Genetically engineered bacterium of high-yield D-pantothenic acid based on one-carbon unit supply as well as construction method and application of genetically engineered bacterium

Abstract

The invention provides a high-yield D-pantothenic acid genetically engineered bacterium based on one-carbon unit supply, a construction method of the high-yield D-pantothenic acid genetically engineered bacterium and application of the high-yield D-pantothenic acid genetically engineered bacterium to preparation of D-pantothenic acid through microbial fermentation. According to the method disclosed by the invention, the supply of a carbon cofactor in an escherichia coli organism is enhanced mainly by enhancing a glycine cracking system, so that the carbon flux flows to the synthesis of D-pantothenic acid; in order to continuously enhance carbon flux, reinforce THF synthetic pathway related genes, regulate and control a serine synthetic pathway, and combine reinforcement of a glycine splitting system and expression of pantoic acid synthetic pathway key genes, the plasmid-free and antibiotic-free engineering strain for high yield of D-pantothenic acid is finally obtained. Finally, the shake-flask titer of the D-pantothenic acid is improved by 31.7% relative to that of the original strain and reaches 6.85 g / L; when a 5-L fermentation tank is used for fermentation for 92 hours, the yield of D-pantothenic acid can reach 112.62 g / L.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a genetically engineered bacterium with high yield of D-pantothenic acid based on one-carbon unit supply and a construction method thereof, as well as application of the genetically engineered bacterium with high yield of D-pantothenic acid in preparing D-pantothenic acid by microbial fermentation. Background Art

[0002] Pantothenic acid, also known as vitamin B5, is one of the components of coenzyme A and plays a key role in important biochemical reactions such as energy metabolism and citric acid cycle. Therefore, as an important vitamin and precursor substance, D-pantothenic acid is widely used in feed, medicine and cosmetics. Among the known D-pantothenic acid synthesis methods, the biological fermentation method for producing D-pantothenic acid has attracted attention due to its advantages such as cheap substrate, easy separation and low toxicity. However, there are still defects in the production of D-pantothenic acid using biological methods, such as unstable fermentation process and low yield. Therefore, it is still a major challenge to construct a higher-yielding D-pantothenic acid strain. Summary of the invention

[0003] In order to solve the technical problem of low yield of D-pantothenic acid synthesized by microbial fermentation in the prior art, the present invention uses CRISPR-Cas9-mediated gene editing technology to strengthen the glycine cleavage system and the folate synthesis pathway in the chassis bacteria genome, regulate the serine pathway and strengthen the expression of key genes in the pantothenic acid synthesis pathway, obtain a genetically engineered bacterium with high yield of D-pantothenic acid, and apply the genetically engineered bacterium to the preparation of D-pantothenic acid by microbial fermentation.

[0004] The technical scheme adopted by the present invention is: a method for constructing a high-yield D-pantothenic acid genetic engineering bacterium based on one-carbon unit supply, the method comprising: using CRISPR-Cas9-mediated gene editing technology to: overexpress the gcvTHP gene in the chassis bacteria genome; strengthen the folP gene; integrate the serA and glyA gene clusters and add a panB gene copy after the serAglyA gene cluster, wherein the serAglyA gene cluster is regulated by a dynamic regulatory element; and add a heterologous codon-optimized alsS gene to obtain a high-yield D-pantothenic acid genetic engineering bacterium.

[0005] The present invention is based on the bottom plate bacteria ZJUTDPAP2 (E.coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB, which has been disclosed in CN116590209A), the system metabolic engineering strategy is comprehensively applied, and the CRISPR / Cas9 gene editing technology is used to replace the gcvTHP gene in situ promoter with the Ptrc promoter, thereby eliminating the transcriptional inhibition of the gcvTHP gene by the gcvA and purR genes, strengthening the glycine cleavage system, and strengthening the one-carbon cofactor supply in the Escherichia coli organism, further making the carbon flux flow to the synthesis of D-pantothenic acid. On this basis, in order to continue to enhance the synthesis of carbon flux to D-pantothenic acid, the present invention also strengthens the genes related to the THF synthesis pathway. On the one hand, the synthesis of folic acid is enhanced by adding a molecule of folP gene copy at the lafU pseudogene site, providing a methyl carrier for the one-carbon unit. On the other hand, the Apt2#82 glycine ribosome switch is used to control the expression of the serAglyA gene cluster in real time according to the intracellular glycine concentration, so as to achieve the moderate enhancement of the key genes of the serine pathway, so as to reasonably regulate the serine synthesis rate. At the same time, in response to the supply of methyl groups, a P-dependent gene was added after the serAglyA gene cluster. panB Finally, by introducing heterologous codon-optimized alsS, the expression efficiency of the genetically engineered bacteria was improved, the yield of D-pantothenic acid was increased, and finally a plasmid-free, antibiotic-free engineered strain for high-yield D-pantothenic acid was obtained.

[0006] Table 1. Genes and corresponding pathways involved in gene editing

[0007]

[0008] Preferably, the method for overexpressing the gcvTHP gene comprises: replacing the in situ promoter of the gcvTHP gene with the Ptrc promoter. Activating the glycine cleavage system by a strong promoter can eliminate the effects of gcvA and purR on the supply of one-carbon units, providing 5,10-methylenetetrahydrofolate for the D-pantothenic acid pathway, and effectively increasing the synthesis of D-pantothenic acid.

[0009] Preferably, the method for strengthening the folP gene comprises: adding a copy of the folP gene at the lafU pseudogene site. Overexpression of the folP gene can further promote the binding of pABA to the GTP pathway, and is an effective strategy for strengthening folic acid synthesis to provide a methyl carrier for one-carbon units.

[0010] Preferably, the dynamic regulatory element is a ribosomal switch Apt2#82. The ribosomal switch Apt2#82 can control the overexpression of serA and glyA according to the intracellular glycine concentration. When glycine accumulates to a certain level, it will fold and cover the ribosomal site, inhibiting the translation of the gene cluster serAglyA; when the intracellular content of glycine is low, the ribosomal site will be exposed to enhance translation. Using the ribosomal switch to control the expression of glyA in real time can achieve moderate enhancement of key genes in the serine pathway. This strategy can reasonably regulate the serine synthesis rate, maintain intracellular glycine at a low level, and effectively promote the synthesis of D-pantothenic acid.

[0011] Preferably, the panB gene is regulated by the PpanB promoter. Adding another copy of the panB gene after the serAglyA gene cluster can better respond to the methyl supply and promote the synthesis of D-pantothenic acid.

[0012] Preferably, the alsS gene is derived from Bacillus subtilis and is codon optimized. Acetolactate synthase (alsS) catalyzes two molecules of pyruvate to form α-acetolactate, and acetolactate synthase is involved in the synthesis of valine, leucine and isoleucine. By introducing a heterologous alsS gene into the genome and performing codon optimization, the expression efficiency of the gene in the host can be improved, and the strain burden is small. Without adding pyruvate, the D-pantothenic acid production in the shake flask is promoted.

[0013] Preferably, the bottom plate bacteria is: E.coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB, denoted as DPAH2.

[0014] Preferably, the nucleotide sequences of the gcvTHP gene, folP gene and alsS gene regulated by the Ptrc promoter are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, respectively; the serAglyA gene cluster sequence regulated by the Apt2#82 ribosomal switch is shown as SEQ ID NO.4; and the nucleotide sequence of the panB gene regulated by the PpanB promoter is shown as SEQ.ID.NO.5.

[0015] More specifically, the method for constructing the genetically engineered bacteria that produces high levels of D-pantothenic acid comprises the following steps:

[0016] (1) The engineered bacteria DPAP2 was used as the starting strain and named H2. The CRISPR-Cas9-mediated gene editing technology was used to replace the in situ promoter of the gcvTHP gene with the Trc promoter in its genome, and the transcriptional regulatory region was deleted to obtain the engineered bacteria DPAH3 derivative, Trc-gcvTHP, which was recorded as engineered bacteria DPAH3;

[0017] (2) Using the engineered bacterium DPAH3 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to add a copy of the folP gene at the lafU pseudogene site to obtain the engineered bacterium DPAH6 derivative, lafU::folP, denoted as engineered bacterium DPAH6;

[0018] (3) Using the engineered bacterium DPAH6 as the starting strain, the CRISPR / Cas9 gene editing technology was used to integrate the serA and glyA gene clusters into the genome, and a copy of the panB gene was added after the gene cluster to obtain the engineered bacterium DPAH7derivative, yeeP::Trc-Apt2#82-serAglyA-P panB -panB, denoted as engineered bacteria DPAH7;

[0019] (4) Using the engineered bacterium DPAH7 as the starting strain, the CRISPR / Cas9 gene editing technology was used to increase the copy number of the Bacillus subtilis alsS gene regulated by the promoter pTrc in the genome by gene knock-in, and codon optimization was performed to obtain the engineered bacterium DPAH8 derivative, gapC::Trc-alsS*, denoted as the engineered bacterium DPAH8, which is the genetically engineered bacterium with high production of D-pantothenic acid.

[0020] The present invention also provides a genetically engineered bacterium with high yield of D-pantothenic acid obtained by any of the above methods. Through the above method, the present invention constructs an engineered bacterium E.coli W3110 without plasmid and antibiotic addition during fermentation, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB / Trc-gcvTHP / lafU::folP / yeeP::Trc-Apt2#82-serAglyA-P panB-panB / gapC::Trc-alsS*, the shake flask titer of this strain reached 6.85g / L, which was 31.7% higher than that of the starting strain. Finally, using a 5-L fermenter for 92 hours, the D-pantothenic acid production could reach 112.6g / L, which greatly improved the synthesis of D-pantothenic acid and shortened the fermentation cycle.

[0021] The present invention also provides the use of the genetic engineering bacteria with high D-pantothenic acid production in the preparation of D-pantothenic acid by microbial fermentation.

[0022] Preferably, the application method comprises: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium, carrying out fed-batch fermentation culture for 72 to 96 hours at 28 to 37° C., 300 to 450 rpm, pH 6.7 to 6.9, and 10% to 30% dissolved oxygen, and separating and purifying the D-pantothenic acid after the fermentation is completed.

[0023] Preferably, the fermentation medium is composed of: 10-30 g / L glucose, 10-25 g / L ammonium sulfate, 1-5 g / L anhydrous betaine, 1-5 g / L yeast powder, 1-5 g / L potassium dihydrogen phosphate, 0.5-2 g / L anhydrous magnesium sulfate, 1-5 g / L β-alanine, 1-5 ml / L trace element solution, the solvent is deionized water, and the pH value is natural; the trace element solution consists of: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0024] Preferably, the application method comprises: loading a 5L fermentation tank with a volume of 1 to 3L of fermentation medium, sterilizing at 115°C for 30min, inoculating the genetically engineered bacterial strain into 1 to 3L of fermentation medium, and fermenting and culturing at 28 to 37°C, an initial aeration volume of 3 to 6L / min, and an initial stirring speed of 300 to 450rpm, adjusting the pH with ammonia water, and adding IPTG with a final concentration of 0.1 to 0.4mM, and a final concentration of 5mg / L or 2mg / L. 12, and 10-40g / L isoleucine 5-10mL; during the fermentation process, the dissolved oxygen is maintained at 10%-30% by using the dissolved oxygen serial speed, and the pH is maintained at 6.7-6.9 by using ammonia water as a neutralizer, and the feed medium is added to the tank through pH linkage feeding, and the glucose concentration is controlled below 5g / L, and the culture is carried out at 28-37°C for 72-96 hours to obtain the fermentation liquid, and the fermentation liquid supernatant is separated and purified to obtain the D-pantothenic acid. Wherein, the feed medium is composed of 500g / L glucose, 5-25g / L ammonium sulfate, 2-8g / L anhydrous betaine, 1-5g / L yeast powder, 10-20g / L potassium dihydrogen phosphate, 5-15g / L anhydrous magnesium sulfate, 40-100g / L β-alanine, 1-5ml / L trace element solution, the solvent is deionized water, and the pH value is natural.

[0025] Beneficial effects of the present invention: The present invention uses CRISPR / Cas9 gene editing technology to strengthen the glycine cleavage system and folic acid synthesis pathway on the basis of existing engineered bacteria, providing one-carbon units and rich methyl carriers for the pantothenic acid synthesis pathway. On the other hand, the Apt2#82 glycine ribosomal switch is used to finely control the serine and glycine synthesis rates, and further strengthen the expression levels of key genes in the D-pantothenic acid biosynthesis pathway, continuously supplying methyl groups to the entire reaction system. A high-yield strain without plasmids and no need to add antibiotics during the fermentation process was obtained; the shake flask titer of the strain of the present invention reached 6.85g / L, which was 31.7% higher than that of the starting strain. Finally, after fermentation in a 5L fermenter for 92 hours, the D-pantothenic acid production was able to reach 112.6g / L, which greatly improved the synthesis of D-pantothenic acid and shortened the fermentation cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The diagram shows the metabolic pathway of D-pantothenic acid and the modification sites.

[0027] Figure 2 The OD600 and D-pantothenic acid titer changes of DPAH3 in Example 1.

[0028] Figure 3 The OD600 and D-pantothenic acid titer changes of DPAH6 in Example 2.

[0029] Figure 4 The OD600 and D-pantothenic acid titer changes of DPAH7 in Example 3.

[0030] Figure 5 The OD600 and D-pantothenic acid titer changes of DPAH8 in Example 4.

[0031] Figure 6 This is a diagram of the fermentation results of DPAH8 in a 5L bioreactor in Example 5. DETAILED DESCRIPTION

[0032] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.

[0033] In the following examples, the final concentration of spectinomycin in the culture medium is 0.05 mg / L, and the final concentration of kanamycin in the culture medium is 0.05 mg / L.

[0034] The parent strain E. coli W3110 of the present invention is from the Coli Genetic Stock Center of Yale University, with a deposit date of August 5, 1975 and a deposit number of CGSC#4474, and has been disclosed in patents US2009 / 0298135A1 and US2010 / 0248311A1.

[0035] The HPLC determination method of D-pantothenic acid content is as follows: chromatographic conditions: C18 column (250×4.6mm, particle size 5μm, Agilent Technologies Co., Santa Clara, CA, USA), detection wavelength: 200nm, column temperature: 30°C; sample treatment: dilute the sample with ultrapure water to keep the D-pantothenic acid content between 0.05g / L and 0.40g / L; mobile phase: acetonitrile / water / phosphoric acid: (50 / 949 / 1); data acquisition time: 25min.

[0036] Example 1: DPAH3 construction and shake flask fermentation

[0037] DPAP2 (E. coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB) was used as the starting strain, and CRISPR-Cas9-mediated gene editing technology was used to overexpress gcvTHP in the genome, and the glycine in situ promoter was replaced by the Trc promoter (the nucleotide sequence is shown in SEQ ID NO.1), so that the transcriptional regulatory factors gcvA and purR could not inhibit the expression of the glycine cleavage system, and the strain DPAH3 (DPAH2 derivative, Trc-gcvTHP) was obtained.

[0038] (1) Construction of pTarget-PAM-gcvTHP plasmid: pTarget plasmid (Addgene Plasmid #62226) was used as a template and pT-gcvTHP-PAM-F / R as primers for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and digested with DpnI digestion enzyme at 37°C for 3 h. The product was then transformed into E. coli DH5α and screened on spectinomycin plates. The correct pTarget-PAM-gcvTHP plasmid was obtained by sequencing for subsequent ligation with Donor DNA.

[0039] (2) Construction of pTD-donor-EcgcvTHP plasmid: First, using the E. coli W3110 genome as a template, gcvTHP-up-F / R as primers were used to amplify the upstream part of the donor DNA (F1), and gcvTHPdown-F / R as primers were used to amplify the downstream part of the donor DNA (F2). Then, using the E. coli W3110 genome as a template, pTrc-EcgcvTHP-18F / R as primers were used to amplify the EcgcvTHP gene fragment (F3) with the promoter pTrc, and the PCR fragments were purified by gel recovery to obtain F1, F2 and F3; the plasmid pTarget-gcvTHP was incubated at 37°C for 8 hours with Xba I and Pst I, and the DNA fragments were recovered by the Clean up kit; according to The pTarget-gcvTHP vector, fragments F1, F2 and F3 were connected together according to the instruction manual of the kit (One step cloning kit, Vazyme Biotech, Nanjing, China), and the pTD-donor-EcgcvTHP plasmid was obtained by sequencing verification.

[0040] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into ZJUTDPAH2 (E. coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB), transfer the monoclonal colony to an LB tube containing 0.05 mg / L kanamycin and culture at 30°C overnight; then inoculate it into a 250 mL shake flask containing 50 mL LB medium at a volume concentration of 1%, add 500 μl 1 mol / L L-arabinose, and culture at 150 rpm and 30°C until OD 600 0.4~0.6; 4000rpm, 4℃ centrifugation for 10min to collect cells and prepare electroporation competent cells. For detailed process, see (Molecular Cloning: A Laboratory Manual, 3ed Edition, 99-102).

[0041] (4) Use a pipette to take an appropriate amount of pTD-donor-EcgcvTHP plasmid (about 200 ng) and mix it with 100 μl of electroporation competent cells prepared in advance, and transfer them into a pre-cooled 2 mm electroporation cup. After an ice bath for about 1-2 minutes, use an electroporator (MicroPluser TM , BIO-RAD) for electroporation transformation. After the electroporation, 800 μl LB medium was immediately added and gently aspirated, and the culture was transferred to a 2 mL Eppendorf tube. After resuscitation at 30°C for 3-4 hours, LB solid plates containing 0.05 mg / L kanamycin and 0.05 mg / L spectinomycin were coated and incubated at 30°C for 12-16 hours. Colony PCR was performed using gcvTHP-VF / R as primers to verify the colony. If a fragment of about 3500 bp was successfully cloned, it was proved to be a DPAH3 (DPAH2 derivative, Trc-gcvTHP) positive colony.

[0042] (5) Plasmid elimination: Use an inoculation loop to pick up positive single colonies and inoculate them into LB liquid test tubes containing 1 mM IPTG and 0.05 mg / L kanamycin, and culture them at 30°C overnight. The next day, streak the bacterial liquid onto an LB solid plate containing 0.05 mg / L kanamycin and culture them at 30°C for 24 h. When the bacteria grow to a certain size, pick up some single colonies and streak them onto an LB plate containing 0.05 mg / L spectinomycin. Single colonies that cannot be streaked onto the LB plate containing 0.05 mg / L spectinomycin indicate that their pTarget-gcvTHP plasmid has been successfully eliminated. Then, pick up single colonies with successfully eliminated pTarget-gcvTHP plasmids and place them into LB test tubes, and culture them at 37°C overnight for elimination of the pCas plasmid. The next day, streak the bacterial liquid onto an LB plate. After culturing at 37°C for 12 hours, some single colonies were picked and streaked on LB plates containing 0.05 mg / L kanamycin. The pCas plasmid of the single colonies that could not be streaked on the LB plates containing 0.05 mg / L kanamycin was successfully eliminated, and finally a plasmid-free strain was obtained. The starting strain H2 was used as the control group, and they were inoculated into 10 mL of LB medium respectively, and cultured at 37°C and 200 rpm as precultures; after 8-12 hours, 1 mL of the preculture was inoculated into a 500 mL shake flask containing 50 mL of MS medium at a 2% inoculum, and then cultured in a constant temperature shaker at 30°C and 180 rpm for 48 hours for strain fermentation; after the fermentation, 1 mL of the fermentation broth was taken to measure the OD 600 At the same time, 1 mL of fermentation liquid was drawn with a pipette and centrifuged at 12000 rpm for 3 min at room temperature. The fermentation supernatant was diluted 5 times and the diluted sample was treated with a water filter membrane to remove impurities. The OD 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 2 shown.

[0043] As shown in the figure, after the additional copy number of gcvTHP gene was added to the genome, the D-pantothenic acid production of DPAH3 increased by 11.7% to 5.81 g / L after 48 hours of shake flask fermentation. By activating the glycine cleavage system with a strong promoter and eliminating the effects of gcvA and pur R on the supply of one-carbon units, 5,10-methylenetetrahydrofolate was provided for the D-pantothenic acid pathway, successfully increasing the D-pantothenic acid production.

[0044] LB medium: 10 g / L peptone, 5 g / L yeast extract, 5 g / L NaCl, solvent is deionized water, pH value is natural.

[0045] MS culture medium: glucose 20g / L, (NH4)2SO416 g / L, KH2PO42 g / L, MgSO40.5 g / L, yeast extract 2g / L, CaCO310 g / L, 1ml / L trace element solution, the solvent is deionized water, pH value is natural; 10g / L calcium carbonate (sterilized separately); the trace element solution composition is: 10g / L CuCl2, 10g / L FeSO4·7H2O, 1g / LZnSO4·7H2O, 0.20g / LCuSO4, 0.02g / LNiCl2·7H2O, the solvent is deionized water.

[0046] Example 2: DPAH6 construction and shake flask fermentation

[0047] Using DPAH3 as the starting strain, CRISPR-Cas9-mediated gene editing technology was used to add a copy of the folP gene (the nucleotide sequence is shown in SEQ ID NO.2) to the lafU pseudogene site through gene knock-in to obtain DPAH6 (derivative, lafU::folP).

[0048] (1) Construction of pTarget-PAM-folP plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as a template and pT-folP-PAM--F / R as primers for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and digested with DpnI digestion enzyme at 37°C for 3 h. The product was then transformed into E. coli DH5α and screened on spectinomycin plates. The correct pTarget-PAM-folP plasmid was obtained by sequencing for subsequent ligation with Donor DNA.

[0049] (2) Construction of pTD-Donor-EcfolP plasmid: First, using the E. coli W3110 genome as a template, folP-up-F / R as primers were used to amplify the upstream part of the donor DNA (F1), and folP-down-F / R as primers were used to amplify the downstream part of the donor DNA (F2). Then, using the E. coli W3110 genome as a template, pTrc-EcfolP-F / R as primers were used to amplify the EcfolP gene fragment (F3) with the promoter pTrc, and the PCR fragments were purified by gel recovery to obtain F1, F2 and F3; the plasmid pTarget-folP was incubated at 37°C for 8 hours with Xba I and Pst I, and the DNA fragments were recovered using the Clean up kit; according to The pTarget-ydeU vector, fragments F1, F2 and F3 were connected together according to the instruction manual of the kit (One step cloning kit, Vazyme Biotech, Nanjing, China), and the pTD-EcfolP plasmid was obtained by sequencing verification.

[0050] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH3 competent cell obtained in Example 1. The method for preparing the DPAH3 competent cell by electroporation was the same as that in Example 1 (3).

[0051] (4) DPAH6 positive colonies were constructed using the same method as in Example 1 (4).

[0052] (5) Plasmid elimination: The implementation method is the same as Example 1 (5) to obtain plasmid-free DPAH6 (derivative, lafU::folP).

[0053] (6) The constructed DPAH6 production strain was used as a control group with the DPAH3 constructed in Example 1 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 3 shown.

[0054] As shown in the figure, we used the lafU pseudogene site in DPAH3 to increase one copy of the folP gene, and the D-pantothenic acid production of DPAH6 increased to 6.01 g / L. Therefore, overexpression of folP promotes the binding of pABA to the GTP pathway, which is an effective strategy to enhance folic acid synthesis and provide methyl carriers for one-carbon units.

[0055] Example 3: DPAH7 construction and shake flask fermentation

[0056] Using DPAH6 as the starting strain, we used CRISPR / Cas9 gene editing technology to integrate the serA and glyA gene clusters in the genome of strain DPAH6 using pseudogene sites, and designed dynamic regulatory elements to adjust the expression status of the gene cluster in real time. In response to the supply of methyl groups, we added another copy of the panB gene after the gene cluster, which was controlled by the in situ promoter PpanB (nucleotide sequences are shown in SEQ ID NO.4 and SEQ ID NO.5), and obtained DPA H7 (DPAH6derivative, yeeP::Trc-RBSApt2#82-serAglyApanB).

[0057] (1) Construction of pTarget-PAM-serAglyApanB plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as a template and pT-PAM-serAglyApanB-F / R as primers for PCR amplification. The PCR product was digested with Dpn I at 37°C for 3 h. The PCR product of pTarget-PAM-serAglyApanB was amplified with linearized primers pTarget-XF and pTarget-XR, and the pTarget-PAM-serAglyA linearized vector was purified by gel recovery for subsequent ligation with Donor DNA.

[0058] (2) Construction of pTD-Donor-serAglyApanB plasmid: Using the E. coli W3110 genome as a template, serAglyApanB-up-F and serAglyApanB-up-R were used as primers to amplify the upstream part (F1) of the donor DNA, and serAglyApanB-down-F and serAglyApanB-down-R were used as primers to amplify the downstream part (F2) of the donor DNA. The PCR fragments were purified by gel recovery to obtain F1 and F2; according to The pTarget-serAglyApanB linearized vector, fragments F1 and F2 were connected together according to the instruction manual of the kit (One step cloning kit, Vazyme Biotech, Nanjing, China), and the pTD-serAglyApanB plasmid was obtained by sequencing verification.

[0059] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH6 competent cell obtained in Example 4. The preparation method of the DPAH6 competent cell by electroporation was the same as that in Example 1 (3).

[0060] (4) DPAH7 positive colonies were constructed using the same method as in Example 1 (4).

[0061] (5) Plasmid elimination: The implementation method is the same as Example 1 (5) to obtain plasmid-free DPAH7 (DPAH6 derivative, yeeP::Trc-RBSApt2#82-serAglyApanB).

[0062] (6) The constructed DPAH7 production strain was used as a control group with the DPAH6 constructed in Example 2 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 4 shown.

[0063] As can be seen from the figure, serA and glyA overexpression are controlled according to the intracellular glycine concentration. When glycine accumulates to a certain level, it will fold and cover the ribosome site, inhibiting the translation of the gene cluster serA-glyA. When the intracellular content of glycine is low, the ribosome site will be exposed to enhance translation. In response to the supply of methyl, we added another copy of the panB gene after the gene cluster to obtain strain H7. The D-pantothenic acid production of DPAH7 was successfully increased to 6.52g / L. The expression of glyA was controlled in real time by the ribosomal switch, achieving moderate enhancement of key genes in the serine pathway. This strategy can reasonably regulate the serine synthesis rate and maintain intracellular glycine at a low level, successfully promoting D-pantothenic acid synthesis.

[0064] Example 4: DPAH8 construction and shake flask fermentation

[0065] Using DPAH7 as the starting strain, CRISPR / Cas9 gene editing technology was used to introduce the heterologous alsS gene into the genome of strain DPAH7, and codon optimization was performed (the nucleotide sequence is shown in SEQ ID NO.3) to obtain DPAH8 (DPAH7derivative, gapC::Trc-alsS*).

[0066] (1) Construction of pTarget-PAM-alsS plasmid: pTarget F plasmid (Addgene Plasmid #62226) was used as a template and pT-PAM-alsS-F / R as primers for PCR amplification. The PCR product was verified by nucleic acid gel electrophoresis and digested with Dp nI digestion enzyme at 37°C for 3 h. The product was then transformed into E. coli DH5α and screened on spectinomycin plates. The correct pTarget-PAM-alsS plasmid was obtained by sequencing for subsequent ligation with Donor DNA.

[0067] (2) Construction of pTD-Donor-BsalsS plasmid: First, using the E. coli W3110 genome as a template, alsS-up-F / R as primers were used to amplify the upstream part of the donor DNA (F1), and alsS-down-F / R as primers were used to amplify the downstream part of the donor DNA (F2). Then, using the B. subtilis 168 genome as a template, pTrc-BsalsS(2)F / R as primers were used to amplify the BsalsS gene fragment (F3) with the promoter pTrc, and the PCR fragments were purified by gel recovery to obtain F1, F2 and F3; the plasmid pTarget-alsS was incubated at 37°C for 8 hours with Xba I and Pst I, and the DNA fragment was recovered using the Clean up kit; according to The pTarget-alsS vector, fragments F1, F2 and F3 were connected together according to the instruction manual of the kit (One step cloning kit, Vazyme Biotech, Nanjing, China), and the pTD-BsalsS plasmid was obtained by sequencing verification.

[0068] (3) The pCas plasmid (Addgene Plasmid #62225) was introduced into the DPAH7 competent cell obtained in Example 5. The preparation method of the DPAH7 competent cell by electroporation was the same as that in Example 1 (3).

[0069] (4) DPAH8 positive colonies were constructed using the same method as in Example 1 (4).

[0070] (5) Plasmid elimination: The implementation method is the same as Example 1 (5) to obtain plasmid-free DPAH8 (DPAH7 derivative, gapC::Trc-alsS*).

[0071] (6) The constructed DPAH8 production strain was used as a control group with the DPAH7 constructed in Example 3 for shake flask testing and detection. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 5 shown.

[0072] Acetolactate synthase (alsS) catalyzes the formation of α-acetolactate from two molecules of pyruvate. Acetolactate synthase is involved in the synthesis of valine, leucine and isoleucine. As shown in the figure, by introducing heterologous alsS genes into the genome and optimizing codons, the expression efficiency of the gene in the host was improved, and the strain burden was small. Without adding pyruvate, the yield in the shake flask was increased, and the D-pantothenic acid yield of the DPAH8 strain increased to 6.85g / L.

[0073] Example 5: Application of D-pantothenic acid producing strain DPAH8 in microbial fermentation to produce D-pantothenic acid

[0074] Fermentation was carried out in a 5L fermenter (BIOTECH-5BG, Shanghai Baoxing), including the following steps:

[0075] (1) Seed culture: Inoculate DPAH8 into 10 mL LB medium on a plate and culture overnight at 37°C and 180 rpm on a shaker. Then, inoculate into two bottles containing 100 mL LB medium at a volume concentration of 1% as a secondary seed solution and culture for 7 to 12 h.

[0076] (2) Inoculation and fermentation: The volume of the fermentation medium in a 5L fermenter is 2L, sterilized at 115℃ for 30min. 25-30℃, initial ventilation volume 3-6L / min, initial stirring speed 300-450rpm, and pH adjusted with ammonia. A total of 200mL of two bottles of secondary seed liquid were transferred to a 5L fermenter containing 2L of non-resistant fermentation medium, and IPTG with a final concentration of 0.2mM was added at the same time, and the final concentrations were 5mg / L VB1, 2mg / L VB 12 , and 5-10mL of 10-40g / L isoleucine, and fermentation begins. During the fermentation process, the dissolved oxygen is maintained at 10%-30% by using dissolved oxygen serial speed, and the pH is maintained at 6.7-6.9 by using ammonia water as a neutralizer. The glucose concentration in the tank is controlled below 5g / L by pH linkage feeding, and the fermentation liquid is obtained by culturing at 28-37℃ for 3-4 days. The fermentation liquid is all the substances in the fermentation tank.

[0077] (3) After the fermentation supernatant was diluted 80 times, the diluted sample was treated with a water filter to remove impurities, and then HPLC was performed according to Example 1. 600 and the D-pantothenic acid content in the fermentation supernatant. Figure 6 shown.

[0078] By regulating the glycine metabolic pathway, methyl cofactor supply, folic acid production and serine synthesis pathway, the supply of one-carbon units was strengthened, and more metabolic flows were allowed to participate in the synthesis of D-pantothenic acid, and the D-pantothenic acid producing strain DPAH8 was obtained. As can be seen from the figure, the D-pantothenic acid production of the engineered strain DPAH8 increased to 112.62 g / L after 92 hours of fermentation in a 5L fermenter, greatly improving the synthesis of D-pantothenic acid.

[0079] The fermentation medium is composed of 20 g / L glucose, 16 g / L ammonium sulfate, 2 g / L anhydrous betaine, 2 g / L yeast powder, 2 g / L potassium dihydrogen phosphate, 0.5 g / L anhydrous magnesium sulfate, 1.5 g / L beta-alanine, 1 ml / L trace element solution, the solvent is deionized water, and the pH value is natural. The trace element solution is composed of 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 10 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, 0.02 g / L NiCl2·7H2O, and the solvent is deionized water.

[0080] The feed medium is composed of 500 g / L glucose, 10 g / L ammonium sulfate, 4 g / L anhydrous betaine, 2 g / L yeast powder, 14 g / L potassium dihydrogen phosphate, 8 g / L anhydrous magnesium sulfate, 60 g / L β-alanine, 2 ml / L trace element solution, the solvent is deionized water, and the pH value is natural.

[0081] The primer sequence information used in Examples 1 to 4 is shown in Table 2.

[0082] Table 2: Primer Sequences

[0083]

[0084] glyA-F ACACAGGAAACAGACCATGGAATTCATGTTAAAGCGTGAAATGAACAT

[0085] glyA-R CCGCCAAAACAGCCAAGCTTTTATGCGTAAACC GGGTAACG

[0086] folP-F TTTCACACAGGAAACAGACCATGCCATCACTCAGTAAAGAAGCG

[0087] folP-R CCGCCAAAACAGCCAAGCTTTCAGTTGTGATGACGCACAGCGC

[0088] folC-F TTTCACACAGGAAACAGACCATGATTATCAAAC GCACTCCTC

[0089] folC-R CCGCCAAAACAGCCAAGCTTTTACTTGCCACCG CTTCTCC

[0090] folM-F TTTCACACAGGAAACAGACCATGGGTAAAACCCAGCCCTTG

[0091] folM-R CCGCCAAAACAGCCAAGCTTTTAACGCAGATGACGACCGC

[0092] folA-F TTTCACACAGGAAACAGACCATGATCAGTCTGATTGCGGCG

[0093] folA-R CCGCCAAAACAGCCAAGCTTTTACCGCCGCTCCAGAATCT

[0094] alsS-R GCTATTTCTAGCTCTAAAACCCGTGGGCGATTTACAACTGACTAGTATTA

[0095] alsS-1 GCTTTTTTTGAATTCTCTAGAAAGGATATTATTATCCGCCGACATTGC

[0096] alsS-3 CCTGTGCGCGTTACAGTGCTTTTGGTTTTCATCAGTTCACC

[0097] alsS-2 CAAAGCACTGTAACGCGCACAGGCGGAG

[0098] alsS-RBS-F GGTCTGTTTCCTGTGTGAAACAATTCCACACATTATACGAGCCGGATGATTAAT

[0099] alsS-RBS-RTTTCACACAGGAAACAGACCATGACCAAAGCCACCAAAGAAC

[0100] alsS-6 TAATAGATCTAAGCTTCTGCAGATCGGCGGGGTTGGGTAT

[0101] The embodiments described above are merely descriptions of preferred implementations of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.

Claims

1. A method for constructing a genetically engineered bacterium that produces high levels of D-pantothenic acid, characterized in that: The method comprises: using CRISPR-Cas9-mediated gene editing technology to: overexpress the gcvTHP gene in the genome of the chassis bacteria; strengthen the folP gene; integrate the serA and glyA gene clusters and add a panB gene copy after the serAglyA gene cluster, wherein the serAglyA gene cluster is regulated by a dynamic regulatory element; and add an alsS gene optimized by a heterologous codon to obtain a genetically engineered bacterium with a high yield of D-pantothenic acid.

2. The method according to claim 1, characterized in that The method for strengthening the folP gene comprises: adding a folP gene copy at the lafU pseudogene site.

3. The method according to claim 1, characterized in that The dynamic regulatory element is the ribosomal switch Apt2#82.

4. The method according to claim 1, characterized in that The panB gene is regulated by the PpanB promoter.

5. The method according to claim 1, characterized in that The alsS gene is derived from Bacillus subtilis and is codon optimized.

6. The method according to claim 1, characterized in that The base bacteria is: E.coli W3110, Trc-EcilvD* / BspanBA* / CgpanC* / alsS* / BspanB* / nac GTG / ΔP 345ptsH / gltA GTG / gltA TTG / Trc-PpfkB.

7. The method according to claim 1, characterized in that The nucleotide sequences of the gcvTHP gene, folP gene, and alsS gene regulated by the Ptrc promoter are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively; the serAglyA gene cluster sequence regulated by the Apt2#82 ribosomal switch is shown in SEQ ID NO.4; and the nucleotide sequence of the panB gene regulated by the PpanB promoter is shown in SEQ.ID.NO.

5.

8. A genetically engineered bacterium with high production of D-pantothenic acid obtained by the method of any one of claims 1 to 7.

9. Use of the genetically engineered bacteria with high D-pantothenic acid production as claimed in claim 8 in the preparation of D-pantothenic acid by microbial fermentation.

10. The use according to claim 9, characterized in that The application method comprises: inoculating the genetically engineered bacteria with high D-pantothenic acid production into a fermentation medium, carrying out fed-batch fermentation culture for 72 to 96 hours at 28 to 37° C., 300 to 450 rpm, pH 6.7 to 6.9, and 10 to 30% dissolved oxygen, and separating and purifying after the fermentation to obtain the D-pantothenic acid.

Images