mmol / mol, and induce at 16℃, 20℃, 24℃, 30℃, and 37℃ for 6h.

[0075] 1.6.4 Optimizing induction time

[0076] Take 5 bacterial bottles and mark them, add 20mL LB medium, add 200μL of recombinant plasmid transformed bacterial solution to each bottle at a ratio of 1:100, and culture at 37℃, 200r / min until OD 600 nm=0.6, IPTG with a final concentration of 1 mmol / mol was added, and the mixture was induced at 37°C for 2h, 4h, 6h, 8h, and 10h respectively.

[0077] 1.6.5 Optimizing IPTG induction concentration

[0078] Take 5 bacterial bottles and mark them, add 20mL LB medium, add 200μL of recombinant plasmid transformed bacterial solution to each bottle at a ratio of 1:100, and culture at 37℃, 200r / min until OD 600 nm=0.6, IPTG was added with final concentrations of 0.2mmol / mL, 0.6mmol / mL, 1mmol / mL, 1.5mmol / mL, and 2mmol / mL, respectively, and induced at 37°C for 6h.

[0079] 1.7 Large-scale expression, purification and WB identification of CCoV-N

[0080] 1.7.1 Large-scale expression of recombinant N protein

[0081] Same as 1.6.2.

[0082] 1.7.2 Purification of recombinant N protein

[0083] Take the recombinant N protein expression supernatant and filter it with a 0.45 μm filter. Prepare 5 mL of NiNTA high-speed chromatography medium (6FF) pre-packed column to purify the protein and operate according to the instructions.

[0084] 1.7.3 Identify the recombinant N protein by Western blot.

[0085] 1.7.4 Animal immunization

[0086] Purified CCoV-N protein was used as the immunization antigen, and Freund's complete adjuvant and Freund's incomplete adjuvant were used as adjuvants. Three healthy female BALB / c mice aged 6 weeks were taken, and the immunization dose was 100 μg / mouse. For the first immunization, the corresponding dose of purified CCoV-N protein was mixed with an equal amount of Freund's complete adjuvant. After emulsification, the mice were injected into the subcutaneous muscles of the back at multiple points. After that, the mice were immunized every 14 days, and the CCoV-N protein was mixed with an equal amount of Freund's incomplete adjuvant. After emulsification, the mice were immunized twice and three times by the first immunization method. 3 days after the third immunization, the immunized mice were blooded by tail cutting, and the CCoV-N protein was used for antigen coating. The indirect ELISA method was used to determine the serum titer of the immunized mice, and blank mice were set as negative controls. Mice with high mouse serum titers were selected for booster immunization, and the intraperitoneal impact immunization method was used without adjuvant, 50 μg / mouse, and cell fusion was performed 3 days after impact immunization. The specific immunization procedure is shown in Table 2.

[0087] Table 2 Mouse immunization program

[0088] Immunization times Immunization dose Adjuvant Immunization time Immune pathway First Free 100 Freund's complete adjuvant 0 Subcutaneous injection in back Second exemption 100 Freund's incomplete adjuvant 14 Subcutaneous injection in back Three exemptions 100 Freund's incomplete adjuvant 28 Subcutaneous injection in back Strengthen immunity 50 - 36 Intraperitoneal injection

[0089] 1.7.5 Indirect ELISA to detect serum titer after mouse immunization

[0090] 1.7.5.1 Establishment of indirect ELISA detection method

[0091] The indirect ELISA method was used to detect positive hybridoma cells for screening. The indirect ELISA method was established. The specific steps are as follows:

[0092] 1) Use purified CCoV-N protein as antigen to coat the ELISA plate. Take 2 96-well ELISA plates and set different concentrations of antigen coating in columns 1-7. The initial protein concentration is 4 mg / mL. Perform gradient dilutions of 1:2, 1:4, 1:8, 1:16, 1:32, and 1:64 in sequence. Add them to columns 1-7 for coating, 100 μl per well, and coat overnight at 4°C.

[0093] 2) Discard the coating solution in the ELISA plate, wash with PBST three times, 200 μl / well, pat dry on absorbent paper, and block with blocking solution, 200 μl / well, at 37°C for 2 h;

[0094] 3) Discard the blocking solution in the ELISA plate, wash with PBST three times, 200 μl / well, pat dry on absorbent paper, add 1:50, 1:100, 1:200, 1:400, 1:800, 1:1600 times diluted positive serum to rows 1-6 of the first plate, 100 μl / well; add 1:50, 1:100, 1:200, 1:400, 1:800, 1:1600 times diluted negative serum to rows 1-6 of the first plate, 100 μl / well, and incubate at 37°C for 1 hour;

[0095] 4) Discard the primary antibody in the ELISA plate, wash with PBST three times, 200 μl / well, pat dry on absorbent paper, add 1:7000 diluted HRP-labeled IgG enzyme-labeled goat anti-mouse secondary antibody to each well, 100 μl / well, and incubate at 37°C for 1 hour;

[0096] 5) Discard the secondary antibody in the ELISA plate, wash with PBST 3 times, 200 μl / well, pat dry on absorbent paper, add 100 μl TMB system colorimetric solution, color for 15 minutes in the dark, add 50 μl stop solution to each well to terminate the reaction, and read the OD on the ELISA reader 630 The absorbance value of nm was measured, and the optimal antigen coating concentration and the optimal serum dilution ratio were selected according to the analysis data displayed by the microplate reader.

[0097] 1.7.5.2 ELISA titer of serum after mouse immunization

[0098] 7 days after the third immunization, blood was collected from the immunized mice by tail cutting and antigen coating with CCoV-N protein, and the serum titer of the immunized mice was determined by indirect ELISA method.

[0099] 1.8 Preparation, screening and subcloning of positive hybridoma cells

[0100] 1.8.1 Recovery and culture of SP2 / 0 myeloma cells

[0101] Choose to revive SP2 / 0 cells two weeks before fusion, put the RPMI-1640 medium containing 20% ​​FBS in a 37℃ water bath for water bath heating; quickly take out the SP2 / 0 cells from liquid nitrogen, and immediately immerse the cryopreservation tube in a 37℃ water bath, gently shake it, and thaw the cells quickly. After the cells are completely thawed, place the cryopreservation tube in a horizontal centrifuge, centrifuge at 1000r / min for 5min, then take it out, and discard the supernatant in the clean bench; resuspend the cells in the RPMI-1640 medium containing 20% ​​FBS prepared in advance, and add it to the T25 cell culture bottle, and make the volume to 5mL with RPMI-1640 medium containing 20% ​​FBS, gently shake the bottle to mix the cells, and then place it in a 5% CO2, 37℃ constant temperature incubator for 12h, then change the medium, add fresh medium, observe the cell state, and wait until the cell state is good and covers 80% of the bottom of the culture bottle, then you can perform the subculture operation.

[0102] 1.8.2 Preparation of feeder cells

[0103] One day before fusion, take a normal BALB / c mouse, take blood from the eyeball and then kill it. After the whole blood of the mouse is left to stand at room temperature for 2 hours, centrifuge it at 4000r / min for 10 minutes, take the supernatant and inactivate the serum at 56℃ for 30 minutes, and then store it at 4℃. Immediately soak the killed mouse in 75% alcohol for disinfection for 30 seconds. Fix the mouse's limbs, expose the abdomen, tear open the abdominal skin, and expose the abdominal cavity. Rinse the mouse's abdominal cavity repeatedly with blank RPMI-1640 culture medium to obtain macrophages. Centrifuge the cell-culture medium mixture at 1200r / min for 5 minutes. Discard the supernatant, resuspend with 50mL HAT complete culture medium, gently blow and mix, and plate in a 96-well plate at 100μl / well. Culture in a 37℃, 5% CO2 incubator for use.

[0104] 1.8.3 Cell fusion

[0105] Preparation of spleen cells from immune mice: Take the boosted immunized mice, take blood from the eyeballs and kill them, and collect positive serum as a positive control. Soak the mice in 75% alcohol for 30 seconds, then take them out, lie on their left side, take out the spleen of the mice, gently remove the fat tissue around the spleen, and place them in a cell sieve. Separate spleen cells by pressure perfusion, centrifuge the spleen cell suspension, and centrifuge at 1200r / min for 10min. Discard the supernatant and resuspend with blank RPMI-1640 medium. Count the cells; collect SP2 / 0 cells, wash them once with blank RPMI-1640 medium, and count the cells. Cell fusion: Mix spleen cells and SP2 / 0 cells in a 50mL centrifuge tube at a ratio of 5:1, and centrifuge at 1200r / min for 10min. Discard the supernatant and tap the bottom of the centrifuge tube to evenly disperse the cells. In a 37℃ water bath, slowly add 1mL PEG4000 within 1min and shake the centrifuge tube gently, and let it stand for 45s. In the first second, slowly add 1 mL of blank RPMI-1640 medium to the centrifuge tube, shaking the centrifuge tube while adding; in the second second, slowly add 2 mL of blank RPMI-1640 medium to the centrifuge tube, shaking the centrifuge tube while adding; in the third second, slowly add 3 mL of blank RPMI-1640 medium to the centrifuge tube, shaking the centrifuge tube while adding, and finally fill the medium to 50 mL. Centrifuge at 1200 r / min for 10 minutes, discard the supernatant, and add 50 mL of HAT complete medium. Take out the cell plate with feeder cells laid the day before, and use a spray gun to evenly add the fused cells to each cell well. Culture in a 37°C, 5% CO2 incubator.

[0106] 1.8.4 Screening and subcloning of positive hybridoma cells

[0107] After fusion, the cells were observed every day, and half of the medium was replaced on the third day, that is, part of the medium in each cell well was aspirated and supplemented with new HAT complete medium. When the cell colonies grew to an appropriate size, the cell supernatant was taken for indirect ELISA detection, and the positive hybridoma cells were subcloned and screened again until the cells were confirmed to be of monoclonal origin.

[0108] 1.8.5 Cryopreservation and thawing of positive hybridoma cells

[0109] Cryopreservation of positive hybridoma cells: Expand the positive monoclonal hybridoma cells and transfer the cells in the 96-well plate to a 24-well plate for culture. When the cells grow to about 80%, transfer the cells to a 6-well plate for continued culture. When the cells grow to 80% again, transfer the cells to a cell bottle for expanded culture. When the cells grow to 70-80% in the cell bottle, gently blow the cells off, centrifuge at 1200r / min for 5 minutes, discard the supernatant, add 1mL of cell freezing solution, mix by blowing, and transfer to a cell cryopreservation tube. Freeze the cell cryopreservation tube in a -80℃ refrigerator within 15 minutes, and transfer to a liquid nitrogen tank for long-term storage within 24-48 hours. Resuscitate the cells regularly and check the cell activity and ability to secrete antibodies.

[0110] Recovery of positive hybridoma cells: Take out the hybridoma cells frozen in liquid nitrogen, shake them quickly in a 37°C water bath until the freezing solution is completely melted, centrifuge at 1000r / min for 5min, discard the freezing solution, resuspend the cell pellet completely with RPMI-1640 complete medium, transfer to the cell plate, and culture in a 37°C, 5% CO2 cell culture incubator. After 24h, when most of the cells are attached to the wall, change the medium, and observe the growth status of the revived cells every day.

[0111] 1.9 Identification of hybridoma cells

[0112] 1.9.1 Identification of chromosome number of hybridoma cells

[0113] The colchicine method was used for cytology examination.

[0114] 1.9.2 Identification of monoclonal antibody subtypes

[0115] According to the instructions of the mouse monoclonal antibody Ig subclass identification, use the enzyme-labeled secondary antibody ready-to-use kit.

[0116] 1.9.3 Hybridoma cell supernatant titer determination

[0117] The indirect ELISA method was used to detect the antibody titer in mouse ascites, and SP2 / 0 myeloma cell supernatant was used as a negative control to detect the titer of hybridoma cell supernatant.

[0118] 1.9.4 Preparation of hybridoma cell ascites and titer determination

[0119] 1) 7 days before intraperitoneal injection of hybridoma cells, select 8-week-old BALB / c mice in good condition and inject 0.5 mL of Freund's incomplete adjuvant into the peritoneal cavity of each mouse;

[0120] 2) Gently blow up the hybridoma cells in good condition, centrifuge at 1000r / min for 3min, discard the supernatant, resuspend the cell pellet with RPMI-1640 basal solution and adjust the cell number to 1×10 6SP2 / 0 cells were used as negative control, and 0.5 mL was injected into each mouse intraperitoneally, i.e., 0.5×10 6 Piece / piece;

[0121] 3) 10-14 days after inoculation, observe the abdominal cavity of the mice every day, and collect ascites when the abdomen is obviously swollen;

[0122] 4) Centrifuge the collected ascites at 4°C, 1500 rpm for 10 min, and collect the supernatant;

[0123] 5) After overnight storage at 4°C, centrifuge at 12,000 rpm for 5 min at 4°C, remove the lower layer of liquid, discard the fat, and store at -20°C for later use;

[0124] 6) The antibody titer in mouse ascites was detected by indirect ELISA method.

[0125] 1.10 Purification and identification of monoclonal antibodies

[0126] 1.10.1 Ascites purification

[0127] 1) Dilution of ascites: prepare a 50mL centrifuge tube, add 10mL of 1× equilibrium buffer and 12mL of 2× equilibrium buffer to the centrifuge tube, take a monoclonal antibody ascites (about 2mL), transfer it to the above centrifuge tube after thawing, mix well, and filter with a 0.45μm filter;

[0128] 2) Pretreatment of purification column: Place the purification column vertically (filler at the bottom). Remove the black stopcock at the top, take the assembled water inlet pipe, insert it into the upper port of the purification column, tighten it, connect the peristaltic pump, and adjust the flow rate. First wash 10 column volumes with ddH2O at a flow rate of 1.0-2.0, then wash 10 column volumes with PBS at a flow rate of 1.0-1.5, and then wash 10 column volumes with 1× equilibrium buffer;

[0129] 3) Overnight loading: Place the diluted and filtered ascites in an ice box, insert the inlet tube, flow rate 0.1-0.4, connect the outlet tube to a 50mL centrifuge tube, and collect the flow-through. After passing through the column, pour the flow-through back into the ascites centrifuge tube, repeat the loading, and repeat twice;

[0130] 4) Re-balance and wash the purification column: First, wash with 1× equilibration buffer for 10 column volumes at a rate of 1.5; then wash with impurity removal buffer for 10 column volumes at a rate of 1.5;

[0131] 5) Elution: First, clean the purifier, do not connect the purification column, put the water inlet pipes of the left and right AB pumps in 1× equilibrium buffer, and then use a 10mL syringe to draw out about 10mL of liquid at the lower port of the AB pump respectively; machine operation steps: click software → openmethod → ​​wq folder → wash. Equilibrium + elution: connect the purification column, insert the water inlet pipe of pump A into 1× equilibrium buffer, insert the water inlet pipe of pump B into the eluent, then prepare 40 2mL EP tubes, add pre-cooled Tris-HCl (pH9.0), 200μL / tube, and then place them on the tube rack.

[0132] 6) Cleaning the purifier and purification column: After elution, wash with PBS for 10 column volumes, equilibrate the purification column with 1× equilibration buffer for 10 column volumes using a pump at a speed of 1.5, and then equilibrate the purification column with PBS using a pump again for 10 minutes at a speed of 1.5;

[0133] 7) The purity of the purified ascites was determined using SDS-PAGE.

[0134] 1.10.2 Ultrafiltration concentration of monoclonal antibodies

[0135] Precool the centrifuge to 4°C and set it to 4500r / min for 60min, with both the speed increase and speed decrease being 8. After balancing the ultrafiltration tube, place it symmetrically in the centrifuge and start centrifugation. Observe it every once in a while to prevent all the liquid from being centrifuged out. When there is only 1.5mL of liquid left in the ultrafiltration tube, stop centrifugation and use a protein concentration meter to detect whether the inner tube contains monoclonal antibodies. Then add precooled PBS (0.22μm filter) to the ultrafiltration tube to 15mL, balance it and centrifuge it again. A total of PBS replacement is required 3 times. The last time, ensure that the liquid in the ultrafiltration tube is 1-1.5mL. Use a 200μL pipette to absorb the liquid in the ultrafiltration tube, then repeatedly and gently rinse the ultrafiltration membrane (10-20 times), and then aspirate the liquid in the ultrafiltration tube into a 2mL EP tube.

[0136] 1.10.3 Indirect immunofluorescence assay (IFA) of monoclonal antibodies

[0137] 1) F81 cells were cultured in 10% FBSDMEM medium in T25 cell culture flasks at 37°C and 5% CO2;

[0138] 2) When the cells grow into a dense monolayer, discard the culture medium, wash twice with PBS, digest with EDTA-free trypsin, and dispense 100 μL per well of a 96-well plate until the cells grow into a dense monolayer. Discard the culture medium, inoculate 2% FBS DMEM medium diluted CCoV virus solution, 100 μL / well, and culture for about 48 hours before harvesting;

[0139] 3) Discard the culture medium of the 96-well cell plate, wash once with PBS, add methanol to fix at room temperature for 15 minutes, then discard, and air dry. Then add 100 μL of 1% TritanX-100 to each well, react at 37℃ for 15 minutes, then discard, and wash three times with PBS. Add 100 μL of 2% BSA to each well, block at 37℃ for 15 minutes, discard the blocking solution, and wash three times with PBS;

[0140] 4) Hybridoma cell supernatant was used as primary antibody, goat anti-mouse IgG AlexaFluor488 was used as secondary antibody, and 100 μL was added to each well.

[0141] 5) Observe the fluorescence under an inverted fluorescence microscope. At the same time, set up a well with cells not inoculated with virus as a negative control.

[0142] 1.10.4 Western blot identification of monoclonal antibodies

[0143] CCoV virus liquid samples were prepared, subjected to SDS-PAGE electrophoresis and then electroblotted onto PVDF membranes, monoclonal antibodies were used as primary antibodies, HRP-labeled goat anti-mouse IgG was used as secondary antibodies, and then images were taken.

[0144] 1.10.5 Preparation of colloidal gold solution

[0145] 1.10.5.1 Pretreatment of glass products

[0146] Clean and disinfect the glass instruments before use.

[0147] 1.10.5.2 Preparation of colloidal gold solution

[0148] Take 1.0g of chloroauric acid, add distilled water to 100mL, filter with a 0.22μm filter membrane, and put it into a clean glass container, refrigerate and keep away from light. Take 100mL of distilled water in a siliconized conical flask, add 1mL of 1% chloroauric acid solution to make the final solution concentration 0.01%, put it on a magnetic heating stirrer and boil for 7min, then quickly add 1.4mL of 1% trisodium citrate aqueous solution at one time under stirring, continue heating for 8min, cool to room temperature, restore to the original volume with distilled water, filter with a 0.22μm filter membrane, and put it into a clean glass bottle. The colloidal gold solution is stored at 2-8℃, and the color of the colloidal gold solution is observed with the naked eye, and the ultraviolet absorbance of the synthesized colloidal gold nanoparticles is measured at the same time.

[0149] 1.10.6 Preparation of gold-labeled conjugates

[0150] 1.10.6.1 Exploration of the optimal gold label pH and optimal labeled protein amount

[0151] A square titration test was used. 2 mL of colloidal gold solution was added to 8 15 mL centrifuge tubes and marked. 4 μL, 6 μL, 8 μL, 10 μL, 12 μL, 14 μL, 16 μL, and 18 μL of 0.2 mol / L K2CO3 solution were added to adjust the pH of the colloidal gold solution. The centrifuge tubes were placed on a rotator and rotated for 10 min before use. Take 8 1.5mL EP tubes and add 160μL ultrapure water to each of them. Pipette 160μL of antibody with a concentration of 2mg / mL and add it to the first EP tube. Mix well and dilute it 2-fold to the 8th tube. Discard the excess antibody in the 8th tube and keep 160μL. Take the serum dilution plate, mark the corresponding K2CO3 addition amount in each vertical column and the corresponding antibody concentration in each horizontal column. After marking, add 200μL of the corresponding colloidal gold solution with 0.2mol / mL K2CO3 to each well, mix gently, and let it stand at room temperature for 5min. Then add 20μL of the antibody with the corresponding concentration to each well, mix gently, and let it stand at room temperature for 5min to allow the colloidal gold particles to fully combine with the antibody. Use a spray gun to add 20μL to each well. 10% NaCl solution, gently mix, stand at room temperature for 5 minutes and observe the color change, and measure the UV absorbance of the synthesized gold-labeled antibody nanoparticles. Select the antibody input amount corresponding to the last well in the plate where the liquid does not change color as the optimal labeled antibody amount, and the pH value represented by the corresponding 0.2 mol / L K2CO3 solution addition amount is the optimal pH for labeling. According to the above steps, the optimal gold-labeled pH and the optimal labeled protein amount are determined for the 6 monoclonal antibodies screened and the 2 monoclonal antibodies in the laboratory as gold-labeled antibodies.

[0152] 1.10.6.2 Preparation of gold-labeled conjugates

[0153] First, add 2mL of gold solution to the centrifuge tube, place the centrifuge tube on the rotating instrument, rotate for 5min, and observe whether dead gold (and gold particle precipitation) appears. If there is no dead gold, add 0.2mol / mLK2CO3 solution with the optimal pH corresponding to the monoclonal antibody, rotate and mix for 5min, then add 200μL of the monoclonal antibody with the optimal concentration, rotate and mix for 5min, and stand at room temperature for 30min. After the gold-labeled solution is allowed to stand for 30min, add 0.244mL of 10% BSA to make the final concentration of BSA 1%, rotate and mix for 5min, block for 30min, centrifuge the blocked solution at 4℃ at 2000r / min for 5min, discard the precipitate, transfer the supernatant to another centrifuge tube, centrifuge at 4℃ at 9000r / min for 10min, carefully discard the supernatant, wash the precipitate once with resuspension buffer and resuspend it at 1 / 10. The obtained is the gold-labeled conjugate, which is stored in a refrigerator at 4℃ for later use.

[0154] 1.11 Assembly and preparation of test strips

[0155] 1) Pretreatment of gold label conjugate pad and sample pad: Wet the glass fiber membrane with conjugate pad treatment solution. After wetting, place in a 37°C oven to dry overnight (at least 8 hours);

[0156] 2) Preparation of coating membrane (striking): Paste the NC membrane to the PVC base plate, use a film sprayer to spray, dilute the monoclonal antibody with the streaking diluent, and spray it on the NC membrane at 1.0 mL / cm as the detection line. Dilute the goat anti-mouse IgG with the streaking diluent, and spray it on the NC membrane at 4.0 mm below the detection line at 1.0 mL / cm as the quality control line. Dry the coated NC membrane at 37°C for 3 hours and seal it for storage;

[0157] 3) Assemble the test strips, cut the sample pad, conjugate pad, NC membrane, absorbent paper, etc. into appropriate widths, and paste them on a clean PVC base plate in order, with each part overlapping by about 2 mm to ensure the flow of the sample liquid;

[0158] 4) Cutting: Take the large plate and use a strip cutter to cut it into single test paper strips with a width of 4.0 mm;

[0159] 5) Assembly: Assemble the cut test paper strips into the base groove of the plastic card, cover the upper cover of the plastic card, press it tightly, and then use a shell pressing machine to press the card to form a test paper strip for the next step of the experiment.

[0160] 1.11.1 Screening and pairing of colloidal gold antibodies

[0161] The 8 monoclonal antibodies screened by the present invention were used as gold-labeled antibodies and intercepting antibodies for cross-matching experiments, and test strips were prepared according to the optimal conditions for the gold-labeled antibodies. 4 TCID 50 / mL of CCoV virus liquid was tested and the color development of the test paper was observed to determine the candidate antibody pairing combination.

[0162] After obtaining the candidate antibody pairing combination, use 10 4 TCID 50 / mL of CCoV virus liquid, 10 3 TCID 50 / mL of CCoV virus liquid, sample processing liquid, and F81 cell supernatant were used to test the above-mentioned alternative antibody pairing combinations. According to the color development of the test strip, the pairing with high sensitivity and strong specificity was selected as the most suitable antibody pairing for subsequent experiments.

[0163] 1.11.2 Determination of the amount of gold label conjugate added

[0164] Prepare a test strip, in which the concentration of the test line coated with 5B7 antibody is 1 mg / mL, and the concentration of the quality control line coated with goat anti-mouse antibody is 2 mg / mL. Add 2, 4, 6, 8, 10, 12, and 15 μL of gold-labeled conjugate to the conjugate pad to prepare a CCoV-N test strip. Use the prepared test strip to detect the same negative sample and positive sample, repeat 3 times, and determine the optimal amount of gold-labeled conjugate according to the color development of the test strip. At the same time, use an immunoassay analyzer to detect the T-line colloidal gold signal intensity, and select the optimal amount with high sensitivity and strong specificity as the optimal amount for subsequent experiments.

[0165] 1.11.3 Determination of NC membrane

[0166] NC membranes can be divided into different specifications according to their pore size and creeping speed, which affect the sensitivity and specificity of the test strips. Purchase 4 common NC membrane models on the market, namely Pall90, Pall120, CN95, and CN140. Prepare test strips, use antibodies with the same C and T line concentrations to streak 4 NC membranes, test the same positive and negative samples, repeat 3 times, and determine the best NC membrane type based on the color development of the test strips. At the same time, use an immunoassay analyzer to detect the T line colloidal gold signal intensity, and select the NC membrane type with high sensitivity and weak nonspecificity as the best NC membrane for subsequent experiments.

[0167] 1.11.4 Determination of the optimal amount of antibody coated on the test line

[0168] Prepare test strips, fix the concentration of goat anti-mouse antibody coated on the quality control line at 2 mg / mL, dilute the antibody to 1, 1.5, 2, 2.5, 3, and 4 mg / mL to streak the NC membrane, assemble the test strips, and use test strips with different test line (T line) coating concentrations to detect the same positive sample, repeat 3 times, and determine the optimal T line coating concentration based on the color development of the test strips. At the same time, use an immunoassay analyzer to detect the T line colloidal gold signal intensity. The minimum antibody coating concentration required for the T line signal to be stable is the optimal test line coating antibody amount, which is used for subsequent experiments.

[0169] 1.11.5 Determination of the optimal amount of coating antibody for quality control line

[0170] Prepare test strips, fix the concentration of the test line coating antibody at 2 mg / mL, dilute the antibody to 0.5, 1, 1.5, 2, 2.5, and 3 mg / mL to streak the NC membrane, assemble the test strips, and use the test strips with different quality control line (C line) coating concentrations to detect the same positive sample, repeat 3 times, and determine the optimal coating concentration of the C line according to the color development of the test strips. At the same time, use an immunoassay analyzer to detect the intensity of the C line colloidal gold signal. The minimum goat anti-mouse antibody coating concentration required for the C line signal to be stable and the optimal quality control line coating antibody amount are used for subsequent experiments.

[0171] 1.11.6 Optimization of reaction time

[0172] Prepare test strips, the antibody concentrations at the test line and the quality control line are the optimal amount of coated antibodies, and the amount of gold-labeled conjugate added is the optimal added volume. Use the prepared test strips to detect the same positive sample, and use an immunoassay analyzer to detect the aggregated colloidal gold signals at the test line and the quality control line at 3min, 6min, 9min, 12min, 15min, 20min, and 25min after spotting, respectively, and repeat 3 times. The shortest time required for the test line and quality control line signals to stabilize is taken as the optimal reaction time.

[0173] 1.12 Colloidal gold test strip quality inspection

[0174] 1.12.1 Determination of test strip sensitivity

[0175] The test strips were prepared using the optimal conditions of the above experiment, and the same batch of test strips were used to detect the virus content of 10 5 TCID 50 / mL of CCoV standard, and used the sample treatment solution to dilute the virus solution 10 times to obtain 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL of samples, test the samples separately, observe the color development results, and determine the minimum detection limit of the samples.

[0176] 1.12.2 Test strip specificity detection

[0177] The test strips were prepared using the optimal conditions of the above experiment, and the same batch of test strips were used to detect common canine viruses CCoV, CPV, CDV, CPIV, F81 cell supernatant and negative samples, and the color development results were observed to detect the specificity of the test strips.

[0178] 1.12.3 Test strip stability test

[0179] Prepare test strips and store them at 37°C. Use the prepared test strips to test the same positive sample at 0d, 10d, 20d, and 30d, repeat 3 times, observe the color development of the test strips, and use an immunoassay analyzer to detect the T-line colloidal gold signal intensity to analyze the stability of the test strips.

[0180] 1.12.4 Testing of clinical samples

[0181] The developed test strips were used to test 47 dog fecal swabs, and the sample test results were recorded and compared with the RT-PCR test results to calculate the compliance rate.

[0182] 1.12.5 Comparison with commercial test strips

[0183] The virus content used is 10 5 TCID 50 / mL of CCoV positive and negative samples, and the CCoV standard was diluted 10 times with the sample treatment solution to obtain 10 4 TCID 50 / mL, 10 3 TCID 50 / mL, 10 2 TCID 50 / mL positive sample. A colloidal gold test strip for detecting imported canine coronavirus antigen on the market was purchased, and the samples diluted in multiples were tested simultaneously with the colloidal gold test strip prepared by the present invention, and the test results were compared and photographed for comparison.

[0184] 2 Results and analysis

[0185] 2.1 CCoV-N target gene amplification

[0186] The N gene was amplified using CCoV as a template, and an amplified fragment (1149 bp) with NdeⅠ and XhoⅠ restriction sites was obtained by PCR ( Figure 1 ), which is consistent with the expected size fragment, indicating that the CCoV-N target gene was successfully amplified.

[0187] 2.2 Identification of pET-30a-CCoV-N recombinant plasmid

[0188] Pick five single colonies for culture, take the cultured bacterial solution and use primers for PCR identification. The results are as follows Figure 2 As shown in A in Figure 1, the target band appeared at 1149 bp, which was consistent with the expected size. The amplified N gene was homologously recombined with the linearized vector pET-30a, and the double enzyme digestion identification results of the CCoV-N recombinant expression vector were as follows: Figure 2 As shown in B, the target bands appeared at 1149 bp and 5238 bp of the N gene and the linearized vector pET-30a, respectively, which were consistent with the expected size. After the culture was expanded, the concentration of the plasmid was extracted and measured, and the sequence alignment after sequencing showed 100% correctness, indicating that the pET30a-CCoV-N recombinant plasmid was successfully constructed.

[0189] 2.3 Expression and identification of CCoV-N recombinant protein

[0190] IPTG was added to the positive transformed bacteria for induction. The SDS-PAGE results were as follows: Figure 3A in the figure shows that there is a target protein band at around 43 kDa, which is consistent with the expected size. Adding IPTG can significantly increase the expression of the target protein. The bacterial solution was further ultrasonically disrupted and the supernatant and precipitate were separated. The SDS-PAGE results are shown in Figure 2. Figure 3 As shown in Figure B, most of the target protein is present in the bacterial supernatant in a soluble form, which is conducive to protein purification.

[0191] Optimization of 2.4CCoV-N protein expression conditions

[0192] 2.4.1 Effect of induction temperature on protein expression

[0193] The results are as follows Figure 4 As shown, IPTG was added at a final concentration of 1 mmol / mL, and the mixture was induced at 16°C, 20°C, 24°C, 30°C, and 37°C for 6 h. After ultrasonic disruption, the supernatant was subjected to SDS-PAGE, and it was found that the protein expression level was highest at 37°C.

[0194] 2.4.2 Effect of induction time on protein expression

[0195] The results are as follows Figure 5 As shown, IPTG was added at a final concentration of 1 mmol / mL, and the culture was induced at 37°C for 2h, 4h, 6h, 8h, and 10h, respectively. The bacterial solution was ultrasonically disrupted, and the supernatant was subjected to SDS-PAGE. It was found that the protein expression level was highest when induced at 37°C for 8h.

[0196] 2.5 Effect of different IPTG concentrations on protein expression

[0197] The results after adding 0.2mmol / mL, 0.6mmol / mL, 1mmol / mL, 1.5mmol / mL, and 2mmol / mL final concentrations of IPTG are as follows Figure 6 As shown, under the condition of induction at 37°C for 8 h, the highest protein expression level can be obtained when the final concentration of IPTG is 0.6 mmol / mL.

[0198] Purification and identification of 2.6CCoV-N recombinant protein

[0199] According to the optimized conditions, the bacterial solution was expressed in large quantities and the bacterial solution was treated with Ni + After affinity chromatography purification, the results of SDS-PADE identification were as follows Figure 7 As shown in the figure, there is a target protein band at around 43 kDa, which is consistent with the expected size. The flow-through and washing buffer control results are normal. The amount of protein eluted by 100% Elution Buffer is high, and the purification effect is good, and a high-purity N protein is obtained.

[0200] 2.7 Analysis of antigenic specificity of CCoV-N recombinant protein

[0201] The antigenicity of CCoV-N recombinant protein was verified by Western Blot using CCoV mouse positive serum as primary antibody. Figure 8 As shown, there is a target protein band at around 43 kDa, which is consistent with the expected size, indicating that the CCoV-N recombinant protein has good antigenic specificity.

[0202] 2.8 Establishment of indirect ELISA detection method

[0203] The OD value of the positive serum was used as the P value, and the OD value of the negative serum was used as the N value to calculate the P / N value of each well. As shown in Table 3, the condition for the maximum P / N value was a serum dilution of 1:800 and an antigen dilution of 0.5 μg / mL. This condition was selected for subsequent screening of positive hybridomas.

[0204] Table 3 Establishment of indirect ELISA detection method

[0205]

[0206]

[0207] 2.9 Results of serum titer determination in immunized mice

[0208] The established indirect ELISA method was used to detect the titer of the sera of immunized mice. Fig. 9 As shown, the serum titers of the three mice all reached 10 5 , all met the fusion conditions, and mouse No. 2 with the highest serum titer was selected for cell fusion.

[0209] 2.10 Positive hybridoma cell screening and subcloning

[0210] like Fig.10 As shown in Figures AC, the successfully fused hybridoma cells began to aggregate on the 3rd day after cell fusion, and then on the 6th day, the hybridoma cells became transparent and clear. On the 10th day, the hybridoma cells aggregated into a large cell mass. The hybridoma cell supernatant was collected and screened by indirect ELISA, and the cell wells with high OD values ​​were subcloned and cultured by limiting dilution. After three subclones, 8 hybridoma cell lines were obtained and named 3D10, 4A8, 6D9, 5B7, 7E2, 5A6, 4H2, and 4B6. Among them, the positive hybridoma cells of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 had good morphology, as shown in Figure 4. Fig.10 As shown in D; the morphology of 4H2 and 4B6 positive hybridoma cells is shown in Fig.31 .

[0211] 2.11 Identification of chromosome number of positive hybridoma cells

[0212] The chromosome number results of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 positive hybridoma cells are as follows Fig.11 As shown in the figure, by counting chromosomes, it can be concluded that the chromosome numbers of the six positive hybridoma cells are all between 98±5, which is consistent with the chromosome number of hybridomas, indicating that they are hybridoma cells. The chromosome number results of 4H2 and 4B6 are shown in the figure. Fig.32 By counting chromosomes, it can be concluded that the chromosome numbers of the two positive hybridoma cells are both between 98±5, which is consistent with the chromosome number of hybridomas, indicating that they are hybridoma cells.

[0213] 2.12 Hybridoma cell supernatant assay results

[0214] The titer of hybridoma cell supernatant was tested by indirect ELISA. The titer test results of hybridoma cell supernatant of 3D10, 4A8, 6D9, 7E2, 5B7 and 5A6 are as follows: Fig.12 As shown, the highest titer of 3D10 is 2 12 , the lowest titer of 5A6 is 2 4 The remaining antibody titers were between 2 9 -2 11 The titer test results of 4H2 and 4B6 hybridoma cell supernatants showed that the titers were 2 10 , 2 11 .

[0215] 2.13 Ascites titer determination results of monoclonal antibodies

[0216] The results of the ascites titer test of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 monoclonal antibodies are as follows: Fig.13 As shown: The highest titer of 3D10, 4A8, and 5A6 is 10 6 , the lowest titer of 5B7 and 7E2 is 10 4 , the titer of 6D9 is 10 5 The titers of 4H2 and 4B6 are both 10 5 .

[0217] 2.14 Identification of Monoclonal Antibody Subtypes

[0218] As shown in Table 4, the antibody subtypes of 3D10, 6D9, 7E2, 5B7, and 5A6 are all IgG1, 4A8 is IgG2a, and the light chain type is κ chain. The antibody subtypes of 4H2 and 4B6 are all IgG1, and the light chain type is κ chain.

[0219] Table 4 Subtype results of monoclonal antibodies

[0220] Antibody Subtype Light chain 3D10 IgG1 κ 4A8 IgG2a κ 6D9 IgG1 κ 5B7 IgG1 κ 7E2 IgG1 κ 5A6 IgG1 κ 4H2 IgG1 κ 4B6 IgG1 κ

[0221] 2.15 Indirect immunofluorescence assay with monoclonal antibodies

[0222] like Fig.14 As shown in the figure, the screened CCoV-N protein monoclonal antibodies 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 can react with CCoV infected cells and show specific fluorescence under an inverted fluorescence microscope. The CCoV-N protein monoclonal antibodies 4H2 (A) and 4B6 (B) can react with CCoV infected cells and show specific fluorescence under an inverted fluorescence microscope, as shown in the figure. Fig.29 shown.

[0223] 2.16 Western blot identification of monoclonal antibodies

[0224] The results of 3D10, 4A8, 6D9, 7E2, 5B7, 5A6 are as follows Fig.15 As shown in the figure, the CCoV-N protein monoclonal antibodies screened can all recognize the virus-specific protein bands with a molecular weight of about 70kDa (phosphorylated N protein). The 4H2 (A) and 4B6 (B) CCoV-N protein monoclonal antibodies screened can all recognize the virus-specific protein bands with a molecular weight of 70kDa (phosphorylated N protein). Fig.30 shown.

[0225] 2.17 Characterization of Purified Ascites

[0226] The identification results of 3D10, 4A8, 6D9, 7E2, 5B7, and 5A6 are as follows Fig.16 As shown in the figure, the monoclonal antibody purified from ascites has a band at 50kDa, which is the monoclonal antibody heavy chain, and a band between 20-25kDa is the monoclonal antibody light chain, which is in line with the expected results of the experiment and the purification effect is good. The concentration of the purified monoclonal antibody after ultrafiltration concentration is above 1mg / mL. The identification results of 4H2 and 4B6 are shown in the figure. Fig.33 shown.

[0227] 2.18 Preparation and testing of colloidal gold solution

[0228] The present invention plans to use a colloidal gold solution with a particle size of 40nm. Fig.17 As shown in A in FIG. 1 , the colloidal gold solution is wine red and transparent when observed with the naked eye. The absorption spectrum of the colloidal gold solution is analyzed by scanning between 400-600 nm using a UV-visible spectrophotometer. Fig.17 As shown in B in FIG. 1 , it is a single peak, and the maximum absorption peak wavelength is 524 nm. The results show that the colloidal gold solution prepared by the present invention has good performance and meets the test requirements.

[0229] 2.19 Optimal pH value and optimal labeled antibody concentration for gold-labeled antibodies

[0230] After adding 20 μl of 10% NaCl solution, gently mix and let stand at room temperature for 5 minutes, Fig.18 As shown, it can be observed that the color of the gold-labeled conjugates in different wells has changed. The conditions corresponding to the wells with a gold-labeled conjugate color closer to the wine red color of the original colloidal gold solution and the highest ultraviolet absorbance value are selected as the optimal conditions. Based on the addition amount of 0.2M K2CO3 corresponding to each 2mL of colloidal gold solution and the addition of 200μl of antibody concentration, the optimal gold-labeled pH and the optimal labeled protein amount of the 8 monoclonal antibodies screened as gold-labeled antibodies are shown in Table 5.

[0231] Table 5 Optimal gold labeling pH and optimal labeled protein amount for monoclonal antibodies

[0232]

[0233]

[0234] 1.20 Selection of the most suitable antibody pair for colloidal gold

[0235] After the antibodies were paired, the optimal conditions were selected to prepare the test strips. 4 TCID 50 / mL of CCoV virus liquid for testing, select Fig.18 As shown in Figure 2, the antibody pair combination was selected: gold label antibody: 4A8, blocking antibody: 4B6 for further experiments. 4 TCID 50 / mL of CCoV virus liquid, 10 3 TCID 50 / mL CCoV virus solution, negative samples, and F81 cell supernatant were tested. Fig.18 shown.

[0236] 2.21 Determination of the optimal NC membrane

[0237] Different types of NC membranes have different sensitivities and specificities. In order to determine the best NC membrane for the test, the same positive sample and negative sample were tested. The reaction results are as follows: Fig.19 As shown, CN95 with higher sensitivity and specificity was selected as the best NC membrane for subsequent experiments.

[0238] 2.22 Determination of the optimal volume of gold label conjugate

[0239] As the volume of gold-labeled conjugate added increases, the amount of antibody captured by the T-line detection line and the amount of gold-labeled conjugate also increase, and the sensitivity will also increase; however, if the volume of gold-labeled conjugate added is too much, the nonspecific adsorption of the test strip will also increase. The pre-treated gold-labeled conjugate pad is sprayed with different volumes of gold-labeled conjugate to test the same positive and negative samples, and the color development of the test strip and the detection signal are compared. The reaction results are as follows Fig. 20 As shown, 8 μl was selected as the optimal addition volume for subsequent experiments.

[0240] 2.23 Selection of the optimal coating concentration of T line interception antibody

[0241] After preparing the test strips, test the same positive sample and negative sample, and compare the color development of the test strips and the detection signal. Fig.21 As shown in the figure, as the concentration of T line increases, the color development degree and detection signal of the test strip will increase accordingly. When the concentration of T line is at a high level, it can completely capture the antigen, and the color development degree and detection signal of the test strip are not much different, but at the same time, the nonspecific adsorption of T line will also be enhanced. Considering the cost waste and nonspecificity, 2mg / mL concentration is selected as the optimal T line coating antibody concentration.

[0242] 4.24C Line Antibody Optimal Coating Concentration Selection

[0243] The NC membrane was coated with goat anti-mouse IgG antibody at concentrations of 0.5, 1, 1.5, 2, 2.5, and 3 mg / mL, respectively. The T-line antibody concentration was fixed at 2 mg / mL, and the C-line coating concentration was optimized. After preparing the test strips, the same positive and negative samples were tested, and the color development of the test strips and the detection signals were compared. The results are shown in Fig. 22 As shown in the figure, as the concentration of the C-line antibody increases, the color development and detection signal of the test strip will increase accordingly. When the concentration of the T-line is at a higher level, it can completely capture the antigen, and the color development and detection signal of the test strip are not much different. Therefore, 2.5 mg / mL antibody concentration is selected as the optimal antibody coating amount for the C line.

[0244] 2.25 Determination of the Optimal Reaction Time

[0245] A batch of test strips were prepared using the optimized conditions of the above test strips, and the same batch of positive samples were tested. The color development and detection signals of the test strips were compared to optimize the reaction time and obtain the best observation and detection effect of the test strips. The results are as follows Fig.23 As shown in the figure, as the reaction time increases, the color development degree and detection signal of the T line and C line test strips will increase accordingly. When the reaction time is 15 minutes, the color development degree and detection signal of the T line and C line test strips are not much different. Therefore, 15 minutes is selected as the best reaction time for interpreting the test strip results.

[0246] 2.26 Evaluation of the sensitivity of colloidal gold test strips

[0247] A batch of test strips were prepared using the optimized conditions of the above test strips. 5 TCID 50 / mL of CCoV standard was diluted with sample treatment solution at 1:10, 1:100, and 1:1000, respectively. The sample treatment solution was used as a negative control and tested with a test strip to observe the color development of the test strip. The results are as follows Fig.24 As shown in the figure, when the CCoV standard diluted 1:100 was tested with the test strip, there was still a faint band on the T line, while when the CCoV standard diluted 1:1000 was tested with the test strip, there was no band on the T line. Therefore, the test strip has good sensitivity and the virus content is 10 3 TCID 50 / mL is the minimum detection limit of the test strip of the present invention.

[0248] 4.27 Evaluation of the specificity of colloidal gold test strips

[0249] The test strips were prepared according to the optimized conditions and the samples were tested to identify the specificity of the test strips. Fig.25 As shown, only when the sample to be tested contains CCoV antigen, both the test line (T line) and the quality control line (C line) are colored and the T / C value is high, while when other virus antigens are detected, only the quality control line (C line) is colored, while the test line (T line) is not colored, which indicates that the antigen detection test paper of the present invention has high specificity.

[0250] 2.28 Evaluation of the stability of colloidal gold test strips

[0251] The colloidal gold test strip placed at 37°C was tested on the same positive sample at 0d, 10d, 20d, and 30d. The results are as follows: Fig.26 As shown, there is no obvious difference in the brightness of the C and T lines of the test strip on different days, which indicates that the test strip of the present invention has good stability.

[0252] 2.29 Testing of clinical samples

[0253] The 47 dog fecal swabs collected were tested using the test strips developed by the present invention and the RT-PCR method, and the results were analyzed and compared. The RT-PCR test results are as follows: Fig. 27 As shown in Table 6, 18 of the 47 dog feces swabs were positive and 29 were negative. After comparing the test results of the test strip developed by the present invention, the results are shown in Table 6. Among the 47 dog feces swabs tested by the test strip, 21 were positive and 26 were negative. Therefore, the total compliance rate between the test strip developed by the present invention and the RT-PCR method is 89.36%.

[0254] Table 6 Clinical sample testing

[0255]

[0256] 2.30 Comparison with commercial test strips

[0257] I bought a colloidal gold test strip of canine coronavirus of a certain imported brand and tested the CCoV virus liquid with different virus amounts using the test strip developed by the present invention. The results are as follows: Fig.28 As shown, when the amount of virus detected is 10 3 TCID 50 / mL of CCoV virus liquid, the test strip developed by the present invention still has visible bands, while the commercial test strip has no bands. It can be seen that the sensitivity of the test strip of the present invention is about 10 times better than that of the commercial test strip. That is, the detection effect of the test strip developed by the present invention is better than that of the commercial test strip.

[0258] The present invention successfully constructed the pET-30a-CCoV-N recombinant plasmid and expressed the CCoV-N recombinant protein in prokaryotes. After immunization, 6 high-efficiency, high-affinity, and high-specificity anti-CCoV-N monoclonal antibodies were screened and named 3D10, 4A8, 6D9, 5B7, 7E2, and 5A6, respectively. When 4A8 was subsequently used as a gold-labeled antibody, it had good specificity and sensitivity. The present invention used the 4A8 and 4B6 antibody pairs as gold-labeled antibodies and interception antibodies, respectively, to establish a canine coronavirus colloidal gold test strip detection method. The hybridoma cell line 4A8, with a deposit number of CCTCCNO: C2024304, was deposited in the China Center for Type Culture Collection, with a deposit address of Wuhan, China, and Wuhan University; the hybridoma cell line 4B6, with a deposit number of CCTCCNO: C2024305, was deposited in the China Center for Type Culture Collection, with a deposit address of Wuhan, China, and Wuhan University. The minimum detection limit is 10 3 TCID 50 / mL, and no cross reaction with CDV, CPV and CPIV, can provide results within 15min, with good sensitivity and specificity. The test strip of the present invention was further tested on 47 clinical samples, and the results showed that the total compliance rate of the colloidal gold test strip of the present invention was 89.36%.

[0259] The embodiments are only descriptions of the preferred modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A hybridoma cell line, characterized in that: The hybridoma cell line is named 4A8, and the deposit number of 4A8 is CCTCC NO: C2024304. It is deposited in China Center for Type Culture Collection, and the deposit address is Wuhan University, Wuhan, China.

2. A monoclonal antibody 4A8 secreted by the hybridoma cell line according to claim 1.

3. The monoclonal antibody 4A8 according to claim 2, characterized in that The heavy chain subtype of the monoclonal antibody 4A8 is IgG2a, and the light chain subtype is κ chain.

4. A method for preparing the monoclonal antibody 4A8 according to claim 2 or 3, characterized in that: The hybridoma cell line 4A8 according to claim 1 is used for secretion.

5. Use of the hybridoma cell line according to claim 1 or the monoclonal antibody 4A8 according to claim 2 or 3 in the preparation of a detection reagent or a detection kit for canine coronavirus.

6. Use of the hybridoma cell line according to claim 1 or the monoclonal antibody 4A8 according to claim 2 or 3 in the preparation of a drug for preventing and treating diseases caused by infection with canine coronavirus.

7. Use of the hybridoma cell line according to claim 1 or the monoclonal antibody 4A8 according to claim 2 or 3 in the preparation of a canine coronavirus vaccine.

8. An immune colloidal gold test strip for detecting canine coronavirus N protein, characterized in that: The immunocolloidal gold test strip uses the monoclonal antibody 4A8 described in claim 2 or 3 as a gold-labeled antibody.

9. The method for preparing the immune colloidal gold test strip as claimed in claim 8, characterized in that: The invention comprises the steps of spraying monoclonal antibody 4B6 on NC membrane as a detection line, wherein the monoclonal antibody 4B6 is secreted by 4B6 hybridoma cell line, the deposit number of the 4B6 hybridoma cell line is CCTCC NO: C2024305, and the cell line is deposited in China Center for Type Culture Collection, and the deposit address is Wuhan University, Wuhan, China; the heavy chain subtype of the monoclonal antibody 4B6 is IgG1, and the light chain subtype is κ chain.

10. The preparation method according to claim 9, characterized in that: The preparation method comprises the steps of diluting goat anti-mouse IgG with a streak diluent and spraying the diluent below the detection line on the NC membrane at 1.0 mL / cm as a quality control line.

Images