Method for improving high temperature resistance and gray mold resistance of tomato, SlWRKY5 overexpression vector and application of SlWRKY5 overexpression vector

Abstract

The invention relates to the technical field of gene engineering, and particularly discloses a method for improving high temperature resistance and gray mold resistance of tomatoes, an SlWRKY5 overexpression vector and application of the SlWRKY5 overexpression vector. The overexpressed SlWRKY5 gene is used for improving the heat resistance of the tomato and enhancing the resistance of the tomato to botrytis cinerea. Through overexpression of the SlWRKY5 gene, the heat resistance of the tomato is remarkably improved, and the resistance of the tomato to botrytis cinerea is enhanced.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a method for improving the high temperature resistance and gray mold resistance of tomatoes, and a SlWRKY5 overexpression vector and application thereof. Background Art

[0002] Tomato (Solanum lycopersicum L.) is one of the important vegetable crops in my country, with an annual cultivation area of ​​more than 1 million hm2. 2 , the output of fresh tomatoes ranks first in the world. However, tomatoes are a crop that is sensitive to temperature and diseases. In my country's tomato production facilities, they often encounter high temperature damage and aggravate diseases, causing serious economic losses to tomato production.

[0003] The suitable growth temperature for tomato seedlings during the growth period is about 24-26℃ during the day and about 18℃ at night. Generally, varieties will be damaged when the day temperature is 34℃ and the night temperature is above 20℃. When the temperature rises to 38℃ during the day or above 26℃ at night, tomatoes will be seriously damaged. High temperature during the flowering and fruiting period will cause the vitality of tomato pollen to decrease, the stigma to be exposed, and the fruit setting rate to decrease, resulting in a serious decline in yield and quality. When the temperature rises, the transpiration of the plant will first intensify, a large amount of water will be lost, and the water physiological balance in the plant will be unbalanced, causing the leaves to wilt, photosynthesis to be blocked, and growth to slow down. Under high temperature stress, cells will produce a large amount of reactive oxygen species (ROS), causing peroxidation of membrane lipids and proteins, and the generated malondialdehyde will further aggravate the damage to the cell membrane, and in severe cases, it can even cause cell death.

[0004] In high temperature and high humidity environments, tomatoes are also very susceptible to gray mold, a necrotic fungus with Botrytis cinereal as the pathogen. It is mainly spread by its conidia. It is a common disease in facility cultivation and difficult to prevent and control in production. When the environment is suitable, gray mold invades the host through young, weak tissues or wounds to achieve initial infection, and a gray mold layer may form after the disease occurs. As the pathogen develops, the leaves appear water-soaked, with irregular edges and light brown or yellow-brown spots; the fruit skin becomes grayish white, the flesh becomes water-soaked and soft, and a gray mold layer with fluff grows at the spots. The losses caused by the infection of gray mold to tomatoes are very serious, causing serious damage from the initial seedling growth to the final fruit transportation and sales process.

[0005] Using modern molecular biotechnology to discover tomato heat-resistant and disease-resistant gene resources and regulating their expression in tomatoes is an important means to breed new stress-resistant and disease-resistant tomato varieties. WRKY transcription factors are involved in a variety of plant biological processes, especially in regulating biotic and abiotic stresses. SlWRKY5 transcription factor is a member of the WRKY transcription factor family. It is necessary to develop the related functions of SlWRKY5 transcription factor to improve high temperature tolerance and gray mold resistance in tomato cultivation. Summary of the invention

[0006] In order to develop the application of SlWRKY5 transcription factor in improving the high temperature resistance and gray mold resistance of tomatoes in tomato cultivation, the present invention provides a method for improving the high temperature resistance and gray mold resistance of tomatoes, and a SlWRKY5 overexpression vector and application. The present invention significantly improves the heat resistance of tomatoes and enhances the resistance of tomatoes to gray mold by overexpressing the SlWRKY5 gene.

[0007] The present invention provides an application of a preparation for overexpressing the SlWRKY5 gene in tomato cultivation. The preparation for overexpressing the SlWRKY5 gene improves the heat resistance of tomatoes and enhances the resistance of tomatoes to gray mold through overexpression of the SlWRKY5 gene.

[0008] The invention regulates the overexpression of the SlWRKY5 gene in tomatoes, thereby enhancing the heat resistance of tomatoes and improving the resistance to gray mold.

[0009] Furthermore, the preparation for overexpressing the SlWRKY5 gene is a SlWRKY5 overexpression vector, and the SlWRKY5 overexpression vector is constructed to transform competent cells, and then to infect tomato plants to improve the heat resistance of tomatoes and enhance the resistance of tomatoes to gray mold.

[0010] Furthermore, the process of infecting tomato plants is: infecting tomato cotyledons with the Agrobacterium strain containing the SlWRKY5 overexpression vector.

[0011] Furthermore, the preparation for overexpressing the SlWRKY5 gene contains the SlWRKY5 overexpression vector as the only effective ingredient.

[0012] Furthermore, the SlWRKY5 overexpression vector was constructed by recombining the SlWRKY5 gene fragment shown in SEQ ID NO.1 and the linearized pHellsgate8 vector.

[0013] Furthermore, the primers for amplifying the SlWRKY5 gene fragment are the SlWRKY5-OE-FW primer shown in SEQ ID NO.2 and the SlWRKY5-OE-RV primer shown in SEQ ID NO.3.

[0014] The present invention also provides a method for constructing a SlWRKY5 overexpression vector, comprising the following steps:

[0015] Amplification of the SlWRKY5 gene fragment: Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO.2 and SEQ ID NO.3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely the SlWRKY5 gene fragment;

[0016] The PCR amplification reaction system is: 1U / μL Phanta Max Super-Fidelity DNA Polymerase 1μL; 2×Phanta Max Buffer 25μL; 10μM upstream primer 2μL; 10μM downstream primer 2μL; DNA template 1μL; dNTP Mix 1μL; ddH2O up to 50μL;

[0017] The SlWRKY5 gene fragment and the linearized pHellsgate8 vector were recombined to obtain the SlWRKY5 overexpression vector;

[0018] The recombination system of SlWRKY5 gene fragment and linearized pHellsgate8 vector is: linearized vector 40ng, SlWRKY5 gene fragment recovery product 6ng, ExnaseII 1ul, 2×CE II Buffer 2ul, ddH2O supplemented to 10ul.

[0019] The present invention also provides a SlWRKY5 overexpression vector obtained by the construction method.

[0020] The present invention also provides a method for improving the high temperature resistance and gray mold resistance of tomatoes, comprising the following steps:

[0021] Amplification of the SlWRKY5 gene fragment: Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO.2 and SEQ ID NO.3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely the SlWRKY5 gene fragment;

[0022] The SlWRKY5 overexpression vector was obtained by recombining the SlWRKY5 gene fragment and the linearized pHellsgate8 vector;

[0023] The SlWRKY5 overexpression vector was heat-shock transformed into Escherichia coli competent cells, positive clones were screened and recombinant plasmids were extracted, and then transformed into Agrobacterium C58 to obtain the Agrobacterium strain containing the SlWRKY5 overexpression vector;

[0024] Tomato cotyledons were infected with Agrobacterium strains containing SlWRKY5 overexpression vectors to construct tomato transgenic plants that were resistant to high temperature and gray mold.

[0025] Furthermore, the PCR amplification program was as follows: preliminary denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention improves the heat resistance and resistance to Botrytis cinerea of ​​tomatoes by regulating the overexpression of the SlWRKY5 gene in tomatoes. The SlWRKY5 transcription factor in tomatoes is cloned and overexpressed in tomatoes. Under high temperature stress, the SlWRKY5 overexpressing plants show obvious heat resistance compared with wild-type tomatoes Ailsa Craig (AC), and stress-related indicators such as relative conductivity, malondialdehyde content and active oxygen are significantly lower than those of AC. When SlWRKY5 transgenic plants are infected with Botrytis cinerea, the SlWRKY5 overexpressing plants show stronger resistance to Botrytis cinerea.

[0028] The present invention develops a new use of the SlWRKY5 gene in tomatoes. Overexpression of the SlWRKY5 gene significantly improves the heat resistance of tomatoes and enhances the resistance of tomatoes to gray mold. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 The morphology, expression level and target detection of SlWRKY5 transgenic plants;

[0031] In the figure, a shows the morphology of SlWRKY5 transgenic plants;

[0032] b Detection of SlWRKY5 expression in SlWRKY5 transgenic plants;

[0033] c shows the target site detection in SlWRKY5 knockout plants;

[0034] d is the plant height statistics of SlWRKY5 transgenic plants.

[0035] Figure 2The morphology of AC and SlWRKY5 transgenic plants before and after high temperature treatment at 42℃.

[0036] Figure 3 The physiological indexes of AC and SlWRKY5 transgenic plants at different time points under 42℃ high temperature treatment;

[0037] In the figure, a is the electrical conductivity (REC) data of SlWRKY5 transgenic plants at different time points under 42°C high temperature treatment;

[0038] b shows the malondialdehyde (MDA) data of SlWRKY5 transgenic plants at different time points after high temperature treatment at 42℃;

[0039] c is the DAB staining of leaves of SlWRKY5 transgenic plants before and after high temperature treatment at 42℃;

[0040] d shows the NBT staining of leaves of SlWRKY5 transgenic plants before and after high temperature treatment at 42°C.

[0041] Figure 4 The susceptibility of AC and SlWRKY5 transgenic plants to Botrytis cinerea 3 days after treatment. DETAILED DESCRIPTION

[0042] The specific embodiments of the present invention are described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The experimental methods described in the embodiments of the present invention are conventional methods unless otherwise specified, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0043] Example 1: Application of overexpression of SlWRKY5 gene in tomato cultivation.

[0044] 1. Experimental Materials

[0045] The tomatoes used were common cultivated tomatoes Ailsa Craig (AC), purchased from the Tomato Genetic Resource Center (TGRC), website: https: / / tgrc.ucdavis.edu / .

[0046] Escherichia coli Trans1-T1 was purchased from Beijing Quanshijin Biotechnology Co., Ltd.

[0047] Agrobacterium strain C58 was purchased from Yangling Jinbairui Biotechnology Co., Ltd.

[0048] The backbone vector of the SlWRKY5 gene overexpression vector is pHellsgate8 vector, which is described in the literature “Li GB, Wang JF, Zhang CL, Ai G., Zhang DD, Wei J, Cai LY, Li CB, Zhu WZ, Robert ML, Zhang JH * .L2,a chloroplast metalloproteinase,regulates fruit ripening byparticipating in ethylene autocatalysis under the control of ERFs.Journal of Experimental Botany,2021,72(20):7035-7048".

[0049] The PTX041 and 043 vectors are described in the document “Deng, L., Wang, H., Sun, C., Li, Q., Jiang, H., Du, M., Li, C.-B., Li, C., Efficient generation of pink-fruited tomatoes using CRISPR / Cas9 system, Journal of Genetics and Genomics (2017), doi: 10.1016 / j.jgg.2017.10.002.”

[0050] 2. Construction of SlWRKY5 overexpression vector and SlWRKY5 knockout expression vector

[0051] 1. Construction of SlWRKY5 overexpression vector

[0052] (1) Cloning of the tomato SlWRKY5 gene

[0053] The cDNA sequence of the SlWRKY5 gene was found in the tomato genome database SNG website (http: / / solgenomics.net / ), as shown in SEQ ID NO.1. The amplification primers of the SlWRKY5 gene were designed using Snap Gene software, and pHellsgate8 vector-specific homologous recombination arms were added to the 5' ends of the designed primers. The upstream and downstream primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.

[0054] SEQ ID NO.1:

[0055]

[0056] SlWRKY5-OE-FW (SEQ ID NO. 2):

[0057] CATTTGGAGAGGACACGCTCGAGATGGGGGAAAACTTCAAAGCT;

[0058] SlWRKY5-OE-RV (SEQ ID NO. 3):

[0059] TCTCATTAAAGCAGGACTCTAGACTACACTTGTATTTCACTGGTATGA.

[0060] Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO.2 and SEQ ID NO.3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment with a length of 1461 bp, namely the SlWRKY5 gene fragment.

[0061] The reaction system for PCR amplification is: Phanta Max Super-Fidelity DNA Polymerase (1U / μL) 1μL; 2×Phanta Max Buffer 25μL; upstream primer (10μM) 2μL; downstream primer (10μM) 2μL; DNA template 1μL; dNTP Mix 1μL; ddH2O up to 50μL.

[0062] The reaction procedure was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 35 cycles; final extension at 72°C for 10 min.

[0063] (2) Construction of SlWRKY5 overexpression vector

[0064] The amplified SlWRKY5 gene fragment with a length of 1461 bp shown in SEQ ID NO.1 and the linearized pHellsgate8 vector were recombined using the homologous recombinase ExnaseII (Novozymes, Nanjing) to obtain a recombinant vector.

[0065] The reaction system for recombination and ligation was: 40 ng of linearized vector, 6 ng of SlWRKY5 gene fragment recovery product, 1 ul of ExnaseII, 2 ul of 2×CE II Buffer, and ddH2O supplemented to 10 ul. The reaction conditions were: 37°C, 30 min.

[0066] The recombinant vector was heat-shock transformed into competent E. coli cells, and the bacterial solution PCR detection was performed. The primers used in the bacterial solution PCR detection were 35S with the sequence shown in SEQ ID NO.4 and gat8-RV with the sequence shown in SEQ ID NO.5.

[0067] SEQ ID NO.4(35S): ACGCACAATCCCACTATCCTTC;

[0068] SEQ ID NO. 5 (gat8-RV): CATAAAAATACGATAGTAACGGGTG.

[0069] For the detection of recombinant vector Escherichia coli, the reaction system was: Taq enzyme (5U / μL) 0.1μL; 2×Taq Buffer 2μL; forward primer (10μM) 0.4μL; reverse primer (10μM) 0.4μL; DNA template 1μL; dNTPs 0.4μL; ddH2O to 20μL, and the reaction procedure was: pre-denaturation at 94℃ for 3min; denaturation at 94℃ for 30s, annealing at 55℃ for 30s, extension at 72℃ for 1min 30s, 35 cycles; final extension at 72℃ for 10min.

[0070] The fragment of 1690bp (including part of the vector fragment) detected by gel electrophoresis is the positive clone that has been successfully transformed. The positive single clone that has been successfully transformed is randomly picked and placed in liquid LB medium containing 100mg / L spectinomycin (Spe), and the bacteria are shaken at 37℃ for 5h. The recombinant plasmid is identified by PCR detection and sequencing. After correct identification, the recombinant plasmid is extracted and used to transform Agrobacterium C58. The specific transformation steps are as follows:

[0071] Take the competent state and freeze-thaw on ice, add 3μl plasmid to the competent state, mix well, stand on ice for 5min, then put the competent state centrifuge tube into liquid nitrogen for 5min, and then incubate the competent state centrifuge tube at 37℃ for 5min. After the end of 37℃, put the competent state on ice for 5min. Then add 500μl blank liquid LB in the clean bench to the competent state, and shake it at 28℃ for 3h. Then apply the plate with rifampicin (Rif) and Spe resistance, invert and culture at 28℃ for 2 days, and perform PCR detection after the monoclonal growth. The detection primers are 35S and gat8-RV. The fragment of 1690bp (including part of the vector fragment) detected by gel electrophoresis is a positive monoclonal clone, that is, the SlWRKY5 overexpression vector is obtained and stored for later use.

[0072] 2. Construction of SlWRKY5 knockout expression vector

[0073] (1) Design of sgRNA target sequence

[0074] The sgRNA target sequence was designed using the online software CCTop-CRISP R / Cas9 target online predictor, and two highly specific sequences on the first exon were screened as target site sequences (Target 1 and Target 2). The selected target site sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 7.

[0075] Target 1 (SEQ ID NO.6): CCTAAAGACTCATTTTTTTGG;

[0076] Target 2 (SEQ ID NO. 7): GAATCGACCCATGAATCTAA.

[0077] (2) Primer design

[0078] Primers were designed for the target sites of the PTX041 vector and the target gene, and the upstream and downstream primer sequences are shown in SEQ ID NO.8 and SEQ ID NO.9, respectively.

[0079] SlWRKY5-CR-FW (SEQ ID NO.8):

[0080] GAATCTAACAGTGTAGTTTGCCTAAAGACTCATTTTTTGGGTTTAGA GCTAGAAATAG;

[0081] SlWRKY5-CR-RV (SEQ ID NO.9):

[0082] GCTATTTCTAGCTCTAAAACTTAGATTCATGGGTCGATTCCAAACTAC ACTGTTAGATTC.

[0083] (3) Construction of SlWRKY5 knockout expression vector

[0084] Using phanta enzyme, intermediate vector 043 as template, and the above-synthesized primers were used for PCR amplification to obtain a 600bp double sgRNA cloning frame, and then the fragment was recovered, homologously recombined with linearized pTX041 to form a recombinant vector, namely the SlWRKY5 knockout expression vector. The PCR system, recombination method, transformation of Escherichia coli and Agrobacterium method refer to the method steps for constructing the SlWRKY5 overexpression vector. The primers used for PCR detection of knockout vector bacterial solution are pTX-Fw and pTX-Rv.

[0085] pTX-Fw (SEQ ID NO. 10): AGCGGATAACAATTTCACACAGGA;

[0086] pTX-Rv (SEQ ID NO. 11): GCAGGCATGCAAGCTTATTGG.

[0087] 3. Agrobacterium-mediated genetic transformation of tomato and identification of pure plants

[0088] Cultivated tomato AC was used as the experimental material. The sterilized seeds were inoculated on 1 / 2MS medium. The grown cotyledons were cut into explants for dark culture. The tomato cotyledons were infecting with Agrobacterium strains containing SlWRKY5 overexpression vectors and knockout vectors. The explants were cultured with antibiotics twice to grow seedlings with growth points. The seedlings were transferred to rooting medium for rooting culture. Finally, the rooted resistant seedlings were transferred to plastic cups filled with nutrient soil and adapted to culture in a plant growth room for 1 month. DNA of transgenic seedlings was extracted for PCR positive detection. The primers used for overexpression detection were 35S and SlWRKY5-OE-RV, and the primers used for knockout plant detection were PTX-FW and PTX-RV. SlWRKY5-OE transgenic plants were obtained, and the positive T0 generation plants were transferred to a glass greenhouse for greenhouse culture. After the results were obtained, the seeds of the T0 generation positive transgenic plants were harvested. The knockout plants also need to be further tested for target editing. The target sites are amplified using SlWRKY5-CR-det-FW and SlWRKY5-CR-det-RV, sequenced, and compared with the reference gene sequence. Individual plants with editing or sequencing double peaks are selected for self-pollination screening. The positive and edited T0 generation plants are transferred to a glass greenhouse for cultivation, and the seeds of T0 generation transgenic plants are harvested after the results are obtained. The knockout plants continue to detect target editing in the T1 generation, and pure and edited individual plants are selected for harvesting for subsequent phenotypic identification.

[0089] After screening, pure SlWRKY5 transgenic plants ( Figure 1 a), the overexpression lines include SlWRKY5-OE-5, SlWRKY5-OE-7 and SlWRKY5-OE-19, which are abbreviated as OE-5, OE-7 and OE-19, respectively, and the CRISPR / Cas9 knockout lines include SlWRKY5-CR-1, SlWRKY5-CR-8 and SlWRKY5-CR-15, which are abbreviated as CR-1, CR-8 and CR-15, respectively.

[0090] The expression level of SlWRKY5 in SlWRKY5 overexpressing plants was detected. The results showed that the expression level of SlWRKY5 in the three strains increased by about 50-90 times, and was significantly overexpressed ( Figure 1b). The target sites of SlWRKY5 knockout plants were detected, and the results showed that the second target site of SlWRKY5-CR-1 was edited, with a deletion of 4 bases; the second target site of SlWRKY5-CR-8 was also edited, with a deletion of 2 bases; both target sites of SlWRKY5-CR-15 were edited, with a deletion of 6 bases in the first target site and 1 base in the second target site ( Figure 1 c). Further measurement of the plant height of SlWRKY5 transgenic plants revealed that SlWRKY5 overexpression resulted in a compact tomato plant shape and dwarfed plants ( Figure 1 d).

[0091] 4. Evaluation of heat tolerance of SlWRKY5 transgenic materials

[0092] AC (wild type) and SlWRKY5 transgenic plants were cultivated in an artificial plant growth chamber to further identify the tolerance of SlWRKY5 transgenic plants to high temperature. Tomato seedlings that had grown for about 40 days and had five leaves and one heart were placed in a light incubator set at a constant temperature of 42°C and 16h light / 8h dark for high temperature treatment. During this period, the damage of the plants under high temperature was observed, and the status of the plants was photographed 24h after high temperature treatment ( Figure 1 ), and samples were taken at 0h, 6h, 12h, and 24h after high temperature treatment, and the conductivity and malondialdehyde of different strains were measured. DAB and NBT staining were performed to determine the damage of plants of different strains. The conductivity, malondialdehyde, and DAB and NBT staining methods refer to the literature "Wang PJ, Xu ZJ, Zhang Y, Ma YB, Yang JY, Zhou F, Gao Y, Li GB*, Hu XH * .Over-expression of spermidine synthase 2(SlSPDS2) in tomato plants improves saline-alkali stress tolerance by increasing endogenous polyamines content to regulate antioxidant enzyme system and ionic homeostasis. Plant Physiology and Biochemistry, 2022, 192(2022):172-185."

[0093] After testing, it was found that the conductivity of tomato plants began to increase gradually after 12 hours of high temperature treatment, and increased rapidly after 24 hours of high temperature. However, the conductivity of SlWRKY5 overexpression plants after 24 hours of high temperature was significantly lower than that of AC and knockout plants ( Figure 3 a), which also shows that the degree of damage of SlWRKY5 overexpression plants under high temperature is less than that of AC plants. The malondialdehyde content of leaves of AC and SlWRKY5 transgenic plants was further measured after high temperature treatment for 0h, 6h, 12h, and 24h. It was found that the malondialdehyde content of AC and knockout plants increased rapidly after high temperature treatment for 12 and 24h, while the malondialdehyde content of SlWRKY5 overexpression plants increased only slightly ( Figure 3 b) DAB staining and NBT staining were used to detect the H2O2 and O2· - The accumulation of H2O2 and O2· - The content was significantly lower than that in AC plants and SlWRKY5 knockout plants ( Figure 3 C and Figure 3 d). This indicates that SlWRKY5 overexpressing plants are less damaged under high temperature stress, and overexpression of the SlWRKY5 gene significantly improves the heat tolerance of tomatoes.

[0094] 5. Evaluation of resistance of SlWRKY5 transgenic materials to gray mold

[0095] Inoculate the gray mold stored in a -80℃ refrigerator onto the PAD medium and culture it in an incubator for about 14 days. At this time, sclerotia are produced in the medium, and the gray mold spores are relatively mature and easy to infect. Use a medicine spoon to gently scrape the mycelium on the surface of the medium, wash as many spores as possible into sterile water, and then use a pipette to transfer the sterile water containing spores to a 15ml centrifuge tube pre-laid with filter paper. Centrifuge at 600g for 10 minutes, pour off the supernatant, and add sterile water to resuspend the gray mold spores. Use a hemocytometer to count the spore concentration and dilute the gray mold spore suspension to 10 5 / ml, used for inoculation experiments.

[0096] The tomato seedlings were grown in a plant growth incubator for about 40 days. When they had five leaves and one heart, they were infected with Botrytis cinerea. The spore suspension of Botrytis cinerea was evenly sprayed on the back of the third and fourth leaves from top to bottom of the plant. The plants continued to be cultured in the growth chamber with a relative humidity of 95% and a temperature of 25°C / 18°C (day / night). The infection of Botrytis cinerea was observed after 3 days. The observation results showed that the leaves of the SlWRKY5 knockout plants were all infected and wilted, while the leaves of the SlWRKY5 overexpression plants were only susceptible to the infection and wilted on the leaves sprayed with the spore suspension of Botrytis cinerea, and the rest of the leaves were not infected. This shows that SlWRKY5 overexpression significantly improves the resistance of tomatoes to Botrytis cinerea ( Figure 4 ).

[0097] Although preferred embodiments of the present invention have been described, additional changes and modifications may occur to these embodiments once those skilled in the art are aware of the basic inventive concepts.

[0098] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Application of a preparation for overexpressing the SlWRKY5 gene in tomato cultivation, characterized in that: The preparation overexpressing the SlWRKY5 gene improves the heat tolerance of tomatoes and enhances the resistance of tomatoes to gray mold through the overexpression of the SlWRKY5 gene.

2. Use of the preparation for overexpressing the SlWRKY5 gene according to claim 1 in tomato cultivation, characterized in that: The preparation for overexpressing the SlWRKY5 gene is a SlWRKY5 overexpression vector. The SlWRKY5 overexpression vector is constructed to transform competent cells and then infect tomato plants, thereby improving the heat resistance of tomatoes and enhancing the resistance of tomatoes to gray mold.

3. Use of the preparation for overexpressing the SlWRKY5 gene according to claim 2 in tomato cultivation, characterized in that: The process of infecting tomato plants is as follows: the Agrobacterium strain containing the SlWRKY5 overexpression vector is infected into tomato cotyledons.

4. Use of the preparation for overexpressing the SlWRKY5 gene in tomato cultivation according to claim 2, characterized in that: The SlWRKY5 overexpression vector is obtained by recombining the SlWRKY5 gene fragment shown in SEQ ID NO.1 and the linearized pHellsgate8 vector.

5. Use of the preparation for overexpressing the SlWRKY5 gene according to claim 4 in tomato cultivation, characterized in that: The primers for amplifying the SlWRKY5 gene fragment are the SlWRKY5-OE-FW primer shown in SEQ ID NO.2 and the SlWRKY5-OE-RV primer shown in SEQ ID NO.

3.

6. A method for constructing a SlWRKY5 overexpression vector, characterized in that: Here are the steps: Amplification of the SlWRKY5 gene fragment: Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO.2 and SEQ ID NO.3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely the SlWRKY5 gene fragment; The PCR amplification reaction system is: 1U / μL Phanta Max Super-Fidelity DNA Polymerase 1μL; 2×Phanta Max Buffer 25μL; 10μM upstream primer 2μL; 10μM downstream primer 2μL; DNA template 1μL; dNTPMix 1μL; ddH2O up to 50μL; Recombining the SlWRKY5 gene fragment and the linearized pHellsgate8 vector to obtain the SlWRKY5 overexpression vector in claim 2; The recombination system of SlWRKY5 gene fragment and linearized pHellsgate8 vector is: linearized vector 40ng, SlWRKY5 gene fragment recovery product 6ng, ExnaseII 1ul, 2×CE II Buffer 2ul, ddH2O supplemented to 10ul.

7. A SlWRKY5 overexpression vector obtained by the construction method according to claim 6.

8. A method for improving the heat resistance and gray mold resistance of tomatoes, characterized in that: The steps include: Amplification of the SlWRKY5 gene fragment: Using tomato cDNA as a template, the gene fragments shown in SEQ ID NO.2 and SEQ ID NO.3 as a primer pair, and phanta enzyme, PCR amplification was performed to obtain a gene fragment of 1461 bp in length, namely the SlWRKY5 gene fragment; Recombining the SlWRKY5 gene fragment and the linearized pHellsgate8 vector to obtain the SlWRKY5 overexpression vector in claim 2; The SlWRKY5 overexpression vector was heat-shock transformed into Escherichia coli competent cells, positive clones were screened and recombinant plasmids were extracted, and then transformed into Agrobacterium C58 to obtain the Agrobacterium strain containing the SlWRKY5 overexpression vector; Tomato cotyledons were infected with Agrobacterium strains containing SlWRKY5 overexpression vectors to construct tomato transgenic plants that were resistant to high temperature and gray mold.

9. The method for improving the high temperature resistance and gray mold resistance of tomatoes according to claim 8, characterized in that: The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, 35 cycles; and final extension at 72°C for 10 min.

Images